Ribosomal RNA-Selective Light-Up Fluorescent Probe for Rapidly

Apr 24, 2019 - Ribosomal RNA-Selective Light-Up Fluorescent Probe for Rapidly ..... biocompatibility, and fantastic cellular permeabilities, we antici...
1 downloads 0 Views 661KB Size
Download PDF
Subscriber access provided by University of Sussex Library

Article

Ribosomal RNA-selective light-up fluorescent probe for rapidly imaging the nucleolus in live cells Chunyan Cao, Peng Wei, Ruohan Li, Yaping Zhong, Xiang Li, Fengfeng Xue, Yibing Shi, and Tao Yi ACS Sens., Just Accepted Manuscript • DOI: 10.1021/acssensors.9b00464 • Publication Date (Web): 24 Apr 2019 Downloaded from http://pubs.acs.org on April 24, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Ribosomal RNA-selective light-up fluorescent probe for rapidly imaging the nucleolus in live cells Chunyan Cao,† Peng Wei,† Ruohan Li,† Yaping Zhong,† Xiang Li,‡ Fengfeng Xue,† Yibing Shi, † Tao Yi*,† †Department

of Chemistry, Fudan University, 2005 Songhu Road, Shanghai 200438, China

‡School

of Chemistry and Environmental Engineering, Shanghai Institute of Technology, 100 Hai Quan Road, Shanghai 201418, China KEYWORDS: Fluorescent Probe, Nucleolus, rRNA Selectivity, Detection, Live Cell Imaging. ABSTRACT: RNA-based fluorescent probes are currently limited by their low selectivity towards RNA versus DNA, and low specificity to different RNA structures. Poor membrane permeability is another defect of existing fluorogenic RNA probes for intracellular imaging. In this work, a naphthalimide derivative, probe 1, was developed for the rapid and selective detection of intracellular ribosomal RNA (rRNA). Probe 1 exhibited a 32-fold fluorescent enhancement in response to rRNA binding and showed desirable selectivity for rRNA versus DNA and other nucleic acids in phosphate buffer at pH 7.2. Importantly, probe 1 displayed excellent permeability of the nucleolus, could be taken up in 1 minute by four different cell lines, and may be the fastest nucleolus dye. The excellent selectivity of probe 1 towards rRNA is attributed to the specific interaction between the complicated 3D structures of rRNA, which was confirmed by quantum calculations using molecular docking simulations. An appropriate lipophilic balance in 1 with the hydrophilic amine group and hydrophobic naphthalimide, as well as its high water solubility guarantee the high permeability of 1 in cell membranes and nucleolus pores, compared to other analogues (e.g., probes 2–8 in this work). Furthermore, enlarged confocal laser micro images of nucleoli and RNase digestion tests revealed that 1 remained highly selective towards rRNA, even for intracellular imaging. As a live cell probe, 1 also exhibited better photostability than the commercial RNA dye, SYTO RNA select.

RNA is a product of cell metabolism, which displays a wide range of functions, including protein synthesis,1 gene regulation2 and reaction catalysts.3 RNA mainly includes messenger RNA (mRNA), transfer RNA (tRNA) and ribosomal RNA (rRNA). As the most abundant RNA, rRNA is produced in nucleolus and can assemble into ribosomes with ribosomal proteins in all living organisms. Compared to DNA, mRNA and tRNA, rRNA possesses more complicated and sophisticated three dimensional (3D) structures folded by more diverse 2D structures, such as single-stranded, internal loop, bulges, and hairpins.4 To analyse the concentration and function of rRNA, extracellular analytic methods such as DNA microarrays and denaturing gradient gel electrophoresis have been widely developed.5 However, those methods do not provide spatiotemporal information for a 3D cell. Therefore, methods for rapidly and selectively visualizing rRNA in live cells are of vital importance. Numerous efforts have been devoted to developing fluorescent probes for intracellular RNA imaging. Compared to oligonucleotides and protein probes,6-8 small molecular organic fluorophores provide a practical platform for intracellular RNA imaging because of their superior chemical tractability and versatile photophysical properties.9-20 Until now, more than twenty fluorophores for intracellular RNA imaging have been developed, but only one commercial RNA fluorescent probe is available. Such probes typically exhibited turn-on responses for

RNA, but suffered from low selectivity due to the interference of DNA and low permeability of cellular membranes and nuclear pores. It is particularly difficult to image intracellular rRNA, compared to total RNA due to not only interference from DNA, but also from other nucleic acids such as mRNA and tRNA that share more similar structures with rRNA than DNA.21 From our point of view, an ideal fluorescent rRNA probe should include the following characteristics: a turn-on response for rRNA binding, significant selectivity for RNA versus DNA and other nucleic acids, and high permeability to biological membranes, especially to nuclear pores. In fact, dyes that meet all such requirements are rarely available. Naphthalimide derivatives are often used for biosensors,22-24 DNA detection 25, 26 and anticancer agents 27 due to their special electronic properties, high photostability, and easy modification. Previously, we developed several naphthalimide derivatives for organogels,28 biosensors29-31 and DNA detection.32 The excellent features of naphthalimide molecules encouraged us to explore their applications for rRNA detection, which has not been reported until now. Based on the more diverse and sophisticated 3D structure of rRNA compared to the traditional double helix structure of DNA, developing specific dyes matching the 3D structure is a strategy for rRNA intracellular imaging. As to cellular permeability, it is reported that the balance of the hydrophilic and hydrophobic groups of a dye is inclined to penetrate

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

amphiphilic membrane structures to enhance the cellular permeability.33 Based on this, we identified a naphthalimide derivative with a dimethyl amine group at the 4 position of naphthalimide and an alkyl amine at the imide portion of the molecule (probe 1 in Scheme 1 and Figure 1a). Probe 1 was reported as a control compound for an artesunate metabolic study in 2017.34 Probe 1 matches with our proposal that the dimethyl amine in the 4 position of naphthalimide can not only act as an intramolecular charge transfer (ICT) donor, but also act as a rotating group to lower the fluorescent quantum yield of the free dye. On the other hand, the terminal alkyl amine group of 1 can not only be a hydrophilic balance of the complete hydrophobic ring, but also a hydrogen bond donor when binding with rRNA. As anticipated, probe 1 demonstrated a turn-on response for rRNA and showed higher selectivity for rRNA than DNA and other nucleic acids, in vitro. Probe 1 could rapidly cross the cellular membrane and nuclear pores to give bright green fluorescence for imaging rRNA in the nucleolus and cytoplasm within 1 minute. Probe 1 is the first reported naphthalimide dye for intracellular imaging of rRNA, and is more advantageous than the commercial probe, SYTO RNA select. Such advantages include superior cellular permeability, easier availability, amenable to washing, higher photostability, and lower cost, among others. To optimize the structure and determine the binding mechanism to rRNA, seven other congeneric derivatives were also synthesized and studied (Scheme 1). The binding mechanism between 1 and rRNA was further studied by quantum calculation using molecular docking simulations.

O

N

O

COOCH3

COOH

NH2 O

N

O

N

N

1

2

O

N

O

N O

N

N

O

analogues were also designed as references of probe 1 (Scheme 1). For example, four compounds named 2, 3, 4, 5 were designed by replacing aliphatic amine group of 1 with COOH, COOCH3, N(CH3)2 and NH-Boc, respectively, to determine the role of the amine group in binding rRNA and penetrating the cellular membrane and nuclear pores. Probe 6 containing an extended six-carbon chain was used to evaluate the effect of carbon chain length on binding rRNA. The diethyl amine group of probe 7 at the 4 position of naphthalimide generated larger steric hindrance to compare the function of the dimethyl amine group of probe 1. Moreover, the morpholine ring at the 4 position of probe 8 not only supplied larger steric hindrance, but also lowered the rotation of the aryl amine, compared to that of the dimethyl amine group of probe 1. Photophysical properties of probes 1–8. The photophysical properties of probes 1–8 were measured in PB at pH 7.2. Generally, probe 1 showed classical ICT properties 27 with a Dπ-A structure in which the dimethyl amine group acted as an electron donor, while the 1,8-dicarboxyl groups acted as electron acceptors. As shown in Figure 1b, probe 1 exhibited a broad absorption band between 350-500 nm and centred at 444 nm at a concentration of 40 µM ( = 11250 M-1·cm-1). The maximum fluorescent emission wavelength was located at 545 nm and the Stokes shift was 101 nm. As expected, the absolute fluorescent quantum yield of 1 was only 0.22% due to the nonradiative transition induced by the rotations of the dimethyl amine groups (Table S1). Comparably, probes 2–7 had similar maximum absorptions at about 440 nm and maximum emissions at about 550 nm (Figure S1). The photophysical properties of probes 1–8 are listed in Table S1. It is notable that the quantum yields of most of those compounds were less than 1%, except for compound 8. The higher fluorescent quantum yield of 8 was due to the prohibited rotation of the morpholine group. Therefore, the strategy of the rotation-free dimethyl amine group at the 4 position was efficient at reducing the quantum yield of the free dye.

N

3

4

NH2 NHBoc O

N

O

N 5

NH2

NH2 O O

N

N

O

O

N

O

O

N N 6

N O

7

8

Scheme 1. Chemical structure of probes 1-8.

Results and discussion Molecular design of probes. Probe 1 was synthesized and characterized according to the reported procedure.35 It should be noted that up to 10 mM of probe 1 could be dissolved in Phosphate buffer (PB) at room temperature, which was sufficiently high for further study. To study the relationship between the structure and detection properties, a series of

Figure 1. (a) Chemical structure, and (b) absorption and emission spectra of probe 1 at 40 µM in 20 mM PB at pH 7.2 (λex = 450 nm).

Specific rRNA response of probe 1 in vitro. Herein, Baker’s yeast RNA, primarily containing rRNA was used as a representative sample of rRNA. To determine the fluorescent change of probe 1’s response to rRNA, the fluorescent titration of probe 1 at a concentration of 10 µM with rRNA was investigated in 20 mM PB at pH 7.2. As shown in Figure 2a, the fluorescence intensity of 1 was enhanced up to 32-fold with the addition of 2300 g/mL rRNA. The relationship between the fluorescence intensity of 1 with the concentration of rRNA (0-1100 g/mL) was well fitted by the sigmoidal equation (Figure 2b) and showed a linear increase below 300 g/mL. The detection limit of probe 1 for rRNA was 0.61 g/mL, which enabled rRNA detection at relatively low concentrations.

ACS Paragon Plus Environment

Page 2 of 9

(a)

(b) 30

1.0

2300 g/ml

0.8

F/F0

0 g/ml

0.4

rRNA DNA tRNA ds RNA ds DNA ss RNA ss DNA

20

0.6

15 10 5

0.2 0.0

25

rRNA

0 500

550 600 Wavelength (nm)

650

0

250 500 750 1000 Concentration (g/ml)

Figure 2. (a) Fluorescent titration of probe 1 at 10 µM with the addition of rRNA. (b) The plot of fluorescent intensity enhancement at 532 nm versus different kind of RNA and DNA at different concentrations (λex = 450 nm). The biological environment of a cell is complicated. It is rich in proteins, nucleic acids, and other biological molecules. Such species can lead to nonspecific binding with probes. Thus, to simulate cell environments, we further determined the selectivity of probe 1 for other species in living organisms. Fluorescent changes to probe 1 were determined using typical biological molecules, such as amino acids, mononucleotide nucleoside triphosphates (NTPs) (ATP, GTP, CTP, UTP) and BSA in PB at pH 7.2 (Figure S10). The observed fluorescent intensities are shown in Figure 3 by plotting the enhancement multiples with different species. We can see that there was almost no fluorescent change after adding 20 equiv. of amino acids and mononucleotides. Compared to the 32-fold

fluorescence increase for rRNA, only a 2.5-fold fluorescence enhancement was observed in the presence of 20 equiv. of bovine serum albumin (BSA). Thus, interference in biological environments is negligible. It is known that rRNA is mainly located at the nucleolus. To further study the rRNA selectivity of 1 in the nucleolus, two nucleolar proteins, nucleolin (NCL) and nucleophosmin (NPM) were used for interference tests. As anticipated, the fluorescence intensity showed little change after adding 1 equiv. of NCL or NPM. The interference effect of mRNA and tRNA for the detection of rRNA was also determined according to the relative amounts of rRNA (82%), tRNA (15%) and mRNA (3%–5%) in living organisms.37 Compared to the 27-fold fluorescence enhancement observed after adding 1000 µg/mL of rRNA, probe 1 exhibited 3.1- and 3.2- fold increases in fluorescence after the addition of 100 µg/mL mRNA (Figure 3 and S11) and 750 µg/mL tRNA. Those results implied that probe 1 was resistant to the interference of DNA, other nucleic acids and other biological species, and selectively recognized rRNA in intracellular imaging.

30 25 20 15 10 5 0

probe 1 Ala Arg Asn Asp Cys Gln Glu Gly His Ile Leu Lys Met Phe Pro Ser Thr Trp Tyr Val AMP CMP GMP UMP NCL NPM BSA ctDNA dsDNA ssDNA dsRNA ssRNA tRNA mRNA rRNA

Accordingly, the absolute fluorescent quantum yield was enhanced from 0.22% to 3.78% (Table S1), corresponding to the results of the fluorescent titration studies. It should be noted that the maximum fluorescent emission wavelength showed a remarkable hypsochromic shift from 547 to 532 nm, and the maximum absorption wavelength exhibited a 10 nm bathochromic shift from 444 nm to 454 nm after the addition of RNA (Figure S2). This is a typical twisted ICT (TICT) characteristic of fluorescent dyes in hydrophobic microenvironments.10 Specifically, the dimethylamine donor of 1 twists the fluorophore scaffold by approximately 90° by photoexcitation, forming a non-emissive and highly reactive species. However, after binding with RNA, the dimethylamine groups were rigidified, the TICT was effectively suppressed, and consequently, fluorescence was visible.36 To verify the rRNA selectivity and fluorescent titration of other kinds of RNA, including tRNA, synthesized doublestranded RNA (dsRNA) (5’-3’: CCAGUUCGUAGUAACCC), single-stranded RNA (ssRNA) (5’-3’: UUGUACUACACAAAAGUACUG), and DNA including calf thymus DNA (ctDNA), synthesized double-stranded DNA (dsDNA) (5’-3’: CCAGTTCGTAGTAACCC), and singlestranded DNA (ssDNA) (5’-3’: ATGTACCGATCA), bindings with probe 1 were performed in parallel. Surprisingly, probe 1 showed only a 5-fold fluorescence increase after the addition of ctDNA (Figure S3). Correspondingly, the quantum yield of 1 was enhanced to 0.66% from 0.22% after titration with ctDNA (Table S1). Similarly, less than a 5-fold fluorescent increase was obtained for probe 1 with the addition of other nucleic acids, including tRNA, dsRNA, ssRNA, dsDNA and ssDNA (Figure 2b and S4-S8), compared to a 32-fold increase with rRNA. These results revealed that probe 1 displayed significant selectivity for rRNA versus other nucleic acids. The selectivity of probe 1 toward rRNA is thus superior to the commercial SYTO probe (Figure S9) and reported rRNA fluorophores (less than 3-fold), 21 implying the potential applications of 1 to rRNA imaging. FL Intensity (a. u.)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

F/F0

Page 3 of 9

Figure 3. Selectivity of probe 1 (10 µM) versus to different species including 20 kinds of amino acids (200 µM), 4 kinds of mononucleotide acid (200 µM), two nucleolus proteins nucleolin (NCL) (10 µM) and nucleophosmin (NPM) (10 µM), BSA (200 µM), ctDNA (1200 µg/mL), synthesized dsDNA (630 µg/mL), synthesized ssDNA (370 µg/mL), synthesized dsRNA (370 µg/mL), synthesized ssRNA (206 µg/mL), tRNA (750 µg/mL), mRNA (100 µg/mL) and rRNA (1000 µg/mL) in 20 mM PB at pH 7.2.

To compare the rRNA detecting properties of probe 1 to 7 other analogues, we tested changes in the fluorescence of probes 2-8 with rRNA and DNA in PB. Figure S12 shows that non-amine terminal probes such as probes 2 and 3 had lower fluorescence enhancements for rRNA than DNA. Probes 4 and 5, which experienced steric hindrance from the amine group exhibited lower rRNA/DNA selectivity (less than 2 multiples for probe 4 and 4 multiples for probe 5) than that of probe 1. Probes 7 and 8 with higher steric hindrance at the 4 position of naphthalimide also showed decreased selectivity for rRNA to DNA (4.1 and 1.4 multiples for probes 7 and 8, respectively). Probe 6, which contained an extended aliphatic chain exhibited 5.5 multiples between rRNA and DNA, which was still lower than that of probe 1. From these results, we concluded that probe 1, containing the alkyl amine group, with the suitable chain length, displayed the most outstanding properties in distinguishing rRNA from DNA in PB. Therefore, probe 1 was selected for further in vitro and ex vivo studies.

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Mechanism of rRNA binding. It remains a challenge to study the mechanism of detection between a small molecule and a complicated biomolecule such as rRNA. The absorption and fluorescent change of probe 1 in response to rRNA clearly indicated a TICT mechanism of rRNA binding. Meanwhile, fluorescence enhancements with the increase of viscosity also verified the TICT process (Figure S13). However, the situation may be complicated. To determine whether it is the existence of a photo-induced electron transfer (PET) process from the alkyl amine group to the naphthalimide ring of 1, we detected the fluorescence change of probe 1 with the decrease of pH because the protonation of the alkyl amine group would restrain the PET process and enhance fluorescence. From Figure S14, we see that the fluorescence intensity of 1 showed less than 20% change with pH 2-8; thus, demonstrating that the fluorescent enhancement of probe 1 with RNA was not from the PET process. Circular dichroism (CD) spectroscopy was used to determine the binding type of probe 1 with RNA or DNA. As shown in Figure S15, there was no induced CD (ICD) obtained from probe 1 with the addition of rRNA, indicating that probe 1 was binding rRNA by non-groove binding modes since the ICD signal can indicate the groove binding of a ligand with nucleic acids. 38 To further confirm the binding mechanism between 1 and rRNA, a molecular docking simulation calculation was performed. Herein, the L1-stalk (PDB: 5ML7), a dynamic domain of the 23S rRNA, was selected as an rRNA model to simplify the binding process with probe 1. Meanwhile, the binding properties of 1 with synthesized dsRNA and dsDNA of the same sequence were also studied as a control. From Figures 4a and S16, we can see that the naphthalimide ring inserted into the hydrophobic core of the L1 stalk that was intertwined by the RNA helix. The steric hindrance of the hydrophobic core of the L1 stalk suppressed the rotation of the dimethyl amine group of 1, leading to the enhancement of fluorescence. In comparison, dsRNA and dsDNA with the traditional double helix structure, could not inhibit the rotation of the dimethyl amine group due to the absence of the hydrophobic core. Meanwhile, three hydrogen bonds formed by two amide oxygen atoms as proton acceptors and one amine hydrogen atom as a proton donor of 1 with the L1 stalk was observed (Figure 4b), compared to two hydrogen bonds between probe 1 and dsDNA (Figure 4c) or dsRNA (Figure 4d and S17). Consistently, the binding energy of probe 1 with the L1 stalk was 35.99 kJ/mol, which was much higher than that with dsRNA (27.50 kJ/mol) and dsDNA (28.76 kJ/mol). Furthermore, 1H NMR titration was performed in D2O. As shown in Figure S18, all the protons of naphthalimide exhibited downfield shifts after the addition of rRNA. The protons of Ha and Hb close to amide oxygen atom showed larger chemical shifts (0.09 ppm) than Hc (0.05 ppm) and Hd (0.06 ppm). This corresponded to the formation of hydrogen bonds between the amide oxygen of 1 with rRNA. The results from molecular docking and 1H NMR titration studies indicated that the higher fluorescence enhancement of probe 1 with rRNA was mainly due to the specific binding of probe 1 with the sophisticated 3D structure of rRNA.

(a)

(c)

Page 4 of 9

L1 stalk

ds DNA

(b)

(d)

L1 stalk

ds RNA

Figure 4. Molecular docking of probe 1 with L1-stalk by (a) hydrophobic core and (b) hydrogen bonds; molecular docking of probe 1 with (c) ds DNA and (d) ds RNA.

Fluorescent imaging of probe 1 in live cells. Encouraged by the fluorescent turn-on response and superior selectivity of probe 1 towards rRNA in PB buffer, we examined its capability to image rRNA in live cells. First, the optimized concentration of probe 1 for fluorescent imaging was detected in live HeLa cells. At the same time, colocalization analyses were conducted with the Hoechst 33342 nuclear dye to confirm the distribution of 1 in HeLa cells. Probe 1 concentrations of 20, 10, 5, and 2.5 µM were incubated with HeLa cells and 1 µM Hoechst 33342 was co-incubated for 10 minutes for confocal imaging. As seen in Figure 5, HeLa cells incubated with probe 1 at a concentration of 20, 10, 5 µM displayed bright green fluorescence in the nucleolus and spotted signal at the cytoplasm. HeLa cells stained with Hoechst 33342 exhibited clear blue fluorescence in the complete nuclear zone. Nucleoli were also clearly seen at the concentration of 2.5 µM. Generally, lower concentrations are superior for staining organelles. Therefore, we selected a concentration of 5 µM for further study. These results also showed that probe 1 had good counterstaining compatibility with the commercial nuclear Hoechst 33342 dye. To further study the distribution of probe 1 in the cytoplasm, we colocalized the fluorescence of probe 1 with commercial Golgi, endoplasmic reticulum (ER), and mitochondrial trackers. From Figure S19, we can see that the colocalization efficiency of probe 1 with the ER tracker (0.59) in the cytoplasm was higher than that of the Golgi (0.34) and mitochondrial trackers (0.20). Those results were consistent with the distribution tendency of ribosomes in the cytoplasm and indicated that probe 1 could selectively image rRNA in both the nucleolus and cytoplasm. To confirm the generality of probe 1 for the intracellular imaging of rRNA, we selected two other cancer cell lines, including HepG-2, MDA-MB-231 and one normal cell line, RAW 264.7 for live cell imaging. Similar with the findings in HeLa cells, Figure S20 showed that all three cell lines displayed nucleolar staining with fluorescence detected in the cytoplasm. Thus, 1 is a general probe for the nucleolus.

ACS Paragon Plus Environment

Page 5 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors Probe 1

Hochest

Merged

up-take were observed at 4°C, compared to that at 37°C. These results indicated that probe 1 penetrated cellular membrane mainly by diffusion.

20 µM

10 µM

0s

30 s

90 s

120 s

60 s

5 µM

Figure 6. Time-dependence (0 s, 30 s, 60 s, 90 s, 120 s) CLSM images of HeLa cells incubated with probe 1 at 5 µM (λex = 488 nm, λem = 515-565 nm). bottom right: fluorescence intensity profile of selected area labelled with white bar. Scale bar: 10 µm.

2.5 µM

Figure 5. CLSM images of HeLa cells incubated with probe 1 at 20, 10, 5 and 2.5 µM for 5 minutes and Hochest 33342 (1 µM) for 10 minutes. Green channel for probe 1 (λex = 488 nm, λem = 515 565 nm) and blue channel for Hochest 33342 (λex = 405 nm, λem = 440 - 490 nm). Scale bar: 20 µm.

To assess the cellular and nuclear membrane permeability of probe 1, we traced fluorescent images in HeLa cells at different time intervals. Surprisingly, clear green fluorescence was observed in the nucleolus of HeLa cells within 30 seconds and was saturated within 1 minute (Figure 6). The speed of fluorescence was much faster than that of commercial SYTO RNA select. From Figure S21, we can see that most of the green fluorescence of SYTO RNA select was located in the cytoplasm with very faint fluorescence detected at the nucleolus after 20 hours of incubation. To the best of our knowledge, almost all reported RNA probes, including fluorescent rRNA probes must be incubated with cells for at least 15 minutes for live cell imaging. Thus, these data verified that probe 1 possessed excellent membrane permeability for live cells, compared to most reported and commercial RNA probes. This ensured that probe 1 could be used for rapid imaging of rRNA in live cells, which is necessary to study the physiological processes of rRNA. In addition to the excellent membrane permeability, it should be noted that the clear confocal laser scanning microscopic CLSM image could be obtained with a low background signal without washing, which is a great advantage to simplifying the cell treatment. The uptake mechanism of probe 1. The excellent permeability of probe 1 encouraged us to explore its penetrating mechanisms. The permeability of probe 1 was compared in the presence and absence of foetal bovine serum (FBS) at 37°C (Figure S22). Similar fluorescent intensities were observed in HeLa cells, indicating that the up-take of probe 1 was not affected by FBS. Concurrently, fluorescent images were taken following incubation at 4°C—a condition for inhibiting endocytosis. As shown in Figure S22, only minor reductions in

To further demonstrate the transmembrane mechanism of probe 1, the cellular membrane and nuclear pore permeabilities of probes 2-8 were also detected (Figure S23). No fluorescence was obtained in HeLa cells incubated with probe 2, even after one hour of incubation. The poor cellular permeability of probe 2 was mainly due to the negative charges from the carboxylic acid group. When amine groups were replaced by COOCH3 or NH-Boc, respectively, probes 3 and 5 showed spotted fluorescence at the cytoplasm and no signal at the nucleolus after one hour of incubation. Thus, the hydrophobic Boc group destroyed the amphiphilic balance of 5 and lowered its permeability through nuclear pores, despite its reasonable performance and selectivity for rRNA in aqueous buffer. Clear fluorescence in the cytoplasm and limited fluorescence in the nucleolus were discovered after 5 minutes of incubation with probes 4 and 6. Probe 7 shared similar permeabilities with probe 1. However, probe 8 stained the complete nucleus, which corresponded with its low selectivity for rRNA to DNA in vitro. To further clarify the relationship between the structures of the probes and permeability, we determined the oil-water partition coefficient (logP) of all eight probes (Table S2). The result showed that probes 1, 7 and 8 with smaller logP had better nuclear pore permeability than the other probes. Those data suggest that the excellent cellular membrane permeability of probe 1 was a result of an appropriate lipophilic balance by the hydrophilic amine group and hydrophobic naphthalimide. It has been reported that soluble small molecules are preferred to diffuse across the nuclear pore.39 The superior nuclear pore permeability of probe 1 may be due to its increased solubility due to the hydrophilic amine group and shorter alkyl chains, compared to other probes. Selectivity of probe 1 in intracellular imaging. In most mammalian cells, the nucleolus is composed of three components: the fibrillar centres (FCs), the dense fibrillar component (DFC), and the granular component (GC). The FCs remain in the central areas of the nucleolus, which are surrounded by the DFC and GC.40 rRNA are also mainly located

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

at the DFC and GC. To determine the location selectivity of probe 1 in the nucleolus, we detailed the location of 1 with enlarged nucleolar images of fixed HeLa cells. Figure 7a showed that the outer areas of the nucleolus, where the rRNA is primarily located, were bright, whereas the fluorescence of the central areas was faint. This further confirmed the selective binding of probe 1 to rRNA in the nucleolus. RNA digestion experiments using ribonuclease (RNase) were carried out to test the selectivity of 1 in cells. In the RNase digestion test, only RNA was hydrolysed. Additionally, the deoxyribonuclease (DNase) digestion test was conducted as a control in which only DNA was hydrolysed. Figure 7b displayed that the fluorescence of both the nucleolus and cytoplasm were almost completely diminished after 4 hours of RNase digestion. However, the fluorescence of fixed HeLa cells remained following DNase treatment. The fluorescence intensity was quantified and revealed that only 29.5% fluorescence remained after RNase digestion, compared to 80% after DNase digestion. SYTO RNA select showed similar results to digestion, with 95% of fluorescence remaining after DNase treatment and 34% remaining after RNase digestion (Figure 7c and Figure S24). The similar digestion results verified that probe 1 and SYTO RNA select shared similar RNA imaging tendencies in fixed cells. (a)

Photostability is a critical property of a fluorescent dye, especially with long durations of imaging. However, most organic fluorophores suffer from low photostability due to irreversible photobleaching. Here, we compared the photostability of probe 1 and SYTO RNA select following irradiation with Xe light. As shown in Figure S26, the fluorescence of SYTO RNA Select was 34% after 150 minutes irradiation. However, probe 1 showed almost no change in fluorescence after irradiation. Therefore, the photostability of probe 1 was much better than that of SYTO RNA select.

Conclusions In conclusion, we developed a fluorescent rRNA probe based on a naphthalimide scaffold. The probe exhibited superior selectivity toward rRNA than other nucleic acids and biomolecules. Moreover, this probe possessed fast rRNA staining in live cells, and can penetrate cellular membrane and nuclear pores within 1 minutes to provide bright green fluorescence at nucleolus. To the best of our knowledge, this is the fastest acting permeabilizing rRNA probe. Due to the advantages of probe 1, including its water solubility, excellent selectivity, significant photostability, biocompatibility, and fantastic cellular permeabilities, we anticipate this probe may provide an alternative tool to commercial rRNA stains.

ASSOCIATED CONTENT Supporting Information

(a) (b) 1

Probe 1

1 + DNase

1 + DNase

1 + RNase

1 + RNase

The Supporting Information is available free of charge on the ACS Publications website. The synthesis and characteristic of the probes, general method and equipment, additional tables and figures (file type, PDF)

AUTHOR INFORMATION Corresponding Author *[email protected]

(c)

SYTO

SYTO + DNase

SYTO + RNase

Notes There are no conflicts to declare.

ACKNOWLEDGMENT The authors thank for the financial support of National Key R&D Program of China (2017YFA0205100) and National Natural Science Foundation of China (21671043, 21877013). We also acknowledge Hongxin Zhao for 1H NMR test from High Magnetic Field Laboratory, Chinese Academy of Science.

(b) Figure 7. (a) CLSM images of enlarged nucleolus in HeLa cells pretreated with cold methanol for 5 minutes and then incubated with probe 1 (5 µM) for 5 minutes, from left to right: dark field, bright field and overlay image, scale bar: 2 µm. (b) Deoxyribonuclease (DNase) and ribonuclease (RNase) digestion experiment of probe 1 (5 µM). Green channel: λex = 488 nm, λem = 515-565 nm. Scale bar: 10 µm. (c) Columned analysis of fluorescent intensities of 1, 1 + DNase, 1 + RNase and SYTO, SYTO + DNase, SYTO + RNase.

MTT and Photostability. The cytotoxicity of probes 1-8 was evaluated by the MTT assay in HeLa cells. All probes except 6 (up to 30 µM) exhibited more than 90% cell viability after 6 hours of incubation with HeLa cells; thus, revealing their strong biocompatibilities (Figure S25).

REFERENCES (1) Choi, Y. S.; Patena, W.; Leavitt, A. D.; McManus, M. T. Widespread RNA 3'-end oligouridylation in mammals. RNA, 2012, 18, 394-401. (2) Morris, K. V. Role of RNA in the regulation of gene expression. Nutr. Rev., 2008, 66, 31-32. (3) Fica, S. M.; Tuttle, N.; Novak, T.; Li, N. S.; Lu, J.; Koodathingal, P.; Dai, Q.; Staley, J. P.; Piccirilli, J. A. RNA catalyses nuclear pre-mRNA splicing. Nature, 2013, 503, 229234. (4) Petrov, A. S.; Bernier, C. R.; Hershkovits, E.; Xue, Y. Z.; Waterbury, C. C.; Hsiao, C. L.; Stepanov, V. G.; Gaucher, E. A.; Grover, M. A.; Harvey, S. C.; Hud, N. V.; Wartell, R. M.;

ACS Paragon Plus Environment

Page 6 of 9

Page 7 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors Fox, G. E.; Williams, L. D. Secondary structure and domain architecture of the 23S and 5S rRNAs. Nucleic Acids Res., 2013, 41, 7522-7535. (5) Greuter, D.; Loy, A.; Horn, M.; Rattei, T. probeBase--an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016. Nucleic Acids Res., 2016, 44, D586-D589. (6) Xia, Y. Q.; Zhang, R. L.; Wang, Z. L.; Tian, J.; Chen, X. Y. Recent advances in high-performance fluorescent and bioluminescent RNA imaging probes. Chem. Soc. Rev., 2017, 46, 2824-2843. (7) Valencia-Burton, M.; McCullough, R. M.; Cantor, C. R.; Broude, N. E. RNA visualization in live bacterial cells using fluorescent protein complementation. Nat. Methods, 2007, 4, 421-427. (8) Ozawa, T.; Natori, Y.; Sato, M.; Umezawa, Y. Imaging dynamics of endogenous mitochondrial RNA in single living cells. Nat. Methods, 2007, 4, 413-419. (9) Liu, Y.; Zhang, W. J.; Sun, Y. M.; Song, G. F.; Miao, F.; Guo, F. Q.; Tian, M. G.; Yu, X. Q.; Sun, J. Z. Two-photon fluorescence imaging of RNA in nucleoli and cytoplasm in living cells based on low molecular weight probes. Dyes Pigments, 2014, 103, 191-201. (10) Wang, H.; Wu, H.; Xue, L.; Shi, Y.; Li, X. A naphthalimide fluorophore with efficient intramolecular PET and ICT processes: application in molecular logic. Org. Biomol. Chem., 2011, 9, 5436-5344. (11) Wang, K. R.; Qian, F.; Rong, R. X.; Cao, Z. R.; Wang, X. M.; Li, X. L., Fluorescence enhancement, cellular imaging and biological investigation of chiral pyrrolidinol modified naphthalimide derivatives. RSC Adv., 2014, 4, 47605-47608. (12) Yao, Q.; Li, H.; Xian, L.; Xu, F.; Xia, J.; Fan, J.; Du, J.; Wang, J.; Peng, X. Differentiating RNA from DNA by a molecular fluorescent probe based on the "door-bolt" mechanism biomaterials. Biomaterials, 2018, 177, 78-87. (13) Lu, Y. J.; Deng, Q.; Hu, D. P.; Wang, Z. Y.; Huang, B. H.; Du, Z. Y.; Fang, Y. X.; Wong, W. L.; Zhang, K.; Chow, C. F. A molecular fluorescent dye for specific staining and imaging of RNA in live cells: a novel ligand integration from classical thiazole orange and styryl compounds. Chem. Commun., 2015, 51, 15241-15244. (14) Li, D. D.; Tian, X. H.; Wang, A. D.; Guan, L. J.; Zheng, J.; Li, F.; Li, S. L.; Zhou, H. P.; Wu, J. Y.; Tian, Y. P. Nucleic acid-selective light-up fluorescent biosensors for ratiometric two-photon imaging of the viscosity of live cells and tissues. Chem. Sci., 2016, 7, 2257-2263. (15) Guo, L.; Chan, M. S.; Xu, D.; Tam, D. Y.; Bolze, F.; Lo, P. K.; Wong, M. S. Indole-based cyanine as a nuclear RNAselective two-photon fluorescent probe for live cell imaging. ACS Chem. Biol., 2015, 10, 1171-1175. (16) Song, G. F.; Miao, F.; Sun, Y. M.; Yu, X. Q.; Sun, J. Z.; Wong, W. Y. Fluorescence turn-on probes for intracellular RNA distribution and their imaging in confocal and two-photon fluorescence microscopy. Sensor Actuat B-Chem., 2012, 173, 329-337. (17) Li, Z.; Sun, S.; Yang, Z.; Zhang, S.; Zhang, H.; Hu, M.; Cao, J.; Wang, J.; Liu, F.; Song, F.; Fan, J.; Peng, X. The use of a near-infrared RNA fluorescent probe with a large Stokes shift for imaging living cells assisted by the macrocyclic molecule CB7. Biomaterials, 2013, 34, 6473-6481. (18) Song, G.; Sun, Y.; Liu, Y.; Wang, X.; Chen, M.; Miao, F.; Zhang, W.; Yu, X.; Jin, J. Low molecular weight fluorescent probes with good photostability for imaging RNA-rich

nucleolus and RNA in cytoplasm in living cells. Biomaterials, 2014, 35, 2103-2112. (19) Zhou, B. J.; Liu, W. M.; Zhang, H. Y.; Wu, J. S.; Liu, S.; Xu, H. T.; Wang, P. F. Imaging of nucleolar RNA in living cells using a highly photostable deep-red fluorescent probe. Biosens. Bioelectron., 2015, 68, 189-196. (20) Liu, J.; Zhang, S. L.; Zhang, C. H.; Dong, J.; Shen, C. Y.; Zhu, J.; Xu, H. J.; Fu, M. K.; Yang, G. Q.; Zhang, X. M. A water-soluble two-photon ratiometric triarylboron probe with nucleolar targeting by preferential RNA binding. Chem. Commun., 2017, 53, 11476-11479. (21) Du, W.; Wang, H.; Zhu, Y.; Tian, X.; Zhang, M.; Zhang, Q.; De Souza, S. C.; Wang, A.; Zhou, H.; Zhang, Z.; Wu, J.; Tian, Y. Highly Hydrophilic, Two-photon Fluorescent Terpyridine Derivatives Containing Quaternary Ammonium for Specific Recognizing Ribosome RNA in Living Cells. ACS Appl. Mat. Inter., 2017, 9, 31424-31432. (22) Lozano-Torres, B.; Galiana, I.; Rovira, M.; Garrido, E.; Chaib, S.; Bernardos, A.; Munoz-Espin, D.; Serrano, M.; Martinez-Manez, R.; Sancenon, F. An OFF-ON Two-Photon Fluorescent Probe for Tracking Cell Senescence in Vivo. J. Am. Chem. Soc., 2017, 139, 8808-8811. (23) Sidhu, J. S.; Singh, A.; Garg, N.; Singh, N. Carbon Dot Based, Naphthalimide Coupled FRET Pair for Highly Selective Ratiometric Detection of Thioredoxin Reductase and Cancer Screening. ACS Appl. Mat. Inter., 2017, 9, 25847-25856. (24) Li, Y.; Qiu, Y.; Zhang, J.; Zhu, X.; Zhu, B.; Liu, X.; Zhang, X.; Zhang, H. Naphthalimide derived fluorescent probes with turn-on response for Au(3+) and the application for biological visualization. Biosens. Bioelectron., 2016, 83, 334338. (25) Banerjee, S.; Kitchen, J. A.; Bright, S. A.; O'Brien, J. E.; Williams, D. C.; Kelly, J. M.; Gunnlaugsson, T. Synthesis, spectroscopic and biological studies of a fluorescent Pt(II) (terpy) based 1,8-naphthalimide conjugate as a DNA targeting agent. Chem. Commun., 2013, 49, 8522-8524. (26) Banerjee, S.; Kitchen, J. A.; Gunnlaugsson, T.; Kelly, J. M. The effect of the 4-amino functionality on the photophysical and DNA binding properties of alkyl-pyridinium derived 1,8naphthalimides. Org. Biomol. Chem., 2013, 11, 5642-5655. (27) Banerjee, S.; Veale, E. B.; Phelan, C. M.; Murphy, S. A.; Tocci, G. M.; Gillespie, L. J.; Frimannsson, D. O.; Kelly, J. M.; Gunnlaugsson, T. Recent advances in the development of 1,8naphthalimide based DNA targeting binders, anticancer and fluorescent cellular imaging agents. Chem. Soc. Rev., 2013, 42, 1601-1618. (28) Yu, X.; Chen, L.; Zhang, M.; Yi, T. Low-molecular-mass gels responding to ultrasound and mechanical stress: towards self-healing materials. Chem. Soc. Rev., 2014, 43, 5346-5371. (29) Zhou, Z.; Yu, M.; Yang, H.; Huang, K.; Li, F.; Yi, T.; Huang, C. FRET-based sensor for imaging chromium(III) in living cells. Chem. Commun., 2008, 3387-3389. (30) Wen, Y.; Liu, K.; Yang, H.; Li, Y.; Lan, H.; Liu, Y.; Zhang, X.; Yi, T. A highly sensitive ratiometric fluorescent probe for the detection of cytoplasmic and nuclear hydrogen peroxide. Anal. Chem., 2014, 86, 9970-9976. (31) Wen, Y.; Xue, F.; Lan, H.; Li, Z.; Xiao, S.; Yi, T. Multicolor imaging of hydrogen peroxide level in living and apoptotic cells by a single fluorescent probe. Biosens. Bioelectron., 2017, 91, 115-121. (32) Mao, Y.; Liu, K.; Chen, L.; Cao, X.; Yi, T. A Programmed DNA Marker Based on Bis(4-ethynyl-1,8-naphthalimide) and

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Three-Methane-Bridged Thiazole Orange. Chem. Eur. J., 2015, 21, 16623-16630. (33) Meanwell, N. A. Improving Drug Candidates by Design: A Focus on Physicochemical Properties as a Means of Improving Compound Disposition and Safety. Chem. Res. Toxicol., 2011, 24, 1420-1456. (34) Yang, Z. H.; Ge, G. B.; Liu, F. Y.; Chen, S. S.; Sun, S. G. Study of a series of fluorophore-labeled artesunate derivatives Design, analysis and application. Dyes Pigments, 2017, 146, 414-419. (35) Tolpygin, I. E., Shepelenoko, E.N., Revinskii, Yu. V., Dubonosov, A.D., Bren, V.A., Minkin, V.I. New chemosensor systems of the Benzo-[de]Isoquinoline-1,3-dione series. Chem. Heterocl. Compd., 2012, 48, 1325-1331. (36) Liu, X.; Qiao, Q.; Tian, W.; Liu, W.; Chen, J.; Lang, M. J.; Xu, Z. Aziridinyl Fluorophores Demonstrate Bright Fluorescence and Superior Photostability by Effectively Inhibiting Twisted Intramolecular Charge Transfer. J. Am. Chem. Soc., 2016, 138, 6960-6963. (37) Johnson, L. F.; Abelson, H. T.; Penman, S.; Green, H. The relative amounts of the cytoplasmic RNA species in normal, transformed and senescent cultured cell lines. J. Cellular Phys., 1977, 90, 465-470. (38) Armitage, B. A. Cyanine Dye-DNA interactions: Intercalation, Groove binding, and Aggregation. Top. Curr. Chem., 2005, 253, 55-76. (39) Timney, B. L.; Raveh, B.; Mironska, R.; Trivedi, J. M.; Kim, S. J.; Russel, D.; Wente, S. R.; Sali, A.; Rout, M. P. Simple rules for passive diffusion through the nuclear pore complex. J. Cell Biol., 2016, 215, 57-76.8 (40) Sirri, V.; Urcuqui-Inchima, S.; Roussel, P.; HernandezVerdun, D. Nucleolus: the fascinating nuclear body. Histochem. Cell Biol., 2008, 129, 13-31.

ACS Paragon Plus Environment

Page 8 of 9

Page 9 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

for TOC only

ACS Paragon Plus Environment