Brief Article pubs.acs.org/molecularpharmaceutics
Ribavirin Uptake into Human Hepatocyte HHL5 Cells Is Enhanced by Interferon‑α via up-Regulation of the Human Concentrative Nucleoside Transporter (hCNT2) Itziar Pinilla-Macua,†,‡,∥,⊥ Paula Fernández-Calotti,*,†,‡,⊥ Sofía Pérez-del-Pulgar,‡,§ and Marçal Pastor-Anglada†,‡ †
Department of Biochemistry and Molecular Biology, University of Barcelona, Institute of Biomedicine (IBUB), 08028 Barcelona, Spain ‡ Oncology Program, National Biomedical Research Institute of Liver and Gastrointestinal Diseases (CIBER EHD), Instituto de Salud Carlos III, 08028 Barcelona, Spain § Liver Unit, Hospital Clínic, IDIBAPS, Barcelona, Spain ABSTRACT: Ribavirin is a broad spectrum antiviral that increases the response rate in chronic hepatitis C patients when administered in combination with IFNα. Ribavirin is a purine nucleoside derivative, transported into hepatocytes by nucleoside transporters. hCNT2 is the best candidate to mediate ribavirin uptake into hepatocytes due to its high-affinity for purines and its capacity to concentrate its substrates intracellularly. The aim of this study was to determine whether hCNT2 function is under IFNα modulation. IFNα treatment of the nontransformed human hepatocyte-derived cell line HHL5 induced a rapid and transient increase in hCNT2 activity after cytokine addition. hCNT2 activity up-regulation was associated with increased ribavirin accumulation into cells. This increase was consistent with the translocation of hCNT2-containing vesicles to the plasma membrane via a mechanism requiring ERK 1/2 and ROCK activation and cytoskeleton integrity. Longer treatments with IFNα induced transcriptional activation of the hCNT2encoding gene (SLC28A2), resulting in a sustained increase in hCNT2-related activity. These observations are proof of concept for at least one of the putative mechanisms underlying the synergistic responses induced by combination therapy with IFNα and ribavirin. KEYWORDS: concentrative nucleoside transporter 2 (hCNT2), hepatitis C, interferon-α, ribavirin
■
INTRODUCTION Ribavirin is a guanosine-derived drug used, in combination with interferon α, as a standard therapy in chronic hepatits C infection. It is phosphorylated intracellularly to form mono-, di-, and triphosphate derivatives, which accumulate inside cells to exert therapeutic effects. The proposed mechanisms for the antiviral actions of ribavirin are (1) induction of error catastrophe, (2) inhibition of the activity of HCV RNA polymerase, (3) inhibition of the activity of inosine monophosphate dehydrogenase to decrease the GTP pool, and (4) modulation of the immune system.1 Additionally, a recent study revealed that ribavirin potentiates IFNα action by promoting IFN-stimulated induction of gene expression.2 Since many of the postulated antiviral actions of ribavirin occur inside hepatocytes, its uptake into target cells is a key step in the exertion of its therapeutic effects. Ribavirin import requires specific plasma membrane transporters. In particular, human nucleoside transporters (hNTs) can mediate the translocation of most nucleoside-derived drugs currently used in the treatment of viral diseases and cancer.3 hNT proteins belong to two unrelated gene families, SLC28 and SLC29, which encode concentrative (CNT) and equilibrative nucleo© 2014 American Chemical Society
side transporter (ENT) proteins, respectively. hENTs mediate the facilitative transport of nucleosides down their concentration gradient across the plasma membrane. The family has four members, although hENT1 and hENT2 are the only two ENTs to be primarily expressed at the plasma membrane, both showing broad substrate selectivity. hENT1 and hENT2 differ in their sensitivity to nitrobenzylthioinosine (NBTI) inhibition, the former being much more sensitive to NBTI (Ki values in the nanomolar range) than hENT2.4 On the other hand, hCNT proteins are Na+-coupled transporters that rely upon the Na+ transmembrane gradient to facilitate substrate accumulation inside cells. This family consists of three members: hCNT1, hCNT2, and hCNT3. hCNT1 and hCNT2 preferentially transport pyrimidine and purine nucleosides, respectively, whereas hCNT3 accepts both types of nucleoside.5,6 Importantly, the rate of uptake of ribavirin into HCVinfected cells might determine its antiviral potency, thus making Received: Revised: Accepted: Published: 3223
April 9, 2014 June 17, 2014 June 23, 2014 June 23, 2014 dx.doi.org/10.1021/mp500263p | Mol. Pharmaceutics 2014, 11, 3223−3230
Molecular Pharmaceutics
Brief Article
Table 1. Oligonucleotides and Probes Used in RT-PCR target gene
encoded protein
sense 5′-3′/antisense 5′-3′
probes 5′FAM-TAMRA3′
SLC28A1 SLC28A2 SLC28A3 SLC29A1 SLC29A2
hCNT1 hCNT2 hCNT3 hENT1 hENT2
TGATTTCTTGGAAAGCCTGGA/TGCTCCTGATCTCTGCGG AAGTAGAGCCTGAGGGAAGCAA/GCCCAGTCCATCCCCC GAGCTGTGCAAAGCAGGGA/TGGCGAATCCTGCTCAACTGTG GCAAAGGAGAGGAGCCAAGA/TTCATTGGTGGGCTGAGAGTT CCCTGGATCTTGACCTGGAG/GGTTTTCCTGGCTTCTGGG
AAGGCCAGCTCCCTAGGAGTGACTTGAG AGGACTGACGCACAAGGAACACAGCC CACACAAACACCAGGATGAAGAACAGG CAGGCAAAGAGGAATCTGGAGTTTCAGTCTC AGGAGCCGGAATCAGAGCCAGATGA
antibiotics (100 U/mL penicillin G, 0.1 mg/mL streptomycin, and 0.25 μg/mL Fungizone), 2 mM glutamine, and 0.1 mM nonessential amino acids. All reagents were purchased from Invitrogen (Carlsbad, CA, U.S.A.). Cells were maintained at 37 °C and 5% CO2. HHL5 cells passages used in all experiments ranged from 3 to 12. Nucleoside Transport Assay. Nucleoside transport activity was monitored in confluent cultured HHL5 cells in either Na+-containing or Na+-free medium as previously described.12 Briefly, the substrate of interest, [3H]guanosine or [3H]ribavirin, was added to the cells at a final concentration of 1 μM and 1 μCi/mL. Uptake was measured in the presence of either 137 mM NaCl or 137 mM choline chloride. Incubation was stopped after 1 min (thus maintaining initial velocity conditions) by washing the monolayers twice in 2 mL of cold stop buffer (137 mM NaCl and 10 mM Tris/HEPES, pH 7.4). Cells were then lysated with 100 μL of 100 mM NaOH, 0.5% Triton-X100. Aliquots were taken for protein determination (BCA Protein Assay Reagent, Thermo Scientific Pierce, IL, U.S.A.) and radioactivity measurements. In the presence of Na+, ENTs and CNTs are functional, although only CNTs require this ion for substrate translocation. Thus, sodium-dependent nucleoside (CNT-related) activity was determined by subtracting uptake rates measured in the choline chloride medium (almost exclusively related to ENT1 and ENT2 activities) from measurements obtained in the sodium chloride medium. Cross-inhibition experiments were performed as described above but adding saturating concentrations (100 μM) of a secondary nonradiolabeled nucleoside to the incubation media which will compete for the transporter and block the transport of radiolabeled substrate. By adding extra cytidine in [3H]guanosine, hCNT3 -mediated transport will be blocked but not hCNT2; whereas the addition of extra guanosine to [3H]cytidine uptake media would block hCNT3 activity but not hCNT1. hCNT2-mediated uptake was determined by subtracting [3H]guanosine + cytidine from [3H]guanosine Na+-dependent uptake, hCNT1 by subtracting [3H]cytidine + guanosine from [3H]cytidine and hCNT3 from the subtraction of [3H]guanosine + cytidine from [3H] guanosine and verified by the subtraction of [3H]cytidine + guanosine from [3H] cytidine. The equilibrative (Na+independent) transport inhibited by NBTI (1 μM) accounts for the ENT1-related nucleoside transport activity, whereas the NBTI-resistant transport includes residual ENT2-related uptake plus diffusion and binding components. Western Blotting. HHL5 cells were cultured to confluence and incubated with 300 U/mL of IFNα for 3−15 min. At 3-min interval time points, cells were washed with cold phosphatebuffered saline (PBS), and protein extracts were obtained as previously described.16 Samples of the supernatants containing 20 μg of the protein were boiled for 5 min and separated by SDS-PAGE on standard 12% gels and transferred to Immobilon-P membranes (Millipore, Bedford, MA, U.S.A.). Membranes were then incubated with specific primary
NT-mediated ribavirin transport and probably selected hNT proteins of therapeutic relevance. Human hepatocytes show mRNA expression for all the surface-expressed NTs described so far, i.e., hENT1, hENT2, hCNT1, hCNT2, and hCNT3, and of these, all but hCNT1 are known to be able to transport ribavirin, albeit with differing efficiency.7−9 hCNT expression in liver is highly regulated and dependent on the differentiation status of the hepatocytes, being lower when cells are undifferentiated (i.e., tumors and fetal hepatocytes).10−12 Conversely, hENTs are ubiquitously expressed and somehow independent of the differentiation status of cells. Although it has been reported that hENT1 is a major mediator of ribavirin uptake into hepatocytes,8 cells used for this type of studies lack hCNT-type function and, consequently, are not suitable models of differentiated human hepatocytes, which are known to express hCNT2 at both the sinusoidal and the canalicular membrane domains.5,12−14 In the present study we have further characterized the differentiated nontumoral human hepatocyte-derived cell line HHL515 for its ability to retain hCNT-type transporter function as primary hepatocytes do. HHL-5 cells show hCNT2-related transport activity, which is the main purine transporter and thus a suitable mediator of ribavirin uptake into cells. Interestingly, hCNT2 function is here shown to be up-regulated by IFNα, thus providing a novel mechanistic explanation for the synergistic action of the two agents in HCV combination therapy.
■
EXPERIMENTAL SECTION
Chemicals and Reagents. Guanosine, cytidine, uridine, NBTI, colchicine, cycloheximide, cytochalasin B, and Y27632 were purchased from Sigma-Aldrich (St Louis, MO, U.S.A.). [3H]Guanosine was from Hartmann Analytic GmbH, [3H]uridine was purchased from PerkinElmer (Waltham, MA) and [3H]cytidine and [3H]ribavirin, from Moravek Biochemicals (Brea, CA, U.S.A.). Inhibitors of PI3K (LY294002), MEK (PD98059), and p38 (SB 203580) were purchased from Calbiochem (San Diego, CA, U.S.A.). PEG-IFNα2b solution (GenScript) and ribavirin (Sigma-Aldrich; St Louis, MO, U.S.A.) were a kind gift of Dr. Juan Ignacio Esteban (Hospital Vall d’Hebrón). Monoclonal antibodies against human phospho-ERK 1/2 and antihuman ERK 1/2 were from Cell Signaling (Danvers, MA, U.S.A.). Cell Culture. The HHL5 cell line was kindly donated by Arvind H. Patel, Institute of Virology, Glasgow. It is a cell line derived from healthy human hepatocytes immortalized with retrovirus vector LXSN16E6E7 based on Moloney’s mouse leukemia virus, which expresses the human papillomavirus type 16 (HPV16) E6 and E7 oncoproteins that have been shown to immortalize human epithelial cells. This cell line retains features of differentiated hepatocytes, such as low levels of α-fetoprotein and limited monolayer growth in collagen matrix15 HHL5 cells were routinely cultured in DMEM medium supplemented with 5% fetal bovine serum, 1% of a mixture of 3224
dx.doi.org/10.1021/mp500263p | Mol. Pharmaceutics 2014, 11, 3223−3230
Molecular Pharmaceutics
Brief Article
antibodies, and with horseradish peroxidase (HRP)-conjugated secondary antibodies (Biorad Laboratories Inc., Hercules, CA, U.S.A.). Immunoreactive bands were detected by enhanced chemiluminescence (ECL, Amersham Pharmacia Biotech, Piscataway, NJ, U.S.A.). Densitometric analysis of the immunoreactive bands was performed using ImageJ software (NIH; http://rsb.info.nih. gov/ij/) RNA Isolation and Quantitative RT-PCR. Total RNA extraction, RNA retrotranscription, and real-time PCR (RTPCR) from cultured HHL5 cells were performed as previously described.17 Quantitative real-time PCR amplification of hCNTs and hENTs were performed with primers and probes from Applied Biosystems (Foster City, CA), summarized in Table 1. Absolute RT PCR results were obtained from interpolation of ΔCT of each sample in line regression standards for number of cDNA copies of each gene. Data Analysis. Data are expressed as the mean ± s.e.m. (standard error of the mean) obtained from triplicates of at least three independent experiments carried out on different days on different cell passages. Statistical analysis was performed using GraphPad Prism version 5.03 for Windows (GraphPad Software, San Diego, CA). Statistical differences were assessed using the one sample t-test or unpaired t-test. P values
