Rexinoids Isolated from Sophora tonkinensis with a Gene Expression

Article pubs.acs.org/jnp

Rexinoids Isolated from Sophora tonkinensis with a Gene Expression Profile Distinct from the Synthetic Rexinoid Bexarotene Makoto Inoue,*,† Hiroki Tanabe,† Ken-ichi Nakashima,† Yukihiro Ishida,† and Hitoshi Kotani‡ †

Department of Pharmacology of Natural Compounds, Graduate School of Pharmaceutical Sciences, Aichi Gakuin University, 1-100 Kusumoto-cho, Chikusa-ku, Nagoya 464-8650, Japan ‡ Department of Pharmaceutical Sciences, Musashino University, 1-1-20 Shinmachi, Nishitokyo, Tokyo 202−8585, Japan S Supporting Information *

ABSTRACT: The retinoid X receptor (RXR) plays a critical role in transcriptional regulation via formation of an RXR homodimer or heterodimers with partner nuclear receptors. Despite the numerous beneficial effects, only a limited number of naturally occurring RXR agonists are known. In this report, two prenylated flavanones (1 and 2) isolated from Sophora tonkinensis were identified as new rexinoids that preferentially activated RXRs, relative to the retinoic acid receptor. The activities of 1 and 2 were the most potent among naturally occurring rexinoids, yet 2 orders of magnitude lower than the synthetic rexinoid bexarotene. Compounds 1 and 2 activated particular RXR heterodimers in a manner similar to bexarotene. A microarray assay followed by quantitative real-time polymerase chain reaction analyses on RNAs isolated from C2C12 myotubes treated with 1 or 2 demonstrated that they significantly increased mRNA levels of lipoprotein lipase, angiopoietin-like protein 4, and heme oxygenase-1. In contrast, bexarotene preferentially potentiated transcription of genes involved in lipogenesis and lipid metabolism such as sterol regulatory element-binding protein-1, fatty acid synthase, and apolipoprotein D by a liver X receptor agonist. In this study, we have demonstrated that two newly identified naturally occurring rexinoids, 1 and 2, possess properties different from bexarotene.

T

mediated alterations to the geometry of DNA, which is in addition to direct transcriptional activation by RXRs.5 Furthermore, RXR activity is regulated by phosphorylation at several serine or threonine residues by c-Jun-terminal kinase, mitogen-activated protein kinase, and casein kinase 1.6−8 Therefore, the activation of kinase signaling pathways provides another tool for modulating the transcriptional activity of RXR heterodimers. In addition, negative modulation of RXR transcriptional activity by small ubiquitin-related modifier modification has also been reported, being involved in the RXR-mediated cellular processes.9 Besides the complexity in transcriptional regulation by RXRs described above, the RXR ligands provide versatility to the function of RXRs. The gene expression profiles induced by several RXR agonists are not necessarily identical and overlap in only a limited number of genes.10 The gene regulation of RXR heterodimers is largely dependent on the respective ligands for RXR and partner NRs, both of which induce subtle conformational changes in the NRs, and concomitant variation in the recruitment of coactivators or corepressors, resulting in modification of chromatin states following epigenetic modu-

he retinoid X receptor (RXR), a member of the nuclear receptor (NR) superfamily of ligand-activated transcription factors, plays unique and critical roles in the regulation of many members of this superfamily and is also involved in the regulation of diverse cellular processes including development, differentiation, metabolism, and cell death.1,2 These versatile effects arise through (1) the ability of RXRs to dimerize with diverse partner NRs and (2) the complex regulation of these RXR heterodimers is mediated by ligands for RXR and partner NRs. The activation of a given RXR heterodimer through RXR does not equate to activation through the partner NR,3 because transcriptional response elicited through the RXR only partially overlaps with that elicited through its partner NR, thereby rendering analysis of the RXR pathway even more complex. Furthermore, the versatile effects of RXRs can stem from the presence of isoforms, homotetramer formation, and regulation by phosphorylation and sumoylation.4−9 The RXR consists of three isoforms, α, β and γ, which are expressed differently depending on the cell type and differentiation status,4 and thus play distinct roles from one another. The RXR isoforms are also reported to form homotetramers, which are transcriptionally silent, but rapidly dissociate into active homodimers upon binding of agonists or antagonists. This indicates that RXR ligands may regulate transcriptional activation through RXR© 2014 American Chemical Society and American Society of Pharmacognosy

Received: April 3, 2014 Published: June 24, 2014 1670

dx.doi.org/10.1021/np5002016 | J. Nat. Prod. 2014, 77, 1670−1677

Journal of Natural Products

Article

lations, such as histone acetylation, methylation, and phosphorylation.11 This notion is supported by evidence that administration of three different RXR agonists (PA024, HX630, or HX600) induced markedly different gene expression profiles in the rat liver.10 PA024 and HX630 were found to possess different abilities to activate RXR/liver X receptor (LXR) heterodimers and induce ATP-binding cassette transporter (ABC) A1 expression,12 and HX600 preferentially induced expression of the carnitine palmitoyltransferase (CPT) 1 gene directly through Nur77/RXR or NURR1/RXR heterodimer transactivation.13 A class of compounds that selectively bind and activate RXRs relative to retinoic acid receptors (RARs) are collectively referred to as rexinoids, which have been reported to exert beneficial effects on insulin sensitization,14 diabetes, obesity,15 atherosclerosis,16 cancer,17 and eczema.18 At present, bexarotene, a synthetic rexinoid, has been approved clinically for the treatment of cutaneous T-cell lymphoma.19 However, bexarotene and some synthetic rexinoids derived from 9-cis retinoic acid (9-cis RA) raise triglyceride levels via transactivation of sterol regulatory element-binding protein (SREBP)-1c by the RXR/LXR heterodimers, suppress the thyroid hormone axis, and induce hepatomegaly as adverse effects.20−22 These side effects strictly limit the development of these rexinoids as therapeutic agents for the treatment of metabolic diseases, despite accumulating evidence showing that rexinoids produce numerous beneficial effects. Substantial studies remain to address the therapeutic potential of the rexinoids. Nonetheless, it is worth exploring a novel class of rexinoids with specificity for RXR heterodimers, RXR isoforms or isotypes, tissues, and cells, but no adverse effects. Further, in light of current clinical applications, it is also worth developing combinational therapies with small doses of peroxisome proliferator-activated receptor (PPAR) γ, RAR, or vitamin D receptor (VDR) agonists, which are already in use clinically but show serious adverse effects at high doses or upon repeated usage. Since limited numbers of natural rexinoids have been reported,23−27 further exploration of naturally occurring rexinoids may lead to not only the development of pharmacological profiles with potential therapeutic value for the treatment of insulin resistance, diabetes, atherosclerosis, cancer, and muscle atrophy, all of which are associated with metabolic sequelae, but also the understanding of the diversity in regulation of gene transcription by RXRs. Therefore, the present study was undertaken to explore novel naturally occurring rexinoids from medicinal plants and to investigate their properties. Sophora tonkinensis is a traditional Chinese plant, and its roots and rhizomes are used as a folk medicine. Phytochemical study reveals that it contains flavonoids and lupin alkaloids as main ingredients, although no intensive study has yet been undertaken of the pharmacological and biochemical effects.28 We found two new naturally occurring rexinoids, (1) 2-[{3′-hydroxy-2′,2′-dimethyl-8′-(3-methyl-2butenyl)}chroman-6′-yl]-7-hydroxy-8-(3-methyl-2-butenyl)chroman-4-one and (2) 2-[{2′-(1-hydroxy-1-methylethyl)-7′(3-methyl-2-butenyl)-2′,3′-dihydrobenzofuran}-5′-yl]-7-hydroxy-8-(3-methyl-2-butenyl)chroman-4-one, which were previously isolated from S. tonkinensis.29 However, sophoranone (3), isolated simultaneously with 1 and 2, failed to show rexinoid activity despite a similar structure. We further show that the properties of 1 and 2 behave as natural rexinoids, compared with the synthetic rexinoid bexarotene.

■

RESULTS AND DISCUSSION Identification of Prenylated Flavanones 1 and 2 as Naturally Occurring Rexinoids. By screening 50 crude drugs for natural ligands of the RXR using RXRα luciferase reporter assays, two prenylated flavanones (1 and 2) were isolated from the root of S. tonkinensis Gagnep. Compounds 1 and 2 were both capable of activating the transcription of the RXR response element reporter gene in a dose-dependent manner, with EC50 values of 0.77 and 0.78 μM, respectively (Figure 1A).

Figure 1. Activation of RXRα by novel RXR ligands isolated from Sophora tonkinensis. (A, B) HEK293 cells were cotransfected with an RXRα expression vector and luciferase reporter plasmids together with pCMX-β-gal. At 8 h after transfection, the cells were treated with increasing concentrations of compound 1 (open circles), compound 2 (solid circles), sophoranone (3) (open squares), and bexarotene (BEX; solid squares) for 48 h (A) or treated with 1 (10 μM), 2 (10 μM), or BEX (0.1 μM) with or without PA452 (RXR pan-antagonist; 10 μM) (B). The data represent the means ± SD of three determinants from a representative of three independent experiments that showed similar results. The data in (B) were evaluated for statistical significance by one-way analysis of variance (ANOVA), followed by Bonferroni’s t-test. **p < 0.01 vs BEX without PA452. A value of p < 0.05 was considered to be statistically significant.

These activities were 2 orders of magnitude lower than that of the synthetic RXR agonist bexarotene. However, when compared with the EC50 values of the other naturally occurring rexinoids or RXR agonists reported, namely, phytanic acid, docosahexanoic acid, honokiol, and bigelovin, the reported ED50 values are 3−64, 50−100, 11.8, and 4.9 μM, respectively, therefore showing less potent activity than 1 and 2.23−27The transcriptional activation by 1 and 2 was completely abrogated by the RXR-specific pan-antagonist PA452, similar to the case 1671



Article

of bexarotene (Figure 1B). We examined the binding of 1 and 2 to each of the three isoforms of RXR. As shown in Figure 2,

Figure 2. Binding of 1 and 2 to three isoforms of RXR. Binding activity of 1 and 2 to RXR isoforms was determined using the EnBio RCAS kit according to the methods described in the Experimental Section. Open circles, solid circles, and open squares represent RXRα, RXRβ, and RXRγ, respectively. The data represent the means ± SD of three determinants.

both compounds were able to bind to each RXR isoform in a similar manner, although they are likely to bind to RXRα with a slightly higher affinity than RXRβ and γ. However, compounds 1 and 2 failed to activate RARα and LXRα or bind to PPARα, δ and γ significantly (Figures S1 and S2, Supporting Information), indicating that they can selectively activate RXRs. Interestingly, sophoranone (3), which was isolated simultaneously with 1 and 2 from the root of S. tonkinensis Gagnep, did not activate RXR up to a concentration of 10 μM. Currently, numerous prenylated flavonoids have been isolated from various plant families. These flavonoids have shown divergent biological activities, such as antibacterial, antifungal, antioxidant, antitumor, anti-skin aging, and estrogenic activities, as well as inhibitory effects on nitric oxide production and cyclooxygenase, lipoxygenase, and cGMP phosphodiesterase 5 activities.30−32 In the present study, we identified for the first time that two prenylated flavanones, 1 and 2, were novel rexinoids, with the highest potency reported among the known rexinoids and specific for RXR among the NRs employed in this study. Further, the structures of 1, 2, and 3 differ in whether or not the isoprenyl residue forms an ether ring on the B ring of flavanone, suggesting that an ether ring could be important for exhibiting rexinoid activity. Activation of RXR Heterodimers by Compounds 1 and 2. Next, we sought to assess the properties of 1 and 2 as rexinoids by evaluating their activation of RXR heterodimers with various partner NRs (LXR, PPARγ, RAR, and VDR) and compare these results with those obtained with bexarotene. First, we examined the effects of 1 or 2 on the induction of an LXR target gene ABCA1 (ATP-binding cassette transporter A1) with or without the LXR agonist T0901317 in RAW264.7 cells. Both 1 and 2 alone induced significant increases in the mRNA levels of ABCA1 in a similar manner to bexarotene and further enhanced the induction synergistically in combination with T0901317 (Figure 3A). These effects of 1 and 2 were similar to those of bexarotene, although the degree of induction was greater in bexarotene-treated cells. Second, both compounds alone increased the mRNA levels of PPARγ target gene angiopoietin-like protein 4 (ANGPTL4) in HLE human hepatoma cells and further potentiated the induction additively

Figure 3. Effects of compounds 1 and 2 or bexarotene on various RXR heterodimers in combination with respective partner NR agonists. (A) RAW264.7 cells were exposed to 1 (10 μM), 2 (10 μM), or bexarotene (BEX, 1 μM) for 24 h with or without T0901317 (LXR agonist). The mRNA level of the RXR/LXR target gene ABCA1 was measured by quantitative RT-PCR. (B) RAW264.7 cells were exposed to 1 (10 μM), 2 (10 μM), or BEX (1 μM) for 24 h with or without rosiglitazone (PPARγ agonist). The mRNA level of the PPARγ target gene ANGPTL4 was measured by quantitative RT-PCR. (C) F9 cells were exposed to 1 (10 μM), 2 (10 μM), or BEX (1 μM) for 24 h with or without atRA (0.1 μM). The mRNA level of the RXR/RAR target gene CYP26A1 was measured by quantitative RT-PCR. (D) HLE cells were exposed to 1 (10 μM), 2 (10 μM), or BEX (1 μM) for 24 h with or without VD3 (0.1 μM). The mRNA level of the RXR/VDR target gene CYP24A1 was measured by quantitative RT-PCR. mRNA levels were normalized by the β-actin levels and expressed as the fold inductions relative to that in vehicle-treated cells (CTRL). The data represent the means ± SD of three determinants from a representative of three independent experiments that showed similar results and were evaluated for statistical significance by one-way analysis of variance (ANOVA), followed by Bonferroni’s t-test. **p < 0.01, *p < 0.05 vs CTRL without respective NR agonists, ##p < 0.01 vs CTRL with respective NR agonists. ap < 0.01, bp < 0.05 vs BEX, cp < 0.01, dp < 0.05 vs BEX with respective NR agonists. A value of p < 0.05 was considered to be statistically significant.

in combination with the PPARγ agonist rosiglitazone (Figure 3B). These effects were similar to those of bexarotene; however, the potency was more intense for bexarotene. Third, both compounds alone increased the mRNA levels of RAR target gene CYP26A1 in F9 cells in a similar manner to bexarotene and further potentiated the induction synergistically upon concurrent treatment with the RAR agonist all-trans retinoic acid (atRA), although bexarotene exhibited a greater effect than 1 or 2 (Figure 3C). Fourth, for the RXR heterodimer with VDR, neither 1 nor 2 alone enhanced the mRNA levels of VDR target gene CYP24A1, while bexarotene was capable of increasing the mRNA level for this gene. When either compound was treated with the VDR agonist calcitriol, the mRNA levels of CYP24A1 were significantly suppressed, while bexarotene had no effect (Figure 3D). These results demonstrated that 1 and 2 stimulated cell functions via RXR/ 1672



Article

Figure 4. Differential expression of mRNAs induced by compounds 1 and 2 and bexarotene. C2C12 myotubes were exposed to 1 (10 μM), 2 (10 μM), or bexarotene (BEX, 1 μM) for 24 h with or without T0901317 (1 μM). The mRNA levels were measured by quantitative RT-PCR, normalized by the β-actin levels, and expressed as the fold inductions relative to that in vehicle-treated cells (CTRL). The data represent the means ± SD of four determinants from a representative of two independent experiments that showed similar results and were evaluated for statistical significance by one-way analysis of variance (ANOVA), followed by Bonferroni’s t-test. **p < 0.01 vs CTRL without T0901317, ##p < 0.01 vs CTRL with T0901317. ap < 0.01, bp < 0.05 vs BEX, cp < 0.01, dp < 0.05 vs BEX with T0901317, ep < 0.01, fp < 0.05 vs compound 2. A value of p < 0.05 was considered to be statistically significant.

expression using the GeneSQUARE Microarray screen. The results demonstrated that more than 10 genes were found to be differentially induced following treatment with 2 or bexarotene alone or in combination with T0901317 or GW501516 (fold change >2.0). Therefore, the different gene expression profiles were evaluated by quantitative RT-PCR. Five LXR target genes, except for LPL (lipoprotein lipase), examined in this study were potently induced by concurrent treatment with bexarotene and T0901317, regardless of whether or not they were activated by bexarotene alone (Figure 4). Interestingly, the mRNA level of LPL was not affected by bexarotene alone or in combination with T0901317. On the other hand, both 1 and 2 alone slightly or significantly increased mRNA levels of five LXR target genes except for FAS (fatty acid synthase). Both compounds were able to potentiate mRNA expression of ABCA1, ApoE, and LPL in combination with T0901317, but failed to enhance mRNA expression of SREBP-1 (sterol regulatory element binding protein-1), FAS, and APOD (apolipoprotein D). Bexarotene is known to cause hyperlipidemia as a severe side effect.35 Although the molecular mechanism behind this hyperlipidemia remains poorly understood, the elevated transcription of SREBP-1 and FAS may play a role in bexarotene-induced hyperlipidemia.36 The results of this study obviously demonstrated that bexarotene potently induced SREBP-1 and FAS in the presence of T0901317. In contrast, compounds 1 and 2 failed to increase the mRNA levels of these two genes in the presence of T0901317. Intriguingly, the mRNA level of LPL, whose up-regulation may be beneficial for atherosclerosis, obesity, and diabetes, was significantly enhanced by 1 and 2 alone or in combination with

LXR, PPARγ/RXR, and RXR/RAR heterodimers either alone or in combination with the agonists for the partner NRs and in a similar manner to that observed for bexarotene. Furthermore, the transactivation of various RXR heterodimers by 1 or 2 was not largely different from that by bexarotene, although bexarotene exhibited a higher potency. The transactivation of RXR/LXR heterodimers was assessed by the induction of the ABCA1 protein in RAW264.7 cells. Both 1 and 2 were capable of inducing the ABCA1 protein alone or in combination with T0901317 (Figure S3, Supporting Information). When the transactivation of PPARγ/RXR heterodimers was assessed by adipogenesis of 3T3-L1 cells, they induced 3T3-L1 cell differentiation and adipogenesis in a similar manner to bexarotene (Figure S4, Supporting Information). Comparison of the Gene Expression Profiles of Compounds 1 and 2 and Bexarotene. Skeletal muscle is a key tissue for lipid oxidation and glucose uptake and accounts for most of the insulin-stimulated glucose utilization. Improvements of insulin sensitivity in skeletal muscle are beneficial for the control of glucose homeostasis. In addition, the PPARδ agonist and rexinoids were reported to increase glucose uptake and β-oxidation of fatty acids in cultured skeletal muscle cells,33,34 and LXRs play important roles in regulating lipogenesis and cholesterol efflux in skeletal muscle.35 Therefore, to elucidate the difference between compounds 1 and 2 and bexarotene in their properties as rexinoids, we extracted total mRNA from C2C12 myotubes treated with 2 or bexarotene, with or without the LXR agonist T0901317 or the PPARδ agonist GW501516, and analyzed the mRNA 1673



Article

whereas the mRNA level of FABP3, which facilitates fatty acid transport in cells, was synergistically enhanced by bexarotene. Collectively, these four PPARδ target genes, except for FABP3, appear to be more sensitive to 1 or 2 induction than bexarotene induction, alone or in combination with the PPARδ agonists. ANGPTL4, a major target of PPARδ in skeletal muscle, is a multifunctional protein that was reported to protect the heart from fatty acid-induced oxidative stress,38 protect against myocardial infarction,39 and reduce foam cell formation and endoplasmic reticulum stress.40 ANGPTL4 is also well known to potently inhibit LPL. Induction of ANGTL4 by bexarotene without an effect on LPL could intimately contribute to a rise in plasma triglycerides.41 In contrast, our findings revealed that 1 and 2 alone or in combination with T0901317 induced LPL and ANGPTL4 mRNAs, suggesting that they would not cause severe hyperlipidemia, unlike bexarotene. Therefore, 1 and 2 may have several beneficial effects on vascular systems. HMOX1 is implicated in diverse biological processes, such as antioxidation, anti-inflammation, antiapoptosis, and antismooth muscle proliferation. These protective effects of HMOX-1 are mediated, in part, by biliverdin and carbon monoxide. Accumulating evidence indicates that HMOX-1 induction and activation would be preventive for inflammatory bowel disease,42 cardiovascular disease,43 and metabolic syndrome.44 Therefore, the results from the present study suggest that 1 and 2 could show potential for the prevention of such disorders. CPT1A controls mitochondrial β-oxidation, and increased activity of CPT1A in skeletal muscle leads to improved insulin sensitivity in high-fat-overfed rats.45 These observations suggest a potential for 1 and 2 to improve insulin sensitivity and diabetes. Taken together, the prenylated flavonoids 1 and 2 were found to serve as rexinoids that transactivate PPARγ/RXR, PPARδ/RXR, RXR/LXR, and RXR/RAR heterodimers and potentiate the activity of agonists for the partner NRs, thereby modulating cellular functions. Furthermore, 1 and 2 induced preferential expression of some genes, which seem likely to play preventive roles in heart diseases, diabetes, insulin resistance, and atherosclerosis, in a different manner than bexarotene. In conclusion, the finding of novel naturally occurring rexinoids provides possible candidates for therapeutic agents against various diseases and paves the way for a greater understanding of the versatile roles of RXRs. Nonetheless, the clinical value of 1 and 2 remains to be elucidated.

T0901317, but not bexarotene. Further, ABCA1 and ApoE, which exhibit antihypercholesterolemic effects, were upregulated by 1 and 2 in combination with T0901317 in a similar manner to bexarotene. Taken together, both 1 and 2 appear to control LXR target genes in a beneficial manner for lipogenesis and lipid metabolism when compared with bexarotene. The four PPARδ target genes evaluated in this study were significantly induced by either 1 or 2, while the mRNA levels of heme oxygenase-1 (HMOX-1) was not affected by bexarotene (Figure 5). Since the mRNA level of HMOX-1, which is a

Figure 5. Differential expression of mRNAs induced by compounds 1 and 2 and bexarotene. C2C12 myotubes were exposed to 1 (10 μM), 2 (10 μM), or bexarotene (BEX, 1 μM) for 24 h with or without GW501516 (1 μM). The mRNA levels were measured by quantitative RT-PCR, normalized by the β-actin levels, and expressed as the fold inductions relative to that in vehicle-treated cells (CTRL). The data represent the means ± SD of four determinants from a representative of two independent experiments that showed similar results and were evaluated for statistical significance by one-way analysis of variance (ANOVA), followed by Bonferroni’s t-test. **p < 0.01, *p < 0.05 vs CTRL without GW501516, ##p < 0.01 vs CTRL with GW501516. ap < 0.01, bp < 0.05 vs BEX, cp < 0.01, dp < 0.05 vs BEX with GW501516, e p < 0.01 vs compound 2. A value of p < 0.05 was considered to be statistically significant.

■

EXPERIMENTAL SECTION

Chemicals and Materials. The structures of compounds (1 and 2) were established by 1H and 13C NMR analyses (Figures S5−S8, Supporting Information). The purities of the compounds were estimated to be higher than 98% by HPLC analysis. Rosiglitazone (RGZ; PPARγ agonist) and GW501516 (PPARδ agonist) were obtained from Alexia Biochemicals (San Diego, CA, USA). T0901317 (LXR agonist) and calcitriol (VDR agonist) were purchased from Cayman Chemicals (Ann Arbor, MI, USA). Bexarotene (BEX) was obtained from Toronto Research Chemicals Inc. (North York, Canada). atRA was purchased from Sigma-Aldrich (St. Louis, MO, USA). PA452 (RXR pan-antagonist) was kindly provided by Dr. H. Kagechika from the Tokyo Medical and Dental University. All test chemicals were dissolved in dimethyl sulfoxide (DMSO; Nacalai Tesque, Kyoto, Japan) and stored at −80 °C until use. Minimum essential medium (MEM), Dulbecco’s modified Eagle’s medium (DMEM), penicillin, and streptomycin were purchased from SigmaAldrich. Nonessential amino acids were obtained from Wako Pure Chemical Industries (Osaka, Japan). Sophora tonkinensis Gagnep was purchased from Tochimoto Tenkaido Co. Ltd. (Osaka, Japan). A

PPARδ target gene,37 was not significantly induced by GW501516, both 1 and 2 are likely to activate HMOX1 independently of the RXR/PPARδ heterodimer. The mRNA levels for ANGPTL4 (angiopoietin-like protein 4), CPT1A (carnitine palmitoyltransferase 1A), and FABP3 were significantly increased by 1 or 2 treatment alone, as well as treatment with bexarotene. However, when the combinational effects with GW501516 were assessed, 1 and 2 exhibited effects different from bexarotene, and these effects were gene dependent. Compounds 1 and 2 were able to synergistically potentiate the mRNA expression of ANGPTL4 and FABP3 induced by GW501516, but less effectively for CPT1A. In contrast, such clear effects for ANGPTL4 were not observed with bexarotene, 1674



Article

Table 1. Primer Sequences Used for Quantitative Real-Time PCR 1

a

genea

accession number

forward primer

reverse primer

hANGPTL4 hCYP24A1 hACTB mABCA1 mApoD inApoE mANGPTL4 mCPTIA mCYP26A1 mFABP3 mFAS mHMOX-1 mLPL mSREBP-1 mACTB

BC023647 NM_000782 NM_001101 NM_013454 NM_007470 NM_009696 NM_020581 NM_013495 NM_007811 NM_010174 NM_007988 NM_010442 NM_008509 NM_011480 NM_107393

AGCATCTGCAAAGCCAGTTT TGAACGTTGGCTTCAGGAGAA ATTGCCGACAGGATGCAGAA AATTCTCAAGTGCAAACACTTCTGG AGCCAAACAGAGCAACGTCT AACCGCTTCTGGGATTACCT AGACTTCGAGGGGAAAGAGG ATGTGGACCTGCATTCCTTC TTCGGGTTGCTCTGAAGACT GGAGGCAAACTCATCCATGT AAGGCTGGGCTCTATGGATT TGCTCGAATGAACACTCTGG GCAGAGAGAGGACTCGGAGA CCATCTTGGCCACAGTACCT CATCCGTAAAGACCTCTATGCCAAC

GGCGCCTCTGAATTACTGTC AGGGTGCCTGAGTGTAGCATC ACATCTGCTGGAAGGTGGACAG GAGGCATATGCTTGCGGTACA CGATGTCGATGCCATTAGAA TTCCGTCATAGTGTCCTCCA TTGGAAGAGTTCCTGGCAGT GAACTTGCCCATGTCCTTGT CCTCCTCCAAATGGAATGAA TGCCATGAGTGAGAGTCAGG TGAGGCTGGGTTGATACCTC TCCTCTGTCAGCATCACCTG CAAAGGCTTCCTTGGAGTTG TCCTGCTTGAGCTTCTGGTT ATGGAGCCACCGATCCACA

h: human. m: mouse.

specimen (No. 020210002) was deposited in the Herbarium of the Department of Pharmacology of Natural Compounds, Graduate School of Pharmaceutical Sciences, Aichi Gakuin University. Cell Culture. Human embryonic kidney (HEK) 293 cells, mouse macrophage-like RAW264.7 cells, HLE human hepatoma cells, 3T3-L1 fibroblasts, and C2C12 myoblasts were provided by the RIKEN BioResource Center (Tsukuba, Japan) through the National BioResource Project of the Ministry of Education, Culture, Sports, Science and Technology of Japan. F9 mouse teratocarcinoma cells were obtained from the JCRB Cell Bank (Osaka, Japan). RAW264.7 cells and HLE cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS; Nichirei Biosciences Inc., Tokyo, Japan), 100 U/mL of penicillin (Sigma-Aldrich), and 100 μg/mL of streptomycin (Sigma-Aldrich) at 37 °C in a humidified atmosphere of 5% CO2 in air. HEK293 cells were maintained in MEM containing 10% FBS, nonessential amino acids (Sigma-Aldrich), 100 U/mL of penicillin, and 100 μg/mL of streptomycin at 37 °C in a humidified atmosphere of 5% CO2 in air. F9 cells were maintained in DMEM containing 10% FBS, 100 U/mL of penicillin, and 100 μg/mL of streptomycin at 37 °C in a humidified atmosphere of 5% of CO2 in air, using culture dishes that were precoated with 0.2% gelatin. C2C12 myoblasts were maintained in DMEM supplemented with 10% FBS at 37 °C in a humidified atmosphere of 5% CO2 in air. At confluence, C2C12 myoblasts were induced to differentiate in medium containing 2% horse serum (Invitrogen, Carlsbad, CA, USA). After differentiation, the medium was replaced every other day for 5 days, and the C2C12 myotubes were then used for the experiment. Luciferase Reporter Gene Assay. HEK293 cells were transfected by calcium phosphate co-precipitation with the following: 60 ng of pCMX-hRXR-α and 150 ng of CRBPII-tk-Luc for the RXR reporter assay, with 30 ng of pCMX-hRAR-α and 120 ng of tk-βRE-Luc for the RAR reporter assay, with the addition of 30 ng of pCMX-β-gal expression vector and carrier DNA pUC18 to yield 600 ng of total DNA per well. After 8 h of transfection, the cells were thoroughly washed with fresh medium and were left to continue incubation in the presence of the compounds at the indicated concentrations in the medium containing 10% FBS for another 24−48 h. Luciferase and βgalactosidase activities of the cell lysates were analyzed using a luminescence reader and a spectrophotometer, respectively. Luciferase activity was normalized relative to the activity of an internal βgalactosidase control and expressed as the means ± SD of the relative luciferase activity, which was determined in triplicate or quadruplicate experiments from a representative of three independent experiments that showed similar results. Binding Activity of RXR or PPAR Ligands. The binding activity of 1 and 2 to RXRα, β, and γ was determined by NR cofactor assays using the EnBio RCAS kit for RXRs-SRC and PPARs-CBP (Fujikura Kasei Co. Ltd., Ibaragi, Japan), according to the manufacturer’s

instructions. The binding activity in this kit is based on the liganddependent interaction between RXR isotypes and the steroid receptor coactivator-1 (SRC-1), or PPAR isotypes and the cAMP responsive element-binding protein-binding protein (CBP), followed by detection using anti-RXR and anti-PPAR antibodies conjugated with horseradish peroxidase, respectively. CD3254 (RXRs), GW7647 (PPARα), GW1929 (PPARγ), and GW501516 (PPARδ) were used as the full agonists. Efficacy and potency were evaluated using maximum B/ Bmax% and EC50, respectively. B/Bmax% is a relative value of the OD450 of the test samples (OD450sample), when the OD450 of the vehicle control (OD450vehicle) and the maximum OD450 of the full agonist (OD450max) are defined as 0 and 100%, respectively. B/Bmax% was calculated from the following equation:

B /Bmax % =

(OD450sample − OD450vehicle) (OD450max − OD450vehicle)

Quantitative RT-PCR. Total RNA was isolated from the cultured cells using RNAiso Plus (Takara Bio Inc., Ohtsu, Japan). Following treatment of the RNA samples with DNase (Invitrogen), the first strand cDNA was synthesized from 0.5 μg of total RNA using the oligo(dT)20 RT primer and ReverTra Ace (Toyobo, Japan), according to the manufacturer’s instructions. Quantitative real-time PCR (SYBR green) analysis was performed using the Takara-bio TP800 Thermal Cycler Dice real-time system. Levels of mRNA expression were subsequently normalized relative to β-actin mRNA levels and calculated according to the delta−delta Ct method. Data are represented as means ± SD of three determinants from a representative of three independent experiments, which showed similar results. The primer sequences used in the present study are listed in Table 1. Western Blot Analysis. RAW264.7 cells were treated with 10 μM compound 1 or compound 2 or 1 μM bexarotene for 24 h and harvested. The protein levels of ABCA1 were determined by Western blotting, as described previously.23 3T3-L1 Cell Differentiation. 3T3-L1 cells were grown to confluency in DMEM containing 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C under 5% CO2. At 2 days after reaching confluency, the cells were exposed to differentiation medium containing 10% FBS, 5 μg/mL insulin, 0.25 μM dexamethasone (DEX), and 0.5 mM isobutylmethylxanthine (IBMX) for 48 h. The cells were then incubated in postdifferentiation medium containing 10% FBS and 5 μg/mL of insulin for a further 48 h. To determine the effects of rexinoids, 1, 2, or bexarotene dissolved in DMSO was added to the postdifferentiation medium and incubated for 4 days. The cells were washed three times with PBS, fixed with 10% formalin in PBS for 1 h at room temperature, washed once with PBS, and stained with a filtered Oil red O stock solution (0.5 g of Oil red O in 100 mL of 1675



Article

(13) Ishizawa, M.; Kagechika, H.; Makishama, M. Biochem. Biophys. Res. Commun. 2012, 418, 780−785. (14) Mukherjee, R.; Davies, P. J. A.; Crombie, D. L.; Bischoff, E. D.; Cesario, R. M.; Jow, L.; Hamann, L. G.; Boehm, M. F.; Mondon, C. E.; Nadzan, A. M.; Paterniti, J. R., Jr.; Heyman, R. A. Nature 1997, 386, 407−410. (15) Ogilvie, K. M.; Saladin, R.; Nagy, T. R.; Urcan, M. S.; Heyman, R. A.; Leibowitz, M. D. Endocrinolgy 2004, 145, 565−573. (16) Lalloyer, R.; Fiévet, C.; Lestavel, S.; Torpier, G.; van der Veen, J.; Touche, V.; Bultel, S.; Yous, S.; Kuipers, F.; Paumelle, R.; Fruchart, J. C.; Staels, B.; Tailleux, A. Arterioscler. Thromb. Vasc. Biol. 2006, 26, 2731−2737. (17) Tanaka, T.; De Luca, L. M. Cancer Res. 2009, 69, 4945−4947. (18) Ruzicka, T.; Lynde, C. W.; Jemec, G. B. E.; Diepgen, T.; BerthJones, J.; Coenraads, P. J.; Kaszuba, A.; Bissonnette, R.; Varjonen, E.; Holló, P.; Cambazard, F.; Lahfa, M.; Elsner, P.; Nyberg, F.; Svensson, A.; Brown, T. C.; Harsch, M.; Maares, J. Br. J. Dermatol. 2008, 158, 808−817. (19) Lansigan, F.; Foss, F. M. Drugs 2010, 70, 273−286. (20) Pinaire, J. A.; Reifel-Miller, A. PPAR Res. 2007, 2007, 94156. (21) Liu, S.; Ogilvie, K. M.; Klausing, K.; Lawson, M. A.; Julley, D.; Li, D.; Bilakovics, J.; Pascual, B.; Hein, N.; Urcan, M.; Leibowitz, M. A. Endocrinology 2002, 143, 2880−2885. (22) Lenhard, J. M.; Lancaster, M. E.; Paulik, M. A.; Weiel, J. E.; Binz, J. G.; Sundseth, S. S.; Gaskill, B. A.; Lightfoot, R. M.; Brown, H. R. Diabetologia 1999, 42, 545−554. (23) Kotani, H.; Tanabe, H.; Mizukami, H.; Makishima, M.; Inoue, M. J. Nat. Prod. 2010, 73, 1332−1336. (24) Zhang, H.; Li, L.; Chen, L.; Hu, L.; Jiang, H.; Shen, X. J. Mol. Biol. 2011, 407, 13−20. (25) de Urquiza, A. M.; Liu, S.; Sjöberg, M.; Zetterström, R. H.; Griffiths, W.; Sjövall, J.; Perlmann, T. Science 2000, 290, 2140−2144. (26) Kitareewan, S.; Burka, L. T.; Tomer, K. B.; Parker, C. E.; Deterding, L. J.; Stevens, R. D.; Forman, B. M.; Mais, D. E.; Heyman, R. A.; McMorris, T.; Weinberger, C. Mol. Biol. Cell 1996, 7, 1153− 1166. (27) Lemotte, P. K.; Keidel, S.; Apfel, C. M. Eur. J. Biochem. 1996, 236, 328−333. (28) Ding, P.; Chen, D. Helv. Chim. Acta 2007, 90, 2236−2244. (29) Li, X. N.; Lu, Z. Q.; Chen, G. T.; Yan, H. X.; Sha, N.; Guan, S. H.; Yang, M.; Hua, H. M.; Wu, L. J.; Guo, D. A. Magn. Reson. Chem. 2008, 46, 898−902. (30) Han, A. R.; Kang, Y. J.; Windono, T.; Lee, S. K.; Seo, E. K. J. Nat. Prod. 2006, 69, 719−721. (31) Shin, H. J.; Kim, H. J.; Kwak, J. H.; Chun, H. O.; Kim, J. H.; Park, H.; Kim, D. H.; Lee, Y. S. Bioorg. Med. Chem. Lett. 2002, 12, 2313−2316. (32) Chi, Y. S.; Jong, H. G.; Son, K. H.; Chang, H. W.; Kang, S. S.; Kim, H. P. Biochem. Pharmacol. 2001, 62, 1185−1191. (33) Singh Ahuja, H.; Liu, S.; Crombie, D. L.; Boehm, M.; Leibowitz, M. D.; Heyman, R. A.; Depre, C.; Nagy, L.; Tontonoz, P.; Davies, P. J. Mol. Pharmacol. 2001, 59, 765−773. (34) Cha, B. S.; Ciaraldi, T. P.; Carter, L.; Nikoulina, S. E.; Mudaliar, S.; Mukaherjee, R.; Paterniti, J. R., Jr.; Henry, R. R. Diabetologia 2001, 44, 444−452. (35) Hessvik, N. P.; Boekschoten, M. V.; Baltzersen, M. A.; Kersten, S.; Xu, X.; Andersén, H.; Rustan, A. C.; Thoresen, G. H. Am. J. Physiol. Endocrinol. Metab. 2010, 298, E602−613. (36) Lalloyer, F.; Pedersen, T. A.; Gross, B.; Lestavel, S.; Yous, S.; Vallez, E.; Gustafsson, J. A.; Mandrup, S.; Fiévet, C.; Staels, B.; Tailleux, A. Arterioscler. Thromb. Vasc. Biol. 2009, 29, 1488−1495. (37) Ali, F.; Ali, N. S.; Bauer, A.; Boyle, J. J.; Hamdulay, S. S.; Haskard, D. O.; Randi, A. M.; Mason, J. C. Cardiovasc. Res. 2010, 85, 701−710. (38) Galaup, A.; Gomez, E.; Souktani, R.; Durand, M.; Cazes, A.; Monnot, C.; Teillon, J.; Le Jan, S.; Bouleti, C.; Briois, G.; Philippe, J.; Pons, S.; Martin, V.; Assaly, R.; Bonnin, P.; Ratajczak, P.; Janin, A.; Thurston, G.; Valenzuela, D. M.; Murphy, A. J.; Yancopoulos, G. D.;

isopropyl alcohol (Kishida Chemical, Osaka, Japan)) for 15 min at room temperature. The cells were then washed twice with water for 15 min each and visualized. Statistical Analysis. Data are presented as means ± SD and were evaluated for statistical significance by the one-way analysis of variance, followed by Bonferroni’s t-test. A value of p < 0.05 was considered to be statistically significant.

■

ASSOCIATED CONTENT

S Supporting Information *

H and 13C NMR analysis of prenylated flavanones 1 and 2, the activation of LXRα and RAR by 1 and 2 demonstrated by the luciferase reporter gene assay, the binding activities of 1 and 2 to PPARs, and induction of ABCA1 protein and 3T3-L1 cell adipogenesis by 1 and 2. These materials are available free of charge via the Internet at http://pubs.acs.org.

1

■

AUTHOR INFORMATION

Corresponding Author

*Tel: +81-52-757-6792. Fax: +81-52-757-6793. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The RXR pan-antagonist PA452 was kindly provided by Dr. H. Kagechika of the Tokyo Medical and Dental University. We thank Dr. M. Makishima (Nihon University School of Medicine) for providing the RXR and RAR expression vectors and the reporter plasmids. This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (26460134).

■

REFERENCES

(1) Dawson, M. I.; Xia, Z. Biochim. Biophys. Acta 2012, 1821, 21−56. (2) Lefebvre, P.; Benomar, Y.; Staels, B. Trends Endocrinol. Metab. 2010, 21, 676−683. (3) Széles, L.; Póliska, S.; Nagy, G.; Szatmari, I.; Szanto, A.; Pap, A.; Lindstedt, M.; Santegoets, S. J. A. M.; Rühl, R.; Dezsö, B.; Nagy, L. Mol. Endocrinol. 2010, 24, 2218−2231. (4) Mangelsdorf, D. J.; Borgmeyer, U.; Heyman, R. A.; Zhou, J. Y.; Ong, E. S.; Oro, A. E.; Kakizuka, A.; Evans, R. M. Genes Dev. 1992, 6, 329−344. (5) Yasmin, R.; Kannan-Thulasiraman, P.; Kagechika, H.; Dawson, M. I.; Noy, N. J. Mol. Biol. 2010, 397, 1121−1131. (6) Bruck, N.; Bastien, J.; Bour, G.; Tarrade, A.; Plassat, J. L.; Bauer, A.; Adam-Stitah, S.; Rochette-Egly, C. Cell Signal 2005, 17, 1229− 1239. (7) Matsushima-Nishiwaki, R.; Okuno, M.; Adahi, S.; Sano, T.; Akita, K.; Moriwaki, H.; Friedman, S. L.; Kojima, S. Cancer Res. 2001, 61, 7675−7682. (8) Zhao, Y.; Qin, S.; Atangan, L. I.; Molina, Y.; Okawa, Y.; Arpawong, H. T.; Ghosn, C.; Xiao, J. H.; Vuligonda, V.; Brown, G.; Chandraratna, R. A. S. J. Biol. Chem. 2004, 279, 30844−30849. (9) Choi, S. J.; Chung, S. S.; Rho, E. J.; Lee, H. W.; Lee, M. H.; Choi, H. S.; Seol, J. H.; Baek, S. H.; Bang, O. S.; Chung, C. H. J. Biol. Chem. 2006, 281, 30669−30677. (10) Vedell, P. T.; Lu, Y.; Grubbs, C. J.; Yin, Y.; Jiang, H.; Bland, K. I.; Muccio, D. D.; Cvetkovic, D.; You, M.; Lubet, R. Mol. Pharmacol. 2013, 83, 698−708. (11) Sugii, S.; Evans, R. M. FEBS Lett. 2011, 585, 2121−2128. (12) Nishimaki-Mogami, T.; Tamehiro, N.; Sato, Y.; Okuhira, K.; Sai, K.; Kagehika, H.; Shudo, K.; Abe-Dohmae, S.; Yokoyama, S.; Ohno, Y.; Inoue, K.; Sawada, I. Biochem. Pharmacol. 2008, 76, 1006−1013. 1676



Article

Tissier, R.; Berdeaux, A.; Ghaleh, B.; Germain, S. Circulation 2121, 125, 140−149. (39) Georgiadi, A.; Lichtenstein, L.; Degenhardt, T.; Boekschoten, M. V.; van Bilsen, M.; Desvergne, B.; Müller, M.; Kersten, S. Circ. Res. 2010, 106, 1712−1721. (40) Lichtenstein, L.; Mattijssen, F.; de Wit, N. J.; Georgiadi, A.; Hooiveld, G. J.; van der Meer, R.; He, Y.; Qi, L.; Köster, A.; Tamsma, J. T.; Tan, N. S.; Müller, M.; Kersten, S. Cell Met. 2010, 12, 580−592. (41) Robciuc, M. R.; Skrobuk, P.; Anisimov, A.; Olkkonen, V. M.; Alitalo, K.; Eckel, R. H.; Koistinen, H. A.; Jauhiainen, M.; Ehnholm, C. PLoS One 2012, 7, e46212. (42) Whittle, B. J. R.; Varga, C. Pharmacol. Rep. 2010, 62, 546−556. (43) Wu, M. L.; Ho, Y. C.; Lin, C. Y.; Yet, S. F. Am. J. Cardiovasc. Dis. 2011, 1, 150−158. (44) Burgess, A.; Li, M.; Vanella, L.; Kim, D. H.; Rezzani, R.; Rodella, L.; Sodhi, K.; Canestraro, M.; Martasek, P.; Peterson, S. J.; Kappas, A.; Abraham, N. G. Hypertension 2010, 56, 1124−1130. (45) Bruce, C. R.; Hoy, A. J.; Turner, N.; Watt, M. J.; Allen, T. I.; Carpenter, K.; Cooney, G. J.; Febbraio, M. A.; Kraegen, E. W. Diabetes 2009, 58, 550−558.

1677


Rexinoids Isolated from Sophora tonkinensis with a Gene Expression

Recommend Documents