Retraining and Optimizing DNA-Hydrolyzing Deoxyribozymes for

Subscriber access provided by UNIVERSITY OF TOLEDO LIBRARIES

Article

Retraining and Optimizing DNA-hydrolyzing Deoxyribozymes for Robust Single- and Multiple-turnover Activities Xinyu Du, Xin Zhong, Wei Li, Hua Li, and Hongzhou Gu ACS Catal., Just Accepted Manuscript • DOI: 10.1021/acscatal.8b01466 • Publication Date (Web): 24 May 2018 Downloaded from http://pubs.acs.org on May 24, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Retraining and Optimizing DNA-hydrolyzing Deoxyribozymes for Robust Single- and Multipleturnover Activities Xinyu Du†,‡, Xin Zhong§,‡, Wei Li†, §, Hua Li§,* and Hongzhou Gu†, §,* †

Fudan University Shanghai Cancer Center, and Institutes of Biomedical Sciences, Fudan

University, Shanghai 200032, China §

Shanghai Institute of Cardiovascular Diseases, Zhongshan Hospital, Fudan University,

Shanghai 200032, China * To whom correspondence should be addressed.

ACS Paragon Plus Environment

1

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 32

ABSTRACT: Recently we reported two classes of Zn2+-dependent DNA-hydrolyzing deoxyribozymes. The class I deoxyribozymes can adopt a secondary structure of either hairpin or stem-loop-stem. The corresponding most active representatives, I-R1 and I-R3, exhibit singleturnover kobs values of ~0.059 and ~1.0 min-1 at 37 ℃, respectively. Further analysis revealed that I-R3 could perform slow multiple-turnover catalysis with the kcat of ~0.017 min-1 at 37 ℃. In this study, we sought to retrain and optimize the class I deoxyribozymes for robust single- and multiple-turnover cleavage activities. Refined consensus sequences were derived based on the data of in vitro reselection from the degenerate DNA pools. By examining individual candidates, we obtained the I-R1 mutants I-R1a-c with improved single-turnover kobs values of 0.68-0.76 min-1 at 37 ℃, over 10 times faster than I-R1. Meanwhile, we further demonstrated that I-R1a-c and I-R3 are thermophilic. As temperature went higher beyond 45 ℃, I-R3 cleaved faster with the kobs value reaching its maximum of ~3.5 min-1 at 54 ℃. Using a series of the kobs values of IR3 from 37 ℃ to 54 ℃, we calculated the apparent activation energy Ea to be ~15 ± 3 kcal/mol for the DNA-catalyzed hydrolysis of DNA phosphodiester bond. In addition, we were able to design a simple yet efficient thermal-cycling protocol to boost the effective kcat of I-R3 from 0.017 to 0.50 min-1, which corresponds to a ~30-fold improvement of the multiple-turnover activity. The data and findings provide insights on the enzymatic robustness of DNA-catalyzed DNA hydrolysis and offer general strategies to study various DNA enzymes.

KEYWORDS: DNA-hydrolyzing, deoxyribozymes, single-turnover, multiple-turnover, thermal cycling


2

Page 3 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

INTRODUCTION Deoxyribozymes are DNA molecules that form structures capable of catalyzing chemical reactions. Since the discovery in 1994 of DNAs that cleave a RNA phosphoester bond (1), deoxyribozymes that catalyze various chemical reactions, including DNA phosphorylation (2,3), adenylation (4), deglycosylation (5), DNA or RNA ligation (6-8), nucleopeptide linkage formation (9), etc. have been isolated and identified by in vitro selection (10-14). In recent years, we (15) and others (16-18) found that DNA can directly hydrolyze DNA phosphodiester bonds, an extremely challenging chemical reaction that overcame a more than 1012-fold rate gap due to the high stability of DNA linkages. Our previous selection work revealed two classes of such deoxyribozymes that use Zn2+ as a cofactor (15). Both classes hydrolyze DNA at specific sites, and yield 3′ hydroxyl and 5′ phosphate termini on the 5′ and 3′ cleavage products, respectively. Based on the high throughput sequencing data of our selection pool, we built the original consensus sequences and secondary structure models for the two classes. Class I is small and contains fifteen conserved nucleotides within a loop region flanked by one or two base-paired stems. Representatives of class I recognize substrate sequences of GTTGAAG and hydrolyze the phosphodiester bond between the dinucleotide ApA. Interestingly, the two most active representatives I-R1 & -R3, with one flanking stem in the former and two the latter, exhibited an about 17-fold difference in terms of the single-turnover catalytic speed (kobs: 0.059 min-1 vs. 1.0 min-1 at 37 ℃), though the conserved sequences identified in the two were the same (Figure 1A). Whether the disparity of catalytic activity between I-R1 and I-R3 came from the additional P2 stem remained a question.


3

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 32

The class I Zn2+-dependent deoxyribozymes seem to favor high reaction temperatures. In our previous study (15), we found that I-R3 catalyzed DNA hydrolysis with a kobs value of ~0.0058 min-1 at 23 ℃. As temperature rose to 37 ℃ and 45 ℃, the kobs values increased to 1.0 min-1 and 1.6 min-1, respectively. Temperatures higher than 45 ℃ were thought to denature the secondary structure of I-R3, thus not tested in the previous study. Owning to the existence of two stems, for I-R3 we were able to engineer a bimolecular construct with an enzyme (E) DNA strand targeting a substrate (S) strand by flanking base pairs (binding arms), and perform multiple-turnover reactions. Like those reported by the Silverman group (16), DNA-hydrolyzing deoxyribozyme IR3 has a slow turnover rate. For a reaction mixture with a 1:200 molar ratio of E to S, 8% of the substrate DNAs were hydrolyzed after a 15-hour incubation at 37 ℃, which corresponds to nearly one hour per turnover or a kcat value of ~0.017 min-1. This is about two orders of magnitude less efficient than many protein enzymes that can process DNA such as restriction enzymes EcoRI (19) and EcoRV (20), which turnover in seconds to minutes. Comparing to restriction enzymes, in terms of turnover the deoxyribozyme I-R3 and many others have the same limitation: The strong binding arms that are necessary for the accomplishment of deoxyribozyme cleavage within a turnover would inevitably slow down the product release and inhibit the multiple turnovers of deoxyribozymes. Although the best-performing class I deoxyribozyme I-R3 has an impressive kobs value of 1.0 min-1 at 37 ℃, we suspected that there might be sequence variations for class I to improve. Meanwhile, we wanted to optimize the turnover rate of class I deoxyribozymes to be comparable to protein enzymes. In this study, based on the sequences of I-R1 and I-R3, we created two degenerate DNA libraries and used in vitro reselection to search for their mutants that may hydrolyze DNA faster. The refined consensus sequences and secondary structural models for the


4

Page 5 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

class I deoxyribozymes are presented. We identified three mutants of I-R1 (I-R1a-c) which hydrolyze DNA over 10 times faster than I-R1, with kobs values around 0.68-0.76 min-1 at 37 ℃. Each mutant contains only two nucleotide variations in the loop region of the hairpin structure of I-R1. I-R1a-c are comparable to I-R3 for the single-turnover activity, indicating that the previously observed disparity of catalytic activity between the hairpin and stem-loop-stem structures is largely not related to the additional P2 stem. In addition, we found two common variable positions in class I deoxyribozymes. After examining the catalytic activity of all possible combinations of the two positions in I-R3, we realized that the current sequence of I-R3 is very likely the best for class I, and there is no room in sequence variations to further boost the catalytic speed of I-R3. However, with more base-pairs designed into the stems of I-R3 to stabilize its secondary structure at high temperatures, we further confirmed that I-R3 is thermophilic and it can cleave DNA with a maximum kobs value of ~3.5 min-1 and a singleturnover yield above 85% at 54 ℃. The apparent activation energy Ea for the hydrolysis of DNA phosphodiester bond was calculated to be ~15 ± 3 kcal/mol based on a series of the kobs values of I-R3 from 37 ℃ to 54 ℃. Moreover, using a simple thermal-cycling procedure to promote the rate limiting dissociation step during multiple-turnover reactions, we were able to accelerate the effective turnover rate of I-R3 from ~0.017 to 0.50 min-1, and efficiently cleave natural DNA － the M13mp18 genome in a multiple-turnover manner with designed I-R3 enzyme strands attacking potential I-R3 substrate regions in the genome. Thus, we present significant insights into the capabilities of the class I DNA-hydrolyzing deoxyribozymes and illustrate general strategies for studying other deoxyribozymes. EXPERIMENTAL SECTION


5

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 32

In vitro reselection The

parental

class

I

representatives

I-R1

(5′-

pGGTAGCATGTACAGCCATAGTTGAGCAATTAGTTGAAGTGGCTGTACAGTGGAGTA ATTTATCCTTCTAGACTGC)

and

I-R3

(5′-

pGGTTGACAGTGTGCAGACGTTGAAGGATTATCCTGGAACAGGATAATCTAGTTGAG CTGTCTGCACACGATTAGC) were synthesized (IDT) with a degeneracy (21) of 0.30 at each underlined nucleotides (25 in total) while the remainder nucleotides were held constant. This yields molecules that have an average of seven mutations relative to the parental sequence. In addition, all possible molecules with up to seven mutations have a high probability of being represented in the reselection population at least once. The sequence of the primer binding domains was designed to be different in the two populations to avoid cross contamination during the

reselection.

A

pair

of

primers

A

(5′-pGGTAGCATGTACAGC)

and

B

(5′-

GCAGTCTAGAAGGATArA) were used for I-R1 reselection, while a pair of primers C (5′pGGTTGACAGTGTGCA) and D (5′-GCTAATCGTGTGCArG) were used for I-R3 reselection. A ribonucleotide (rA or rG) was included at the 3′ terminus of primers B & D to permit the alkaline-induced site-specific cleavage of the PCR products as described below. In vitro reselection for the two populations was performed in parallel using a simplified selection strategy comparing to the previous report (15). In the first round of selective amplification, 200 pmol of each synthetic population (the starting population, Generation 0, G0) were ligated at 60 ℃ for 2 hours to form DNA circles in a 200 µL mixture containing 1X CircLigase reaction buffer, 50 µM ATP, 2.5 mM MnCl2, and 200 U CircLigase (EpiCentre). The ligated products were precipitated with 100% ethanol and purified by using denaturing, 10%


6

Page 7 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

polyacrylamide gel electrophoresis (dPAGE). The gel was stained with ethidium bromide, and the circular DNAs were recovered from each gel by crush/soaking with 10 mM HEPES (pH 7.5 at 23 ℃), 200 mM NaCl and 1 mM EDTA followed by precipitation with 100% ethanol. The recovered DNAs were then incubated in a 100 µL selection buffer containing 50 mM HEPES (pH 7.0 at 23 ℃), 100 mM NaCl, 10 mM MgCl2, and 2 mM ZnCl2 at 37 ℃ for 10 minutes. Cleaved DNAs were separated by 10% dPAGE, recovered as described above and re-ligated with CircLigase in a 30 µL mixture containing 1X CircLigase reaction buffer, 50 µM ATP, 2.5 mM MnCl2, and 50 U CircLigase. Circular DNAs were isolated by 10% dPAGE, recovered as described above, and then amplified by PCR with 100 pmol primers to generate double-stranded amplification products, which were treated with 0.25 M NaOH at 90 ℃ for 5 minutes to induce the cleavage of the ribose-containing strand. The intact 75 nt single-stranded DNAs were then purified by 10% dPAGE, recovered as described above, and subjected to the next-round selection. After G0, to help track the DNA signals on dPAGE gels, 20 µCi of [α-32P] dATP were doped into the PCR reaction in each round of reselection to radioactively label the DNA populations. To select for the most active DNA-cleaving deoxyribozymes, the time for DNA populations to react in the selection buffer was shortened from 10 minutes (G0-G2) to 2 minutes (G3-G4), then to 30 seconds (G5-G6), and finally to 12 seconds (G7-G8). Double-stranded DNA clones (TOPO TA Cloning Kit, Invitrogen) from the selection pool of G8 were individually sequenced, and the G6 pool was deep sequenced using next-generation sequencing technology. Deoxyribozyme cleavage assays About 40 pmol of each synthetic DNA were mixed with 30 µL of 1X kinase buffer containing 5 mM MgCl2, 25 mM CHES (pH 9.0 at 23 ℃), 3 mM DTT, and 60 µCi of [γ-32P] ATP, 30 U T4


7

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 32

polynucleotide kinase (NEB). The samples were incubated at 37 ℃ for 1 hour for 5′ end labeling. Labeled DNAs were then purified by 10% dPAGE and recovered as described above. DNAs

that

were

labeled

in

this

way

include

I-R1

(5′-

CATGTACAGCCATAGTTGAGCAATTAGTTGAAGTGGCTGTACATG),

I-R1a

(5′-

CATGTACAGCCATAGTTGAGCATTAAGTTGAAGTGGCTGTACATG),

I-R1b

(5′-

CATGTACAGCCATAGTTGAGCACTAAGTTGAAGTGGCTGTACATG),

I-R1c

(5′-

CATGTACAGCCATAGTTGAGCAAAAAGTTGAAGTGGCTGTACATG), I-R3 S R13A (5′CTCGTGATGCAGACGTTGAAGGATTATCTTTCTGACT),

I-R3

S

R13G

(5′-

CTCGTGATGCAGACGTTGGAGGATTATCTTTCTGACT),

I-R3

S

R13C

(5′-

CTCGTGATGCAGACGTTGCAGGATTATCTTTCTGACT),

I-R3

S

R13T

(5′-

CTCGTGATGCAGACGTTGTAGGATTATCTTTCTGACT),

and

I-R3

long

S

(5′-

ATGCTGTATGCAGTAACTCGTGATGCAGACGTTGAAGGATTATCTTTCTGACTTAGC GACCTGGCTA). For unimolecular deoxyribozyme constructs (I-R1 and I-R1a to 1c), about 1 pmol of 5′

32

P

labeled DNAs were allowed to fold in a 50 µL solution containing 50 mM HEPES (pH 7.0 at 23 ℃), 100 mM NaCl after incubation at 90 ℃ for 5 minutes, followed by cooling at room temperature for 5 minutes, and then incubation at 37 ℃. 4 µL of the sample was pipetted out and added to 8 µL of stop solution (90% formamide, 30 mM EDTA, 0.025% bromophenol blue, 0.025% xylene cyanol) as a no reaction control (time = 0). For the rest 46 µL of the DNA sample, cleavage reactions were initiated by adding another 46 µL of a solution containing 50 mM HEPES (pH 7.0 at 23 ℃), 100 mM NaCl, 20 mM MgCl2, and 4 mM ZnCl2 (pre-heated at 37 ℃ for 10 minutes). At certain time points (time = 10, 20, 40, … seconds), 8 µL of the sample


8

Page 9 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

was pipetted out and added to 8 µL of stop solution as described above. Samples from different time points were collected and separated by 10% dPAGE and visualized/quantified by PhosphorImager. Values for the observed rate constant kobs were established by using the following equation: Fraction cleaved = FCmax(1 － e－kt), where k = kobs and FCmax = maximum of fraction cleaved. For bimolecular deoxyribozyme constructs, about 0.5 pmol of 5′

32

P labeled substrate DNA

strands were mixed with 2 pmol of enzyme strands for folding and reaction as described above. Excess amount of enzyme strands were used to ensure the kobs values were obtained for singleturnover reactions. DNA enzyme strands used for cleavage assays include I-R3 E Y4T (5′AGTCAGAAAGATAATCTAGTTGAGCTGTCTGCATCACGAG),

I-R3

E

Y4A

(5′-

AGTCAGAAAGATAATCTAGATGAGCTGTCTGCATCACGAG),

I-R3

E

Y4G

(5′-

AGTCAGAAAGATAATCTAGGTGAGCTGTCTGCATCACGAG),

I-R3

E

Y4C

(5′-

AGTCAGAAAGATAATCTAGCTGAGCTGTCTGCATCACGAG),

I-R3

long

E

(5′-

TAGCCAGGTCGCTAAGTCAGAAAGATAATCTAGTTGAGCTGTCTGCATCACGAGTTA CTGCATACAGCAT). To test deoxyribozyme’s temperature dependence, the incubation (reaction) temperature was adjusted to a value between 37 ℃ and 62 ℃, other conditions remained the same as described above. Thermal-cycling assisted multiple-turnover assays 5 pmol of 5′

32

P labeled substrate (S) DNA strands (I-R3 S R13A) were mixed with 0.1 or

0.025 pmol of enzyme (E) strands (I-R3 E Y4T) with a E to S molar ratio of 1:50 or 1:200,


9

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 32

respectively, in a 200 µL solution containing 50 mM HEPES (pH 7.0 at 23 ℃), 100 mM NaCl, 10 mM MgCl2, and 2 mM ZnCl2. The samples were incubated on an Eppendorf Mastercycler PCR machine with programmed temperatures cycling at 70 ℃ for 20 sec and then 45 ℃ for 1 min. After certain number of cycles (every 5 cycles for E:S = 1:50 and every 20 cycles for E:S = 1:200) , 5 µL of the sample was pipetted out and added to 5 µL of stop solution as described above. Samples undergoing different number of thermal cycling were collected and separated by 10% dPAGE and visualized/quantified by PhosphorImager. Multiple-turnover cleavage of circular M13mp18 DNA (CnBioruler) was conducted in reactions containing 1 µg (~0.4 pmol) of M13 DNA and ~0.008 pmol of each synthetic class I deoxyribozyme enzyme (E1, E2, E3, E4, and combinations) strands. By doing so, the molar ratio of E1-4 to M13 was maintained at around 1:50. These reaction samples underwent 100 thermal cycles (70 ℃ for 20 sec, 50 ℃ for 2 min for samples with E1 or E3 and 5 min for samples with E2 or E4), and the products were electrophoresed using the 2 M formaldehyde denaturing 0.8% agarose gel to separate the cleaved fragments from the uncleaved precursor. The DNA bands were visualized by staining the gel with SYBR Gold Nucleic Acid Gel Stain (Invitrogen). The four

synthetic

enzymes

are

E1

AACCAGACCGGAAGCAAATAGTTGAGCTAGGTCAGGATTAGAGAGT), TTTCGTCACCAGTACAAATAGTTGAGCTGCCTGTAGCATTCCACAG), ACTATTAAAGAACGTGGATAGTTGAGCTGTCAAAGGGCGAAAAACC),

(5′E2 E3 E4

(5′(5′(5′-

GGTCAGTATTAACACCGCTAGTTGAGCTAGTGCCACGCTGAGAGCC). RESULTS AND DISCUSSION Refined consensus sequence and secondary structure


10

Page 11 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

The secondary structure of class I Zn2+-dependent deoxyribozymes from our previous selection (15) contains either one or two base-paired elements (stems) (Figure 1A). These stems are distributed around a catalytic core domain, generating structure A (one stem) or B (two stems). In the catalytic core, both structures contain two segments of conserved nucleotides (red): 5′TAGTTGAG and 5′-GTTGAAG, with the cleavage site between ApA (Figure 1A). In structure A, the two segments are joined together by stem P1 and a short six-nucleotide loop － 5′CAATTA as in its most active representative I-R1. In structure B, they are connected by stems P1 and P2 with a dinucleotide spacer 5′-CT to link the 3′ end of the segment 5′-TAGTTGAG to P2 as in its most active representative I-R3. Totally there are 21 or 17 unpaired nucleotides in the catalytic core domain of structure A or B, respectively. With around 1-2 mM Zn2+ concentrations, these small deoxyribozymes can quickly cleave themselves (kobs: 0.059 min-1 for I-R1, 1.0 min-1 for I-R3 at 37 ℃) at a specific site in single-turnover reactions.

The two starting pools of variant deoxyribozymes were generated by introducing mutations at 25 nucleotides of the catalytic core, including the 4 or 8 nucleotides in the stem region for structure A or B, respectively (Figure 1A; see also Experimental Section). A degeneracy in nucleotide identity of 0.30 was introduced at each mutagenized position (21), to yield DNAs where these sites have a 70% chance of carrying the wild-type nucleotide and a 10% chance of carrying one of the other three nucleotides. The paralleled selections for structures A and B were both initiated with approximately 200 pmol (1.2 x 1014 molecules) of synthetic single-stranded (ss) DNAs (G0). With CircLigase, these ssDNAs were ligated into a circular form, which were purified by 10% dPAGE (Figure 1B). The recovered circular DNAs were subsequently incubated in selection buffer containing 2 mM ZnCl2. The resulting self-cleavage products (linear DNAs) were isolated by 10% dPAGE, and re-ligated into circles for PCR amplification to regenerate the


11

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 32

linear ssDNAs. One iteration of this selection-amplification process constitutes one round of in vitro reselection.

Figure 1. Reselection of class I deoxyribozymes. (A) Secondary structures (A&B) of the degenerate class I representatives I-R1 and I-R3. Enclosed are the degenerate nucleotides. Red refers to the previously identified conserved nucleotides. Arrowheads point to the cleavage site. (B) Reselection scheme for isolating class I deoxyribozymes. See the in vitro reselection of Experimental Section for details. Blue refers to the degenerate region. (C) Plot of the fraction cleaved signal versus the DNA population. G designates generation. GN refers to the DNA population after N rounds of selective amplification. (D) Refined consensus sequence and secondary structure of class I deoxyribozymes derived from high-throughput sequencing data of


12

Page 13 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

the G6 DNA populations. Gray, black and red nucleotides designate conservation of at least 75%, 90% and 97%, respectively; positions in which nucleotide identity is less conserved are represented by circles. Base-paired substructures are labeled P1 through P2. Green shading denotes base pairs supported by covariation. R and Y denote purine and pyrimidine, respectively. The previously reported fifteen highly conserved nucleotides in both structures I-A and I-B are marked 1 to 15. The previously reported six less conserved nucleotides in the loop region of structure I-A are highlighted by a black curve.

The incubation of circular DNA populations in the selection buffer lasted about 10 minutes for the first three rounds of reselection (G0-G2) (Figure 1C). In order to search for mutants with faster cleavage speed, we gradually shortened the incubation time to 12 seconds (G7-G8) after seven rounds of selective amplification. The G6 DNA populations for the paralleled selections were chosen for high-throughput sequencing to build the refined consensus sequence and secondary structure of the class I deoxyribozymes (Figure 1D). In the mutagenized region at the end of stem(s), only nucleotide covariations (green shading) were observed in the refined model, suggesting that the integrity rather than the sequence of stem(s) is critical to the class I deoxyribozymes. Among the previously reported 15 conserved nucleotides (numbered 1 to 15) in the catalytic core, two nucleotides － Y4 and R13 － seem to be more variable comparing to the others (Figure 1D). In both refined structural models (A&B), no less than 90% conservation of pyrimidine (T or C) and no less than 97% conservation of purine (G or A) were observed in the 4th and 13th nucleotide positions, respectively, while at least 97% conservation of a fixed base was shown for the rest positions. For the refined structure A, more variable nucleotides were found in the short loop region that connects the two conserved segments, consistent with the observation of less conservation in this region in our previous report (15).


13

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 32

Isolation of I-R1 mutants with robust single-turnover DNA-hydrolysis activity

Figure 2. Comparison of the new deoxyribozyme I-A representatives to I-R1 in sequences and cleavage activity. (A) Sequences of four individual deoxyribozyme I-A representatives, including I-R1 and I-R1a to 1c. Comparing to I-R1, the identical sequences in I-R1a to 1c are shown as dots. Gray shading denotes sequences that form P1 stem. Arrowhead points to the cleavage site. (B) Deoxyribozyme cleavage assays for I-R1 and I-R1a to 1c. 5′ 32P-labeled DNAs were incubated at 37 ℃ in the selection buffer for hydrolysis reaction. At different time points (0 - 60 min), the reaction was stopped and the DNA samples were collected and separated by denaturing 10% PAGE. Filled and hollow arrowheads identify uncleaved DNA precursor and 5′ cleavage fragments, respectively. (C) Plot of the fraction of DNA cleaved versus the incubation time for I-A representatives. Data was quantified on the basis of the PAGE gels in B. (D) The kobs and half-life values for I-A representatives. After nine rounds of selective amplification, the G9 DNA population was cloned and sequenced. Of 30 clones, many were identical in sequence, resulting in the identification of three I-R1 mutants that each carries a two-nucleotide mutation in the less conserved loop region － 5′CAATTA (Figure 2). All three mutants (1a-c) share a T to A mutation in the 5th nucleotide position of the loop. Mutants 1a&b contain another A to T or C mutation in the 3rd position, respectively, while Mutant 1c has its 4th nucleotide T in the loop changed to A. In the selection buffer with 2 mM ZnCl2, the single-turnover kobs values for the three mutants I-R1a to c were


14

Page 15 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

measured to be around 0.68-0.76 min-1 at 37 ℃ (Figure 2B-D), which is over 10 times faster than that of I-R1, the previous identified best representative of the I-A structure. This catalytic speed also makes the robustness of the three mutants comparable to I-R3 (kobs ~ 1 min-1 at 37 ℃), the most active representative of the I-B structure. Hence the data clearly suggests that it was largely not the number (1 or 2) of stems that caused the disparity of catalytic activity between I-R1 and I-R3 in the previous report (15). The class I deoxyribozymes can catalyze site-specific DNA hydrolysis with almost the same robustness no matter they fold into the subtype structure A or B. Optimal sequence for the class I deoxyribozymes In I-R1a to c isolated from G9, no mutations occurred in the positions of Y4 and R13 (Figure 2A), which were observed to be variable in the G6 DNA population (Figure 1D), where less selection stringency was applied comparing to G9. Similarly, of 30 clones from the G9 population for the structure B reselection, all were found to be the same as I-R3, without the Y4/R13 mutations observed in G6. The phenomena hint that the sequence mutations in those two positions are less likely to generate class I variants with a kobs value better than 1.0 min-1 at 37 ℃. To further confirm this speculation and to fully uncover the optimal sequence for class I deoxyribozymes, we chose the bimolecular I-R3 to study the effect of the Y4/R13 variations on class I’s activity. I-R3 shares the same conserved sequence in the catalytic core with I-R1a to c (Figure 1&2), and cleaves DNA (15) slightly faster than I-R1a to c (Figure 2D). Its bimolecular configuration made the cleavage assays easier to be designed and performed (see Experimental Section). From the refined sequence model based on the G6 population (Figure 1D), we know that the 4th and 13th positions in the catalytic core prefer to be pyrimidine (Y) and purine (R),


15

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 32

respectively. After performing single-turnover cleavage assays for all sixteen (42) sequence combinations of the two positions, we found that the Y4/R13 combination did cleave faster than Y4/Y13, R4/R13, and R4/Y13 (Figure 3 and Figure S1). For the Y4/R13 combination, the fastest cleavage came from T4/A13, which are the same nucleotides identified in I-R3 and in clones of the G8 reselection pools. At 37 ℃, for single nucleotide mutation of T4 to C4, or A13 to G13, the kobs value was decreased from 1.0 min-1 to 0.50 or 0.38 min-1, respectively. With double mutations － T4 to C4 and A13 to G13, the catalytic speed was further decreased to 0.25 min-1, four folds slower than that of I-R3. Comparing to either of the single mutations, the double mutations of T4/A13 to C4/G13 weakened the cleavage activity more, implying that it is unlikely that T4 and A13 form the Watson-Crick base-pair interaction for deoxyribozyme function. Meanwhile the data clearly shows that although nucleotides in the Y4/R13 positions have certain variability, variants at the two positions do not generate mutants with a cleavage speed surpassing I-R3. The similar effects of the Y4/R13 mutations on the cleavage activity were also observed for I-R1a.

Figure 3. Effect of the Y4/R13 variations on the activity of deoxyribozyme I-B. (A),(B) Plot of the fraction of DNA cleaved versus the incubation time for I-B with Y4/R13 variation. Data


16

Page 17 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

was quantified on the basis of the PAGE gels in Figure S1. (C),(D) The kobs values for the sixteen combinations and their relative fold decreases to the kobs of deoxyribozyme I-B with T4/A13. Data was derived from A and B. In a recent work, the Yokobayashi group applied deep sequencing to determine the tolerated and untolerated mutations in the catalytic core of I-R3 (22). Of all 533 active mutants they identified, including the Y4/R13 mutations (note that the 13th nucleotide in our current work was labeled as the 15th in the work in ref. 22), none of them was reported to cleave faster than the original I-R3. Likely due to the different I-R3 constructs – unimolecular I-R3 used in ref. 22 and bimolecular I-R3 by us, the kobs values measured for the Y4/R13 mutations are not exactly the same in the two reports. But the effect of the Y4/R13 variations we observed is consistent with ref. 22. In our work, the selection was biased for class I variants with robust cleavage activity. Thus other tolerated mutations (22) reported to weaken the activity of I-R3 more than the Y4/R13 mutations were not selected and discussed in this study. Based on the findings by the two groups, it seems that the class I deoxyribozymes have little sequence space to be further improved for single-turnover activity, and the optimal sequence for the class I has already been illustrated in I-R3 and I-R1a to c. The limited number of nucleotides in the current class I constructs might limit the formation of fine structures for faster catalysis, which has been seen in ribozymes. For example, the hammerhead ribozyme is a self-cleaving RNA enzyme that forms a secondary structure with three stems (I, II, III) flanking around a 13-nucleotide core (23-26). The minimal hammerhead has a similar size and single-turnover rate constant of 1 min-1 to the class I deoxyribozymes. However the full-length hammerhead ribozyme has an improved cleavage rate up to 1000-fold greater than that of the corresponding minimal construct, with additional sequence elements in stems I and II to permit additional tertiary contacts to form and stabilize the active conformation


17

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 32

of the ribozyme (27,28). In the future work, the class I deoxyribozymes may be reselected and engineered for better cleavage activities in a way similar to that the full-length hammerhead ribozyme adopts.

Figure 4. Temperature dependence of I-R3. (A) Schematic drawing of the secondary structure of I-R3. P1 and P2 refer to stems. Arrowhead points to the cleavage site. (B),(C) Cleavage assays for I-R3 at 54 ℃. For assay description, similar conventions apply as in Figure 2B. Stems P1/P2 of the I-R3 assayed in B and C contain 16/14 and 30/30 base-pairings (bp), corresponding to melting temperatures of 42/44 ℃ and over 65/65 ℃, respectively. (D),(E) Plot of the fraction of DNA cleaved versus the incubation time for I-R3 at various temperatures. Data was quantified on the basis of the PAGE gels in B, C, and Figure S2. (F),(G) The kobs and cleavage plateau of IR3 at different temperatures. Data was derived from D and E.


18

Page 19 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Thermophilic property of the class I deoxyribozymes Besides sequence mutations, the reaction temperature also affects the single-turnover activity of the class I deoxyribozymes. In our previous report (15), we found that I-R3 favors higher reaction temperatures. However, because the melting temperatures (Tms) of the P1 and P2 stems of the tested I-R3 construct were estimated to be around 42-44 ℃ in the reaction buffer, the highest temperature we tested (15) was 45 ℃, which was chosen to be close to the Tm of the stems in order to not largely disrupt the secondary structure of the deoxyribozyme. For this construct, the kobs value was estimated to be 1.6 min-1 at 45 ℃, and the hydrolysis reaction hit a cleavage plateau at 94% (same as 37 ℃) after 5 min (see ref. 15). It has been reported that the RNA-cleaving Zn2+-dependent deoxyribozymes can work at temperatures as high as 90 ℃ (29). In this study, with the I-R3 construct we examined the reaction temperature beyond 45 ℃. Starting from 50 ℃, we measured the kobs values and the cleavage plateaus of I-R3 every 2 ℃, up to 60 ℃ (Figure 4 and Figure S2). Surprisingly, at 50 ℃ which was thought to largely disrupt the P1 and P2 stems, we did not observe an apparent decrease of the cleavage plateau comparing to 37 ℃ and 45 ℃ (Figure 4D&G). This suggests that nucleotides in the catalytic core likely form certain structures that can further stabilize P1 and P2 stems. The cleavage plateau started to decrease from 90% (50 ℃) to 76% (52 ℃), then to 50% (54 ℃), 33% (56 ℃), and to less than 3% (58-60 ℃) (Figure 4D&G). The trend implied that more I-R3 constructs were denatured at higher reaction temperatures. The measured singleturnover kobs reached a maximum value of 3.3 min-1 at 54 ℃ (Figure 4F). Beyond that temperature, the hydrolysis speed started to drop. The kobs–temperature correspondence was


19

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 32

further confirmed by an improved I-R3 with longer P1 and P2 stems (See Experimental Section, also Figure 4C, E&F, and Figure S2). Each stem contains 30 base-pairs (bp), comparing to 14 or 16 bp in the original I-R3 construct, and has an estimated Tm over 65 ℃ in the reaction buffer. This I-R3 construct with longer stems showed similar kobs values to the original construct at each tested temperature points, with a maximum kobs value of 3.5 min-1 at 54 ℃ (Figure 4F). However, likely due to the stronger stabilization of the two stems, an 88% cleavage plateau was achieved at 54 ℃ (Figure 4G). And the apparent drop of the plateau was only seen when the temperature was beyond 56 ℃. Thus to achieve the optimal single-turnover performance of the class I deoxyribozymes, we would recommend to design the stems P1 and P2 strong enough (e.g., 30 bp) and set the reaction temperature at 54 ℃. Within one minute, one should expect that the DNA hydrolysis is done and roughly 88% of the DNA substrates are cleaved. Interestingly, 54 ℃ seems to be a critical point for I-R3. No matter how stable the stems were, below that point I-R3 cleaved faster as temperature went higher, while beyond that point the trend inverted (Figure 4F). A similar critical point also appeared to I-R1a-c (data not shown). One possible explanation is that the structure of the catalytic core may start to melt or denature above 54 ℃. Perhaps a crystal structure of I-R3 with atomic resolution would help explain this phenomenon in the future. In our temperature-dependence assays, the HEPES buffer (pH 7.0 at 23 ℃) contains 2 mM ZnCl2, which is around the solubility limit of this compound. Certain levels of ZnO nanoparticles might have been generated in the buffer although no obvious precipitation was observed, which can inhibit the activity of I-R3 according to a recent report by the Liu lab (30). As temperature increases, the pH of the HEPES buffer would turn more acidic, and more ZnO thus could be


20

Page 21 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

converted to Zn2+. This may explain the positive correlation between the kobs and temperature as it increases from 37 ℃ to 54 ℃.

The DNA-catalyzed DNA hydrolysis is a chemical reaction which seems to follow the generalized Arrhenius’ law: The reaction rate doubles for every 10 degree Celsius increase in temperature from 37 ℃ to 54 ℃. According to Arrhenius’ equation:

ln

2 1 1 = − , 1

1 2

where k1 and k2 are the rate constant values at temperatures T1 and T2 expressed in Kelvin, respectively, and R is the gas constant, we were able to calculate the apparent activation energy Ea to be about 15 ± 3 kcal/mol for the hydrolysis of DNA phosphodiester bond, using a series of the kobs values generated by I-R3 at 37 ℃, 45 ℃, 50 ℃, 52 ℃, and 54 ℃. It has been reported (31) that the type II restriction endonucleases reduced the energy barrier by ~30 kcal/mol, giving an activation barrier of 19 kcal/mol for the hydrolysis of DNA phosphodiester bond. The Ea value derived from deoxyribozyme I-R3 matches well with the energy barrier overcome by protein restriction enzymes during the hydrolysis of DNA. Thermal-cycling assisted multiple-turnover cleavage of DNA The product inhibition, or the tight binding of the enzyme strand to the product through Watson-Crick base pairing, greatly influenced the multiple-turnover capability of many known deoxyribozymes (10,11). One simple way to promote the release of the reacted substrate strand from an enzyme strand is to increase the temperature to denature the secondary structure of the deoxyribozyme. The class I deoxyribozymes are DNAs that can hydrolyze DNA site-specifically


21

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 32

with the presence of Zn2+. In their reaction buffer, we did not see any detectable DNA-cleavage signal due to self-degradation at high temperatures in our previous (15) and current studies. Based on that as well as our knowledge of the kobs–temperature and yield–temperature correspondence for I-R3 (Figure 4), we proposed that a procedure of denature and renature through thermal cycling should be able to assist the deoxyribozyme cleavage of DNA in a multiple-turnover way.

Figure 5. Thermal-cycling assisted multiple-turnover of deoxyribozyme I-B. (A) Overview of the multiple-turnover reaction. (B),(C) Denaturing 10% PAGE separation of multiple-turnover reaction products with 5′ 32P-labeled substrate DNAs. The DNA samples were collected for PAGE every 5 and 20 cycles in B and C, respectively. (D),(E) The fraction of DNA cleaved versus the number of temperature cycles. Data was quantified on the basis of the PAGE gels in B and C. (F) Target sites for cleavage of M13mp18 DNA by synthetic deoxyribozyme I-B enzyme DNAs. Substrates 1-3 (S1-3) in M13 DNA has been confirmed in the previous report (15). A


22

Page 23 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

fourth potential substrate region (S4) with GTTGcAG sequence was tested together with S1-3 for effective multiple-turnover cleavage by deoxyribozymes. The lowercase c refers to the nucleotide that varies from the optimal substrate sequence. Arrowhead denotes the site of cleavage, and gray shading identifies base-paired region. (G) Cleaving M13 DNA by four I-B enzyme DNAs in multiple-turnover reactions. M13 DNA was incubated with various combinations of E1 to E4 DNAs with a 1:50 molar ratio of E1-4 to M13. Each reaction underwent 100 rounds of thermal-cycling. Cleavage products were separated by denaturing (2.5 M formaldehyde) 0.8% agarose gel electrophoresis, and the DNA products were visualized by staining with SYBR Gold. Circular and linear M13 DNA bands are marked as C and L, respectively. The bands that correspond to cleavage products generated on digestion with two different DNA enzymes are also denoted.

We demonstrated our proposal with the I-R3 construct that contains relatively short P1 (16 bp) and P2 (14 bp) stems, which was used in the temperature-dependent assay (Figure 4B). This deoxyribozyme construct exhibited nearly complete (> 90%) single-turnover cleavage at 45 ℃ in 1-2 min. And at 60 ℃, it barely cleaved likely due to the denaturation of the secondary structure. Using a thermal cycler, we programmed a simple protocol to promote the multiple-turnover cleavage of I-R3 (Figure 5A). The enzyme strands and excess amount of substrates of I-R3 were firstly heated to 70 ℃ in the reaction buffer for 20 sec to ensure the denaturation. Then the temperature was dropped to 45 ℃ and maintained there to enable the renaturation and reaction. After 1 min, the cleavage reached the plateau and the temperature was increased to 70 ℃ again for 20 sec to promote the dissociation of the cleaved substrates from the enzyme strands. Following that was another incubation at 45 ℃ for 1 min to enable the renaturation of the enzymes to the intact substrate strands for a new round of cleavage. This temperature cycling was turned on many rounds till majority of the substrates were cleaved. Of course, as more cleaved substrates were generated, during the renaturation process, the binding efficiency of the enzymes to the intact substrates would be disturbed more due to the indiscriminative hybridization of the enzymes to the intact and the cleaved substrates, resulting in a gradually


23

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 32

reduced turnover rate. This phenomenon was observed in both multiple-turnover assays with a different molar ratio of E to S (Figure 5B-E). However, despite of the product inhibition effect to some extent, the thermal-cycling assisted multiple-turnover strategy still exhibited an overall much better effective turnover rate than previous reports on DNA-cleaving deoxyribozymes (15,16). With a 1:50 molar ratio of E to S, after 90 thermal cycles, about 90% of the substrates were cleaved, which corresponds to 45 turnovers (Figure 5D). Since each thermal cycle took about 1 min and 20 sec, 90 cycles took 120 min. Thus it took around 2 min and 40 sec per turnover in average, which corresponds to an effective kcat value of 0.375 min-1. Note that this “effective kcat” is not a true isothermal kcat. We used this term solely for practical comparisons. Using another set of data where 60 thermal cycles led to 80% cleavage of the substrates, the calculated effective kcat value is 0.50 min-1, about 30 folds faster than the turnover rates in the previous reports (15,16) where reactions were performed isothermally. In the assay with a 1:200 molar ratio of E to S, similar effective turnover rates (0.30-0.50 min-1) were observed (Figure 5E). Thus this thermal-cycling strategy offers a simple yet efficient way to boost the effective multiple-turnover rate of DNA-catalyzed DNA hydrolysis even comparable to that of some restriction enzymes (19,20). The thermal-cycling assisted multiple-turnover cleavage of DNA with deoxyribozymes was also exploited to process single-stranded genomic DNA. Due to the tolerance of single nucleotide changes to the 13th position in the catalytic core of deoxyribozyme I-B architecture (Figure 1D & Figure 3), there are only six highly conserved nucleotides in the substrate domain. This leads to the identification of four potential class I substrate sequences (S1-4) within the 7249nt M13mp18 genome (Figure 5F). Three of them (S1-3) have been demonstrated to be efficiently processed by synthetic class I enzyme sequences (E1-E3) in single-turnover reactions


24

Page 25 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

(15). The fourth potential substrate sequence (S4) contains a R13C variation, which could cause the most negative effect on the efficiency of deoxyribozyme cleavage among the A, T, G, and C variations of R13 (Figure 3). At 37 ℃, the R13C single nucleotide variation of I-R3 possessed a kobs value of 0.067 min-1, about 15 folds slower comparing to the R13A in the original I-R3. And it took 20 min for the R13C construct of I-R3 to achieve an 80% cleavage signal in the singleturnover reaction at 37 ℃(Figure 3). The relatively slow catalytic speed of the R13C variation determined that the S4 position in M13 genome could not be efficiently processed by deoxyribozyme E4 in a single-turnover reaction at 37 ℃. However I-R3 exhibited an increased catalytic speed from 37 to 54 ℃ (Figure 4), which also applied to I-R3 variants (data not shown). Thus when performing the thermal-cycling assisted multiple-turnover cleavage assay of M13 genome, we increased the incubation temperature to 50 ℃ instead of 45 ℃ to further boost the cleavage speed, especially at the S4 position with deoxyribozyme E4. Also in each cycle, we extended the incubation time to be 2 or 5 min instead of 1 min, to ensure the near complete cleavage within each potential substrate sequences that were bound by E1-4 (See Experimental Section). For a series of reaction mixtures that contained a 1 : 50 molar ratio of different combinations of the four enzyme strands to M13 genome, we turned on the thermal cycling (70 ℃ for 20 sec, 50 ℃ for 2 or 5 min) for 100 rounds. On a 0.8% denaturing agarose gel, we observed the corresponding DNA fragments with the sizes expected for site-specific cleavage by E1-4 (Figure 5G). For the multiple-turnover cleavage assay of M13 genome, in total it took about 4 or 9 hours (100 cycles) to catalyze over 40 turnovers (> 80%) of cleavage in S1&3 or S2&4 regions, respectively. In comparison to many protein enzymes, despite of the less impressive effective turnover rate (~0.070-0.17 min-1) due to the imperfect class I substrate


25

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 32

sequences within the M13 genome, we demonstrated for the first time to utilize deoxyribozymes to process genomic DNA in a multiple-turnover fashion with a simple thermal-cycling strategy. In principle, this thermal cycling strategy should be applicable to assist the effective turnover of other DNA-cleaving deoxyribozymes (15-18), as long as increasing temperature would not induce the self-degradation of the DNA substrates in the corresponding reaction buffer. For the deoxyribozymes that catalyze the cleavage of a RNA phosphodiester bond (1), repeated warming of the reactants may lead to the RNA degradation. Thus one should be careful to apply the strategy to promote the effective turnover rate of deoxyribozymes whose substrates are unstable at high temperatures. CONCLUSIONS The reselection of class I Zn2+-dependent deoxyribozymes revealed I-R1a-c with only two nucleotide mutations in the less conserved loop region. Comparing to I-R1, these mutants displayed single-turnover kobs values around 0.68-0.76 min-1 at 37 ℃, over 10-fold more active. These DNAs are perhaps the smallest known deoxyribozymes that robustly cleave DNA in a hairpin structure with 21 nucleotides in the loop. The comparable kobs values of I-R1a-c to that of I-R3 suggest that the additional P2 stem in the secondary structure (Figure 1D) has negligible effect on the single-turnover activity of the class I deoxyribozymes. Further studies indicated that the class I have little sequence space to be further improved for single-turnover activity. At 37 ℃ , the optimal class I deoxyribozymes are represented by I-R3, with the single-turnover kobs value of 1.0 min-1. I-R3 was also demonstrated to be thermophilic and catalyze the single-turnover cleavage of DNA to the maximum speed of 3.5 min-1 at 54 ℃.


26

Page 27 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

The class I deoxyribozymes are enzymes made up of DNA to hydrolyze DNA, which means these specific DNA sequences are able to lower the energy barrier for the hydrolysis of DNA phosphodiester bond. Using a series of the kobs values at different temperatures between 37 and 54 ℃ , we calculated through Arrhenius’ equation that during the hydrolysis of DNA phosphodiester bond, the class I deoxyribozymes overcame an apparent Ea of about 15 ± 3 kcal/mol, consistent with the energy barrier (19 kcal/mol) reported on the type II restriction endonucleases during their hydrolysis of DNA (31). Due to product inhibition, deoxyribozymes were usually inefficient in multiple-turnover reactions (10,11). The isothermal kcat of I-R3 was calculated to be about 0.017 min-1 in the previous report (15). In this study, based on the kinetic parameters of I-R3, we developed a simple yet efficient thermal cycling protocol to boost the effective kcat of I-R3 to 0.50 min-1, about 30-fold more robust than before and comparable to that of some restriction enzymes (19,20). This protocol was also proved to be functional in the multiple-turnover cleavage of natural DNA like M13mp18, which contains potential I-R3 substrate regions. The strategies we used in retraining and optimizing the class I deoxyribozymes should set up an example to study various deoxyribozymes and deepen our understanding of these DNA catalysts. We also believe that the improved single- and multiple-turnover activities of the class I deoxyribozymes will promote the biotechnological applications (32-35) of these DNA enzymes to a higher level.

AUTHOR INFORMATION Corresponding Author *E-mail for [email protected]; [email protected]


27

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 32

ORCID Hongzhou Gu: 0000-0001-5058-4815 Author Contributions ‡Xinyu Du and Xin Zhong contributed equally to this work. Funding Sources This work was supported by the National Nature Science Foundation of China (81861138004, 21673050, 81500229), Shanghai Sailing Program (16YF1401600), and the National Key Research and Development Program of China (2016YFC1306400). Notes The authors declare no competing financial interest.

ASSOCIATED CONTENT Supporting Information Cleavage assays of the sixteen combinations of Y4/R13 variation in I-R3, Cleavage assays for I-R3 at various temperatures from 37 ℃ to 62 ℃ (PDF) This information is available free of charge on the ACS Publications website.

ACKNOWLEDGMENT We thank Zasha Weinberg and members from the Breaker lab at Yale University for valuable discussions.


28

Page 29 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

REFERENCES 1. Breaker, R.R. and Joyce, G.F. A DNA Enzyme that Cleaves RNA. Chem. Biol. 1994, 1, 223-229. 2. Li, Y. and Breaker, R.R. Phosphorylating DNA with DNA. Proc. Natl. Acad. Sci. U.S.A. 1999, 96, 2746-2751. 3. Camden, A.J., Walsh, S.M., Suk, S.H. and Silverman, S.K. DNA Oligonucleotide 3′phosphorylation by A DNA Enzyme. Biochemistry 2016, 55, 2671-2676. 4. Li, Y., Liu, Y. and Breaker, R.R. Capping DNA with DNA. Biochemistry 2000, 39, 3106-3114. 5. Sheppard, T.L., Ordoukhanian, P. and Joyce, G.F. A DNA Enzyme with N-glycosylase Activity. Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 7802-7807. 6. Cuenoud, B. and Szostak, J.W. A DNA Metalloenzyme with DNA Ligase Activity. Nature 1995, 375, 611-614. 7. Sreedhara, A., Li, Y. and Breaker, R.R. Ligating DNA with DNA. J. Am. Chem. Soc. 2004, 126, 3454-3460. 8. Flynn-Charlebois, A., Wang, Y., Prior, T.K., Rashid, I., Hoadley, K.A., Coppins, R.L., Wolf, A.C. and Silverman, S.K. Deoxyribozymes with 2′-5′ RNA Ligase Activity. J. Am. Chem. Soc. 2003, 125, 2444-2454. 9. Pradeepkumar, P.I., Höbartner, C., Baum, D.A. and Silverman, S.K. DNA-Catalyzed Formation of Nucleopeptide Linkages. Angew. Chem. Int. Ed. 2008, 47, 1753-1757. 10. Emilsson, G. and Breaker, R.R. Deoxyribozymes, New Activities and New Applications. Cell Mol. Life Sci. 2002, 59, 596-607. 11. Silverman, S.K. Deoxyribozymes, DNA Catalysts for Bioorganic Chemistry. Org. Biomol. Chem. 2004, 2, 2701-2706. 12. Silverman, S.K. Catalytic DNA, Scope, Applications, Deoxyribozymes. Trends Biochem. Sci. 2016, 41, 595-609.

and

Biochemistry

of

13. Silverman, S.K. DNA as A Versatile Chemical Component for Catalysis, Encoding, and Stereocontrol. Angew. Chem. Int. Ed. 2010, 49, 7180-7201. 14. Zhou, W., Saran, R. and Liu, J. Metal Sensing by DNA. Chem. Rev. 2017, 117, 82728325.


29

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 32

15. Gu, H., Furukawa, K., Weinberg, Z., Berenson, D.F. and Breaker, R.R. Small, Highly Active DNAs that Hydrolyze DNA. J. Am. Chem. Soc. 2013, 135, 9121-9129. 16. Chandra, M., Sachdeva, A. and Silverman, S.K. DNA-catalyzed Sequence-specific Hydrolysis of DNA. Nat. Chem. Biol. 2009, 5, 718-720. 17. Xiao, Y., Allen, E.C. and Silverman, S.K. Merely Two Mutations Switch A DNAhydrolyzing Deoxyribozyme from Heterobimetallic (Zn2+/Mn2+) to Monometallic (Zn2+-only) Behavior. Chem. Commun. 2011, 47, 1749-1751. 18. Dokukin, V. and Silverman, S.K. Lanthanide Ions as Required Cofactors for DNA Catalysts. Chem. Sci. 2012, 3, 1707-1714. 19. Modrich, P. and Zabel, D. EcoRI Endonuclease. Physical and Catalytic Properties of the Homogenous Enzyme. J. Biol. Chem. 1976, 251, 5866-5874. 20. Vermote, C.L. and Halford, S.E. EcoRV Restriction Endonuclease, Communication between Catalytic Metal Ions and DNA Recognition. Biochemistry 1992, 31, 6082-6089. 21. Breaker, R.R. and Joyce, G.F. Inventing and Improving Ribozyme Function, Rational Design versus Iterative Selection Methods. Trends Biotechnol. 1994, 12, 268-275. 22. Dhamodharan, V., Kobori, S. and Yokobayashi, Y. Large Scale Mutational and Kinetic Analysis of A Self-hydrolyzing Deoxyribozyme. ACS Chem. Biol. 2017, 12, 2940-2945. 23. Forster, A.C. and Symons, R.H. Self-cleavage of Plus and Minus RNAs of A Virusoid and A Structural Model for the Active Sites. Cell 1987, 49, 211-220. 24. Prody, G.A., Bakos, J.T., Buzayan, J.M., Schneider, I.R. and Bruening, G. Autolytic Processing of Dimeric Plant Virus Satellite RNA. Science 1986, 231, 1577-1581. 25. Hutchins, C.J., Rathjen, P.D., Forster, A.C. and Symons, R.H. Self-cleavage of Plus and Minus RNA Transcripts of Avocado Sunblotch Viroid. Nucleic Acids Res. 1986, 14, 3627-3640. 26. Forster, A.C. and Symons, R.H. Self-cleavage of Virusoid RNA Is Performed by the Proposed 55-nucleotide Active Site. Cell 1987, 50, 9-16. 27. Khvorova, A., Lescoute, A., Westhof, E. and Jayasena, S.D. Sequence Elements outside the Hammerhead Ribozyme Catalytic Core Enable Intracellular Activity. Nat. Struct. Mol. Biol. 2003, 10, 708-712. 28. De la Peña, M., Gago, S. and Flores, R. Peripheral Regions of Natural Hammerhead Ribozymes Greatly Increase Their Self-cleavage Activity. EMBO 2003, 22, 5561-5570. 29. Nelson, K.E., Bruesehoff, P.J. and Lu, Y. In Vitro Selection of High Temperature Zn2+dependent DNAzymes. J. Mol. Evol. 2005, 61, 216-225.


30

Page 31 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

30. Ma, L., Liu, B., Huang, P., Zhang, X. and Liu, J. DNA Adsorption by ZnO Nanoparticles near Its Solubility Limit: Implications for DNA Fluorescence Quenching and DNAzyme Activity Assays. Langmuir 2016, 32, 5672-5680. 31. Pingoud, A., Fuxreiter, M., Pingoud, V. and Wende, W. Type II Restriction Endonucleases: Structure and Mechanism. Cell Mol. Life Sci. 2005, 62, 685-707. 32. Gu, H. and Breaker, R.R. Production of Single-stranded DNAs by Self-cleavage of Rolling-circle Amplification Products. Biotechniques 2013, 54, 337-343. 33. Furukawa, K. and Minakawa, N. Allosteric Control of A DNA-hydrolyzing Deoxyribozyme with Short Oligonucleotides and Its Application in DNA Logic Gates. Org. Biomol. Chem. 2014, 12, 3344−3348. 34. Endo, M., Takeuchi, Y., Suzuki, Y., Emura, T., Hidaka, K., Wang, F., Willner, I. and Sugiyama, H. Single-molecule Visualization of the Activity of a Zn2+-dependent DNAzyme. Angew. Chem., Int. Ed. 2015, 54, 10550−10554. 35. Praetorius, F., Kick, B., Behler, K.L., Honemann, M.N., Weuster-Botz, D. and Dietz, H. Biotechnological Mass Production of DNA origami. Nature 2017, 552, 84-87.


31

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 32

ToC:


32

Retraining and Optimizing DNA-Hydrolyzing Deoxyribozymes for

Recommend Documents