Role of Locked Nucleic Acid Modified Complementary Strand in

We have investigated the sensitivity of this equilibrium to pharmacological agents by employing locked nucleic acid (LNA) modified complementary stran...
0 downloads 0 Views 117KB Size
Download PDF
12328

J. Phys. Chem. B 2007, 111, 12328-12337

Role of Locked Nucleic Acid Modified Complementary Strand in Quadruplex/ Watson-Crick Duplex Equilibrium Niti Kumar and Souvik Maiti* Proteomics and Structural Biology Unit, Institute of Genomics and IntegratiVe Biology, CSIR, Mall Road, New Delhi 110 007, India ReceiVed: April 5, 2007; In Final Form: July 31, 2007

In the human genome, the G-rich sequences that form quadruplexes are present along with their C-rich complementary strands; this suggests the existence of equilibrium between a quadruplex and a WatsonCrick duplex which allows the execution of their respective biological functions. We have investigated the sensitivity of this equilibrium to pharmacological agents by employing locked nucleic acid (LNA) modified complementary strands, and demonstrated successful invasion of the stable telomeric quadruplex d[(G3TTA)3G3]. Fluorescence, UV, ITC, and SPR studies were performed to understand the binding process involving the preformed quadruplex and LNA-modified complementary strands compared with that involving the unmodified complementary strand. Our data indicate that LNA modifications in the complementary strand shift the equilibrium toward the duplex state. These modifications confer increased thermodynamic stability to the duplex and increase the magnitude of relative free energy (∆∆G°) difference between duplex and quadruplex, thus favoring the predominance of duplex population over quadruplex. This superior ability of LNA-modified complementary strand can be exploited to pave an exploratory approach in which it hybridizes to a telomeric quadruplex and drives duplex formation, and inhibits the recognition of 3′ G-rich overhang by RNA template of telomerase which guides telomere extension.

Introduction The termini of eukaryotic chromosomes are composed of specialized DNA nucleoprotein complexes termed telomeres. In mammals, telomeric DNA consists of a tandem array of the six-nucleotide (nt) repeat 5′ TTAGGG 3′/3′ CCCTAA 5′, approximately 4-14 kilobases (kb) long in humans, terminating in a 150-200 nt 3′ single strand DNA overhang of the G-rich strand.1-3 Both telomeric DNA and telomere-associated proteins have an essential role in stabilizing chromosome ends by forming a cap structure that protects chromosome ends from exonucleolytic degradation and terminal fusions.4 Telomeres can structurally organize into different conformations: for instance, the G-rich single-stranded DNA can adopt an unusual fourstranded DNA structure involving G-quartets,5,6 or it might fold back to form a T-loop or displace one strand of a telomeric duplex to form a D-loop.7 Proteins associated with telomeric DNA can bind specifically to ds-DNA, single strand overhang, or interact via other telomeric proteins to maintain the telomeric length, integrity, and function.4 Telomerase, a ribonucleoprotein, hybridizes to G-rich overhang via its 11 base RNA template and guides the addition of six base telomeric repeats for the extension of telomeric ends to control the growth and survival of tumor cells.8 As these G-rich overhangs have the potential to form G-quadruplexes, stabilization of these structures by quadruplex selective ligands has been shown to directly inhibit telomere elongation by telomerase in vitro.9-11 Another strategy adopted to inhibit telomerase includes use of short modified oligonucleotides exhibiting enhanced affinity to target RNA template of telomerase, where the length and position of modification would govern the specificity and efficiency of * Corresponding author. Phone: +91-11-27666156. Fax: +91-1127667471. E-mail: [email protected].

inhibition.12,13 An alternative approach can be adopted to target the G-rich overhang which may form a quadruplex under cellular conditions by modified complementary oligonucleotide to form a stable duplex, thus making the G-overhang inaccessible for hybridization to telomerase RNA template for extension of telomeric ends. Apart from telomeres, guanine-rich sequences are found in other important DNA regions such as centromeres, immunoglobulin switch regions, mutational hot spots, and promoter elements in the human genome.14-17 However, the role of quadruplexes outside telomeric regions is still unclear, although the quadruplex motif is prevalent in the human genome with an average incidence of ∼1 quadruplex every 10 000 bases, suggesting the existence of potential quadruplexes in the functionally important regulatory regions of genes.18,19 However, in the genomic context, guanine stretches are present along with their C-rich complementary strand, which generates a competing environment between Hoogsteen bonded quadruplex structure and Watson-Crick hydrogen bonded duplex structure. The structural transition among these secondary structures may modulate their molecular recognition by proteins, and thus affect gene function. This structural transition can be modulated by pH, temperature, salt concentration, and complementary strand concentration.20-30 We have recently shown the influence of natural (molecular crowding) and pharmacological (cationic porphyrin) agents on this equilibrium, as these perturbants stabilize the quadruplex and shift the equilibrium toward quadruplex formation.28 With increasing evidence for the biological relevance of quadruplexes, it is an attractive goal to engineer the unfolding of these stable structures. Efforts are now being invested in developing synthetic nucleic acids that can hybridize to G-rich sequence through Watson-Crick base pairing. Recently, inva-

10.1021/jp072705u CCC: $37.00 © 2007 American Chemical Society Published on Web 10/03/2007

Quadruplex-WC Duplex Equilibrium sion of DNA and RNA quadruplex was demonstrated through complementary and homologous PNA probes.31 However, the influence of these modified probes on the quadruplex/WatsonCrick duplex equilibrium remains undiscussed. Among other nucleic acid analogues, locked nucleic acid (LNA), a conformationally locked monomer of 2′-O-4′-C-methylene-D-ribofuranosyl, displays very high affinity for Watson-Crick base pairing with DNA or RNA. LNA scores over other nucleic acid analogues as it provides thermostability to duplexes and triplexes and exhibits increased biological stability without being associated with toxic effects. This makes LNA oligonucleotides promising agents for artificial control of gene expression in vivo.32-35 We have employed LNA-modified pyrimidine-rich complementary strand to invade stable telomeric quadruplex and perturb the quadruplex/Watson-Crick duplex equilibrium. Modifications were incorporated in the pyrimidine-rich strand at positions complementary to the adenine base located in the TTA loop of telomeric quadruplex. We used fluorescence resonance energy transfer (FRET) spectroscopy, UV spectroscopy, isothermal titration calorimetry (ITC), and surface plasmon resonance (SPR) to extract the thermodynamic and kinetic parameters involved in quadruplex hybridization to complementary strand that modulates the predominance of particular population at equilibrium. Materials and Methods Oligonucleotides and Nomenclature. Unlabeled and dual labeled (5′ fluorescein and 3′ TAMRA) G-rich oligonucleotide d(GGGTTAGGGTTAGGGTTAGGG) and the complementary strand d(CCCTAACCCTAACCCTAACCC) were procured from Sigma Genosys. Locked nucleic acid (LNA) modified complementary strands having modifications at different positions were obtained from Proligo. The following nomenclature was used for complementary strands: DNA, d(CCCTAACCCTAACCCTAACCC); LNA 1, d(CCCTAACCCTAACCCTAACCC); LNA 2, d(CCCTAACCCTAACCCTAACCC); and LNA 3 d(CCCTAACCCTAACCCTAACCC), where boldface underline indicates the LNA-modified base. The concentration of unlabeled oligonucleotide was calculated by extrapolation of tabulated values of the dimers and monomer bases at 25 °C39 using procedures reported earlier.40 The concentration of the labeled oligonucleotide was determined by measuring the absorbance of the attached fluorescein moiety at 496 nm using a molar extinction coefficient of 4.1 × 104 M-1 cm-1.41 All experiments were done in 50 mM MES buffer, pH 7, 100 mM KCl. Circular dichroism (CD) spectra were recorded on a Jasco spectropolarimeter (Model 715, Japan) equipped with a thermoelectrically controlled cell holder and a cuvette with a path length of 1 cm. CD spectra for quadruplexes (5 µM) in the absence and presence of equimolar unmodified complementary strand concentration, 5 and 10 times excess of unmodified (DNA) complementary strand, were recorded between 220 and 325 nm at 20 °C in 50 mM MES buffer, pH 7, 100 mM KCl. The CD spectra were also recorded for equimolar mixtures of preformed quadruplex (5 µM) and modified complementary strands (LNA 1-LNA 3) at 20 °C in 50 mM MES buffer, pH 7, 100 mM KCl. UV Experiments. The UV annealing experiment for quadruplex and duplex was performed on a Cary 100 (Varian) spectrophotometer with a cooling rate of 0.3 °C/min. Quadruplex (1 µM) annealing was monitored at 295 nm in 50 mM MES, 100 mM KCl, pH 7. For the duplex annealing experiment, 1 µM G-rich strand and 10 µM C-rich strand for unmodified and modified complementary strands was used in 50 mM MES, 100 mM KCl, pH 7, and was monitored at 260 nm.

J. Phys. Chem. B, Vol. 111, No. 42, 2007 12329 Steady-State Experiments. Fluorescence experiments were done using a Fluoromax 4 (Spex) spectrofluorimeter and FLUOstar OPTIMA from BMG Labtech (Germany). In the Fluoromax 4 (Spex) spectrofluorimeter, the excitation wavelength was set at 480 nm and the emission spectra were recorded from 500 to 700 nm. The cooling and heating profile of the quadruplex (30 nM) in the absence and presence of an equimolar concentration of the respective complementary strand was constructed with a cooling rate of 0.2 °C/min. Normalized donor (fluorescein) emission (I520 nm ) Ft/F97) at 520 nm was plotted as a function of temperature, where Ft is the fluorescence at any temperature and F97 is the fluorescence at 97 °C. A FLUOstar OPTIMA fluorescence plate reader was used to determine the binding affinity of G-quadruplex to its complementary strand. The plate reader provides the advantage of working on systems that suffer from thermodynamic and kinetic inertia, requiring prolonged incubation, and allows working with many samples at dilute concentrations. The experiments were done in 384 well plates, using excitation (480 nm) and emission (520 nm) filters for fluorescein. The wells were loaded with the solution of fixed concentration of preformed quadruplex (12 nM) and with increasing concentrations of complementary strand (0-100 nM). Sample mixtures were incubated for a period of 24 h at 20 °C, and the plate was read at 520 nm. For analysis of data, the observed fluorescence intensity was considered as the sum of the weighted contributions from folded G-quadruplex strand and extended G-strand in duplex form:

F ) (1 - Rb)F0 + RbFb

(1)

where F is the observed fluorescence intensity at each titrant concentration, F0 and Fb are the respective fluorescence intensities of the initial and final states of titration, and Rb is the mole fraction of quadruplex in duplex form. Assuming 1:1 stoichiometry for the interaction in the case of complementary strand binding, it can be shown that

[Q]0Rb2 - ([Q]0 + [C] + 1/KA)Rb + [C] ) 0

(2)

where KA is the association constant, [Q]0 is the total G-strand concentration, and [C] is the added complementary strand concentration. From eqs 1 and 2, it can be shown that

∆F ) (∆Fmax/2[Q0]){([Q]0 + [C] + 1/KA) -

x([Q]0 + [C] + 1/KA)2 - 4[Q]0[C]}

(3)

where ∆F ) F - F0 and ∆Fmax ) Fmax - F0. Kinetic Experiments. An insight into the unfolding kinetics of a quadruplex is obtained from the unfolding rate constants. The opening up of the quadruplex (30 nM) upon addition of an equivalent concentration of the complementary strand (DNA and LNA 1-LNA 3) was monitored as the increase in the fluorescence intensity of the donor at 520 nm as a function of time using a Fluoromax 4 (Spex) spectrofluorimeter. The fluorescence change obtained was fitted using single and double exponential decays, but the data fit to double exponential decay with good residuals. Double exponential decay fitting was performed using the equation

∆F ) A1e-t/Γ1 + A2e-t/Γ2 + A3

(4)

where Γ1 and Γ2 are the time constants of the decay and A1 and A2 are their respective amplitudes. A3 is the fluorescence intensity at t ) ∞. The observed rate constant kobs was calculated

12330 J. Phys. Chem. B, Vol. 111, No. 42, 2007

Kumar and Maiti

from 1/(Γ), where (Γ) is the mean time constant and was calculated as

(Γ) ) (A1Γ1 + A2Γ2)/(A1 + A2)

(5)

Surface Plasmon Resonance Study. SPR measurements were performed with a BIAcore 2000 (BIAcore Inc.) system using streptavidin-coated sensor chips (Sensor chip SA; BIAcore Inc.). The 30-mer 5′-biotin TTTTTTTTTGGGTTAGGGTTAGGGTTAGGG-3′ was heated to 95 °C and annealed by slow cooling to form a quadruplex in filtered and degassed 10 mM HEPES with 100 mM KCl with 0.005% surfactant IGEPAL, pH 7.4. This sample was then immobilized (≈300 RU) on flow cell 2. Flow cell 1 was left blank as a control to account for any signal generated owing to bulk solvent effect or any other effect not specific to the DNA interaction, which was subtracted from the signal obtained in flow cell 2. All experiments were performed at 20 °C using running buffer (filtered and degassed 10 mM HEPES with 100 mM KCl and 0.005% surfactant IGEPAL) at pH 7.4. Oligonucleotide immobilized surface was exposed to the running buffer for at least 2 h at a flow rate of 5 µL/min to attain baseline stability. Analyte (unmodified and modified complementary strands) solutions at different concentrations (1.25-100 nM) were prepared in the running buffer and were injected (at 20 µL/min for 300 s) using an automated protocol. Following this, dissociation from the surface was monitored for 300 s in running buffer. Regeneration was done using 1 M NaCl in 50 mM NaOH. Data were analyzed using BIAevaluation 3.1.1. The dissociation phase was fitted to determine the kd, which was used in the association phase to obtain the ka values. Under pseudo-first-order conditions, where the free analyte concentration is held constant in the flow cell, the binding is described by

dR/dt ) kaC(Rmax - R) - kdR

(6)

where dR/dt is the rate of change of the SPR response signal, R and Rmax are the measured and maximum response signals measured with binding, C is the analyte concentration, and ka and kd are the association and dissociation rates, respectively. The binding constant KA is calculated as ka/kd. At equilibrium, dR/dt ) 0, and eq 6 can be written as

Req/C ) KARmax - KAReq

(7)

Req ) RmaxKAC/(1 + KAC)

(8)

Req is the measured response at equilibrium, and values of Req are obtained at a series of injected analyte C concentrations. The steady-state response, when plotted versus analyte concentrations and fit to the Langmuir isotherm for a molecular interaction, provides the binding affinity of immobilized molecule to its target and Rmax. Isothermal Titration Calorimetry Experiment. The ITC experiment was performed in a Microcal VP-ITC titration calorimeter. The 300 µL syringe was filled with 280 µM complementary strand. Titration was carried out by injecting 5 µL aliquots of complementary strand into the cell containing 20 µM preformed telomeric quadruplex at 10 min intervals at 20 °C; complete mixing was accomplished by stirring with the syringe paddle at 300 rpm. Titration curves were corrected for heat of dilution by injecting the complementary oligonucleotide into the 50 mM MES, 100 mM KCl, pH 7. The resultant titration plot was fitted to a sigmoidal curve by a nonlinear-least-squares

Figure 1. (a) CD spectra recorded for quadruplex (5 µM) alone (9) and mixtures of quadruplex (5 µM) and unmodified complementary strand DNA with 5 (4), 25 (O), and 50 µM (0) concentrations in 50 mM MES buffer, pH 7, 100 mM KCl. (b) CD spectra recorded for quadruplex (5 µM) alone (9) and equimolar mixtures of quadruplex (5 µM) and complementary strand DNA (4), LNA 1 (O), LNA 2 (]), and LNA 3 (0).

method using Origin 7.0 (Microcal Software). The binding constant KA, the stoichiometry N, and the enthalpy change ∆H° were obtained from the curve fitting. The Gibbs free energy change ∆G° and the entropy ∆S° were calculated from the equation ∆G° ) -RT ln KA ) ∆H° - T∆S°. Results To obtain information about the structural transitions in nucleic acids, we recorded CD spectra for telomeric quadruplex and for mixtures of preformed quadruplex with unmodified and LNA-modified complementary strands. Figure 1 shows the spectrum of telomeric quadruplex represented by a wellcharacterized predominant positive peak at 295 nm and a negative peak at 270 nm, which confirms the presence of antiparallel conformation. The spectra recorded for a mixture of preformed quadruplex in the presence of equimolar concentration, 5 and 10 times excess unmodified (DNA) complementary strand concentration, showed a blue shift for both positive and negative peaks to 278 and 252 nm, respectively, indicating duplex formation (Figure 1a). A shoulder band around 290 nm was observed in the case of equimolar concentration of unmodified complementary strand, which indicates the existence of residual quadruplex population in the mixture. However, at 1:5 and 1:10 quadruplex:unmodified complementary strand ratios, this shoulder band at 290 nm corresponding to residual quadruplex population decreased and the magnitude of the duplex signature composed of positive and negative peaks at 278 and 252 nm increased. This suggests that the increase in the complementary strand concentration drives greater conversion of the stable telomeric quadruplex to duplex. We also recorded spectra for a mixture of preformed quadruplex and equimolar concentration of LNA-modified (LNA 1-LNA 3) complementary strand and observed increases in the magnitude of the duplex signature for both positive and negative peaks at 278 and 252 nm, respectively. The duplex signature increased with increase in number of modifications and also showed a decrease in the shoulder band at 290 nm (Figure 1b). Hence, equimolar concentrations of modified complementary strands could drive greater duplex formation in contrast to unmodified complementary strand.

Quadruplex-WC Duplex Equilibrium

J. Phys. Chem. B, Vol. 111, No. 42, 2007 12331

Figure 2. Normalized fluorescence of quadruplex (12 nM) at 520 nm as a function of complementary strand concentrations, DNA (4), LNA 1 (O), LNA 2 (]), and LNA 3 (0), in 50 mM MES buffer, pH 7, 100 mM KCl. The fluorescence change reflects the opening of quadruplex for duplex formation.

For evaluating the efficiency of LNA-modified pyrimidinerich complementary strands to invade and hence accelerate unfolding of a stable telomeric quadruplex to form a duplex, we assessed the binding affinity of the complementary strands to the quadruplex. The LNA modification in the pyrimidinerich complementary strand was incorporated in the thymine base, which is complementary to adenine base in the TTA loop of telomeric quadruplex. When the quadruplex opens in the presence of its complementary strand, the distance between the donor and acceptor increases, leading to lesser energy transfer from donor to acceptor, and this increases the donor signal. We monitored the change in fluorescence intensity of fluorescein with increasing complementary strand concentration (0-100 nM) in 100 mM KCl buffer after 24 h of incubation. The representative graph for binding affinity is shown in Figure 2. The binding affinity toward the complementary strand at 20 °C was found to be 3.8 ((0.2) × 107 M-1 for the unmodified complementary strand DNA, and 1.0 ((0.15) × 108, 1.5 ((0.18) × 108, and 3.3 ((0.21) × 108 M-1 for LNA1, LNA2, and LNA 3, respectively. To comprehend the fate of the equilibrium, the relative stability of quadruplex and duplex needs to be understood. We collected temperature dependent fluorescence cooling and heating curves for an equimolar mixture of quadruplex and its unmodified and modified complementary strands at the rate of 0.2 °C/min. The cooling and heating profile obtained for a mixture of quadruplex and complementary strand showed no hysteresis, suggesting that the process is in thermodynamic equilibrium. For clarity we are representing only the cooling curves. Cooling the system slowly from 95 to 20 °C containing both the G-rich oligonucleotide and its complementary strand generates a competing environment which allows the G-rich oligonucleotide to either exist as a quadruplex or hybridize to its complementary strand to form a duplex depending on the relative thermodynamic stabilities of these two secondary structures. The fluorescence annealing (cooling) profile involves the contribution from quadruplex, duplex, and random coil populations. It has been previously shown that in a quadruplex the distance between donor and the acceptor is less, leading to more energy transfer to the acceptor. When the G-rich oligonucleotide binds to its complementary C-rich sequence, the donor and acceptor are separated by a larger distance,20 which leads to less energy transfer from donor to acceptor and results in a greater fluorescence intensity of the donor in the case of duplex. The relative order of the fluorescence signals for the different species would be highest for duplex and least for quadruplex, whereas the fluorescence intensity for random coil would be intermediate between duplex and quadruplex fluorescence.26

Figure 3. (a) Fluorescence annealing curves obtained for quadruplex (30 nM) alone (9) and for mixtures of quadruplex (30 nM) and unmodified complementary DNA strand with 30 (4), 150 (O), and 300 nM (0) concentrations in 50 mM MES buffer, pH 7, 100 mM KCl. (b) Fluorescence annealing curves obtained for quadruplex (30 nM) alone (9) and for equimolar mixtures of quadruplex (30 nM) and complementary strand, DNA (4), LNA 1 (O), LNA 2 (]), and LNA 3 (0), in 50 mM MES buffer, pH 7, 100 mM KCl.

We monitored the fluorescence annealing profile at 520 nm for the dual labeled telomeric G-rich sequence in the absence and presence of equimolar concentration, 5 and 10 times excess unmodified complementary strand concentration. The annealing profile recorded for quadruplex alone in the absence of complementary strand showed the expected sigmoidal curve in which the donor fluorescence decreased with decrease in temperature, suggesting quadruplex formation (Figure 3a). The annealing curves obtained for the equimolar mixture of both the G-rich and unmodified C-rich strands initially followed the quadruplex cooling profile at higher temperatures (90-65 °C). However, around 60 °C a change in annealing profile was observed which showed an increase in fluorescence with a decrease in temperature (Figure 3a). The initial decrease and subsequent increase in fluorescence in the cooling profile corresponds to quadruplex and duplex formation, respectively. The fluorescence intensity change at different temperatures is reflective of these contributing populations. The annealing profile recorded for the mixture of G-rich strand and 5 times excess of its complementary strand shows slight decrease in fluorescence intensity from 90 to 70 °C, in comparison to equimolar complementary strand concentration, and at around 70 °C an increase in the fluorescence intensity was observed with a decrease in temperature. This profile suggests that 5 times excess complementary strand forces the G-rich strand to adopt a duplex structure, resulting in greater duplex formation. We also recorded the annealing profile with 10 times excess complementary strand (Figure 3a). This profile did not show the initial decrease in fluorescence intensity for the temperature range of 90-70 °C, as was observed in case of 1:1 and 1:5 mixtures of G-rich and C-rich strands. This suggests negligible quadruplex formation when 10 times excess complementary strand was used. Around 73 °C, a greater increase in fluorescence intensity was obtained with a decrease in temperature in comparison with 1:1 and 1:5 mixtures of G-rich and C-rich strands. Since duplex formation is an intermolecular process, the increase in the complementary strand concentration forces the G-rich strand to hybridize with its complementary strand and drive greater duplex formation. The thermal stability of duplex is concentration dependent, and the increased duplex population obtained upon increasing complementary strand

12332 J. Phys. Chem. B, Vol. 111, No. 42, 2007

Kumar and Maiti

TABLE 1: Thermodynamic and Kinetic Parameters Obtained from Fluorescence Study in 50 mM MES Buffer, pH 7, 100 mM KCl at 20 °Ca DNA LNA 1 LNA 2 LNA 3

KA, M-1

Γ20, s

kobs, s-1

Deq, nM

Qf, nM

Deq/Q0

3.8 ((0.20) × 107 1.0 ((0.15) × 108 1.5 ((0.18) × 108 3.3 ((0.20) × 108

9340 ((150) 5251 ((105) 4623 ((160) 3723 ((130)

1.0 × 10-4 2.0 × 10-4 2.2 × 10-4 2.7 × 10-4

12.4 17.9 19.8 21.9

17.6 13.1 11.2 8.1

0.41 0.56 0.63 0.73

a KA is the equilibrium constant for duplex formation. Γ20 is the mean time constant. kobs is the observed rate constant and kobs ) 1/Γ20. Deq, Qf, and Deq/Q0 are duplex concentration, free quadruplex concentration, and fraction of duplex; these are all determined at equilibrium when equimolar concentrations of preformed quadruplex and complementary strand (30 nM) were mixed together in 50 mM MES buffer, pH 7, 100 mM KCl. The amount of duplex at equilibrium, Deq, was calculated from the binding affinity toward the complementary strand obtained from different experimental conditions, using the equation KA ) Deq/(Q0 - Deq)(C0 - Deq), where Q0 and C0 (Q0 ) C0) are the initial quadruplex and complementary strand concentrations.

concentration results in increased thermal stability. This is evident from the annealing curves, where the temperature at which increase in fluorescence is observed shifts to higher temperatures upon increasing complementary strand concentration (Figure 3a). The annealing profile was recorded for the mixture of equimolar concentration of G-rich strand and LNAmodified complementary strand (Figure 3b). The profile obtained for equimolar mixture of G-rich and LNA 1-modified complementary strand showed a similar decrease in fluorescence intensity at temperatures 90-65 °C, suggesting quadruplex formation, as seen for DNA. Around 65 °C there is an increase in fluorescence with a decrease in temperature, suggesting duplex formation. However, on using equimolar concentrations of LNA 2 and LNA 3, we obtained a lesser decrease in fluorescence intensity at temperatures 90-65 °C and a greater increase in fluorescence intensity at temperatures 65-15 °C, in contrast to equimolar unmodified complementary strand. Thus, equimolar LNA-modified complementary strands could drive greater duplex formation and consequently decrease the amount of quadruplex formed in contrast to that observed in the case of unmodified complementary strand. We also observed that the temperature at which increase in fluorescence intensity is observed in the annealing curve shifts to higher temperatures with an increment in the number of LNA modifications in the complementary strand. This shift to higher temperatures is due to a greater amount of duplex formation and the increased thermal stability provided by LNA-modified base (Figure 3b). It is difficult to obtain the thermodynamic parameters involved in duplex formation from the fluorescence annealing profile as it includes the contributions from duplex, quadruplex, and random coil. Our CD spectra (Figure 1a), fluorescence steady state experiments (Figure 2), and fluorescence annealing experiments (Figure 3a) concurrently indicate that 10 times excess complementary strand drives maximum duplex formation and leaves negligible quadruplex population in the mixture. Therefore, we conducted UV annealing experiments with G-rich strand and 10 times excess of its unmodified and modified complementary strands to obtain the thermodynamic parameters for duplex formation. We used 1 µM G-rich strand and 10 µM unmodified and LNA-modified complementary strands, monitored the absorbance at 260 nm with decreasing temperature, and obtained the characteristic melting profile for duplex. The UV annealing profile of quadruplex alone, monitored at 295 nm, gave a Tm of 67 ( 0.5 °C and a ∆G°20 of -3.2 ( 0.3 kcal/mol. However, the duplex annealing profile for DNA monitored at 260 nm showed a Tm of 60 °C. The Tm value of duplexes formed by LNA 1, LNA 2, and LNA 3 was 64, 67.5, and 72 °C, respectively. With the use of modified complementary strand (LNA 1-LNA 3) an average ∆Tm increase of ≈4 °C per modification for duplex was observed (Supporting Information Figure 1). The van’t Hoff enthalpy obtained for duplex formation

TABLE 2: Kinetic Parameters Obtained from SPR in 10 mM HEPES Buffer, pH 7.4, 100 mM KCl at 20 °Ca DNA LNA 1 LNA 2 LNA 3

ka, M-1 s-1

kd, s-1

KA, M-1

9.4 × 104 8.4 × 104 1.5 × 105 2.1 × 105

1.8 × 10-3 3.0 × 10-4 3.3 × 10-4 2.8 × 10-4

5.2 × 107 2.8 × 108 4.5 × 108 7.5 × 108

a

ka and kd are association and dissociation rate constants. KA is the equilibrium association constant for duplex formation obtained by ka/ kd. Error levels for ka, kd, and KA values are (15%.

using unmodified complementary strand was -52.5 kcal/mol, and it increased to -72.8 kcal/mol for LNA 1, -82.7 kcal/mol for LNA 2, and -86.7 kcal/mol for LNA 3, respectively. The ∆G°20 obtained from the UV experiments for duplex formed by unmodified complementary strand DNA was -14.7 kcal/ mol and the value for duplexes formed by modified complementary strand was -17.2, -19.5, and -21.2 kcal/mol for LNA 1, LNA 2, and LNA 3, respectively (Table 3). The LNA modification increases the thermodynamic stability of duplex and, hence, explains the dominance of duplex in structural competition between quadruplex and duplex. To extract the binding kinetics of the above system in 100 mM KCl, a precise estimation of the quadruplex unfolding rate constant upon hybridization to its complementary strand was required. We observed that, in the presence of K+ ions, the rate of quadruplex opening was relatively slow but could be followed by a conventional spectrophotometer at 20 °C as shown in Figure 4. The mean time constant obtained upon equimolar addition of unmodified complementary strand to preformed quadruplex was 9340 ((150) s at 20 °C in 100 mM KCl solution. In case of LNA-modified complementary strand the mean time constant decreased to 5251 ((105), 4623 ((160), and 3723 ((130) s for LNA 1, LNA 2, and LNA 3, respectively, as mentioned in Table 1. To get an insight into the detailed kinetics, we employed the surface plasmon resonance (SPR) technique to obtain the association and dissociation rate constants involved in quadruplex hybridization to its complementary strand to form duplex. We obtained Req, the measured response unit at equilibrium for a series of injected analyte concentrations and plotted Req versus complementary strand concentrations (Supporting Information Figure 2). These response curves when fit to the Langmuir isotherm for molecular interactions provide Rmax and the binding affinity. Rmax is the maximum response at saturation of binding sites and denotes the amount of duplex formed. Greater Rmax and binding affinity obtained for the LNA-modified complementary strands imply greater duplex-forming capability of the modified complementary strand over the unmodified counterpart, as shown in Figure 5. The analysis of sensorgrams indicates an increase in the association rate (ka) and a simultaneous decrease in the dissociation rate (kd) with an increase in number of LNA

Quadruplex-WC Duplex Equilibrium

J. Phys. Chem. B, Vol. 111, No. 42, 2007 12333

TABLE 3: Thermodynamic Parameters Obtained from ITC and UV Experiments Conducted in 50 mM MES Buffer, pH 7, 100 mM KCl ITCa KA, M-1 DNA LNA 1 LNA 2 LNA 3

1.5 ((0.3) × 4.2 ((0.5) × 106 7.0 ((0.4) × 106 2.0 ((0.2) × 107 106

UVb

∆H°, kcal/mol

∆S°, eu

∆G°20, kcal/mol

Tm, °C

∆HvH, kcal/mol

∆S°, eu

∆G°20, kcal/mol

-53 ((1.50) -61 ((0.7) -73 ((1.20) -83 ((1.5)

-153 -178 -218 -257

-8.2 -8.8 -9.1 -9.8

61.0 64.0 67.5 72.0

-52.5 -72.8 -82.7 -86.7

-128 -190 -215 -223

-15.0 -17.1 -19.7 -21.4

a Thermodynamic parameters were obtained for hybridization of complementary strand to the preformed quadruplex at 20 °C. The quadruplex concentration in the cell was 20 µM, and the complementary strand concentration in the syringe was 280 µM. ∆G° was determined using the relation ∆G° ) -RT ln KA, where R is the universal gas constant, T is temperature, and KA is the binding affinity for duplex formation. b UV annealing experiments were performed with 1 µM G-rich strand and 10 µM complementary strand. van’t Hoff enthalpy for duplex formation was determined from UV annealing curves using the relation ∆HvH ) -R[d ln K/d(1/T)], where R is the universal gas constant, T is temperature, and K is the equilibrium constant calculated for non-self-complementary associations using the relation K ) R/(CT/n)n-1(1 - R)n. R is the fraction of single strand in duplex state, CT is the total strand concentration, and n is the molecularity. Tm values are within (0.5 °C error. The thermodynamic parameters obtained were within 10% error.

Figure 4. Changes in the fluorescence of quadruplex (30 nM) at 520 nm in the presence of equimolar complementary strand concentration, DNA (4), LNA 1 (O), LNA 2 (]), and LNA 3 (0), in 50 mM MES buffer, pH 7, 100 mM KCl, as a function of time. The fluorescence change reflects the kinetics for quadruplex hybridization to its complementary strand.

Figure 5. Req obtained upon hybridization of 5′ biotin-telomericK+ quadruplex to its unmodified DNA (4) and LNA-modified complementary strands, LNA 1 (O), LNA 2 (]), and LNA 3 (0), in 10 mM HEPES pH 7.4, 100 mM KCl, at 20 °C.

modification; the data are tabulated in Table 2. The association and dissociation rates for quadruplex hybridization to unmodified complementary strand were 9.4 × 104 M-1 s-1 and 1.8 × 10-3 s-1, respectively. However, in the case of LNA 3 having a maximum number of modifications, an increase in association rate to 2.1 × 105 M-1 s-1 and a simultaneous decrease in the dissociation rate constant to 2.8 × 10-3 s-1 were observed. The binding affinity determined from these kinetic parameters was 5.2 ((0.78) × 107, 2.8 ((0.42) × 108, 4.5 ((0.67) × 108, and 7.5 ((1.12) × 108 M-1 for DNA, LNA 1, LNA 2, and LNA 3, respectively. Next we conducted isothermal titration calorimetry experiments to obtain a comprehensive description of thermodynamics involved in the associating system for Watson-Crick duplex formation for a mixture of preformed quadruplex and its

Figure 6. ITC profile for duplex formation obtained upon mixing telomeric quadruplex and unmodified, DNA (4), and modified complementary strands, LNA 1 (O), LNA 2 (]), and LNA 3 (0), in 50 mM MES buffer, pH 7, 100 mM KCl, at 20 °C.

unmodified and modified complementary strands. The hybridization event is dependent on nearest-neighbor WC base pairs. The duplex formed by unmodified and modified complementary strands has the same purine-pyrimidine content, but the sugar modification also affects the thermodynamic profile. Figure 6 shows the characteristic sigmoidal curves obtained for heat of injection for the hybridization process of preformed quadruplex to its unmodified and modified complementary strands, and the hybridization process was more exothermic in the case of modified complementary strands. ∆H°ITC was -53 ( 1.5 kcal/ mol for DNA and -61 ( 0.7, -73 ( 1.2, and -83 ( 1.5 kcal/ mol for LNA 1, LNA 2, and LNA 3, respectively (Table 3). The binding affinity determined was 1.5 ((0.3) × 106, 4.2 ((0.5) × 106, 7 ((0.4) × 106, and 2.0 ((0.2) × 107 M-1 for DNA, LNA 1, LNA 2, and LNA 3, respectively (Table 3). Discussion The relatively frequent occurrence of putative G-quadruplex forming sequences in the human genome suggests that this motif is one of the most versatile and stable motifs of considerable interest for both its structural and functional relevance with special emphasis on the telomeric DNA. Efforts are being invested for the design of compounds and oligonculeotides that can target telomere structure, affect its molecular recognition and function, and thus be employed for telomerase inhibition. With the exploration and examination of nucleic acid hybridization, a multitude of nucleic acid analogues have been synthesized which provide promising therapeutic applications. Among the nucleic acid analogues, locked nucleic acid (LNA), a conformationally locked analogue, displays unprecedented high affinity toward its target and provides increased thermostability to duplexes and triplexes.36,37 LNA and LNA-DNA chimeras

12334 J. Phys. Chem. B, Vol. 111, No. 42, 2007 complementary to the telomerase RNA template have been demonstrated to be potent and selective telomerase inhibitors.13 However, a potential problem with the use of small oligomers to recognize the 11-base RNA template of telomerase is that these six to eight base sequences may show complementarity toward many other cellular mRNA and genomic DNA sequences, resulting in inadequate selectivity. However, employing LNA-based high-affinity oligonucleotide (21-mer) complementary to G-rich repetitive unit in 3′ telomeric overhang (G3TTA)3G3, which adopts quadruplex structure in vitro, would exclusively restrict the binding of telomerase RNA template and inhibit telomere extension, and also overcome the likelihood of nonspecific effect. Moreover, the recruitment of telomeric proteins required for regulating the length and integrity of G-rich overhang would be affected due to formation of a duplex structure upon hybridization to LNA-modified complementary strand, and consequently would disturb the homeostasis of telomeres and induce apoptosis. Using CD, FRET, UV, SPR, and ITC, we have investigated the influence of LNA-modified complementary strand in modulating the quadruplex/Watson-Crick duplex equilibrium. We have recently demonstrated the sensitivity of this equilibrium to environmental changes by mimicking natural and pharmacological context by using molecular crowding agents and quadruplex selective ligand, respectively. Molecular crowding agents and quadruplex interactive ligand favor quadruplex formation and delay duplex formation.28 In the present study, we employ a pharmacological agent, a LNA-modified complementary strand, which drives the unfolding of a stable telomeric quadruplex to form a duplex. Our CD results indicate the induced structural transition of preformed telomeric quadruplex to duplex in the presence of unmodified and LNA-modified complementary strands. The CD spectrum recorded for an equimolar mixture of preformed quadruplex and unmodified complementary strand showed a structural transition from antiparallel quadruplex signature with a positive peak at 295 nm and a negative peak at 270 nm to duplex signature with a positive peak at 278 nm and a negative peak at 252 nm. A shoulder band around 290 nm was also obtained, indicating the existence of residual quadruplex population in the mixture. However, using 5 and 10 times excess unmodified complementary strand concentrations resulted in the increase in duplex signature and the disappearance of the residual shoulder band. Intriguingly, the equimolar concentration of LNA-modified complementary strand could drive greater conversion of stable telomeric quadruplex to duplex, in comparison with unmodified complementary strand. The increase in LNA modifications resulted in an increase in the magnitude of duplex signature comprising of a positive peak at 278 nm and a negative peak at 252 nm and concomitant loss of the shoulder band of residual quadruplex population at 290 nm. Equimolar concentrations of modified complementary strands could drive greater quadruplex opening and mediate greater duplex formation in contrast to unmodified complementary strand, which required 5-10 times excess complementary strand to drive a similar extent of duplex formation. Fluorescence Annealing Study. We also carried out temperature-dependent fluorescence studies to compare the relative stability of quadruplex and WC duplex which would dictate their respective predominance at equilibrium. We recorded the annealing curves obtained for the equimolar mixture of both the G-rich and unmodified complementary strand DNA, which initially followed the quadruplex cooling profile at higher temperatures (90-65 °C). Around 60 °C, a change in annealing

Kumar and Maiti profile was observed, which showed an increase in fluorescence with a decrease in temperature (65-15 °C). The initial decrease and subsequent increase in fluorescence intensity in the annealing profile correspond to quadruplex and duplex formation, respectively. Increasing the concentration of unmodified complementary strands by 5 and 10 times resulted in a greater increase in fluorescence upon a decrease in temperatures (65-15 °C), thus driving greater duplex formation than the equimolar complementary concentration. This implies that addition of equimolar concentration of unmodified complementary strand does not produce a complete increase in fluorescence at lower temperatures (65-15 °C), suggesting the existence of quadruplex population. This is also in agreement with our CD result, which shows the presence of a shoulder band from residual quadruplex along with a duplex signature. When we recorded the annealing profile of equimolar concentration of G-rich telomeric strand and LNA-modified complementary strand, we obtained a similar trend in annealing profile as observed for unmodified complementary strand. The temperature at which an increase in fluorescence is observed shifts to a higher temperature and the profile displays a greater increase in fluorescence with a decrease in temperature (65-15 °C) in contrast to unmodified strand. The curvature of the annealing profile in the presence of unmodified and modified complementary strands depicts the contribution from random coil at temperatures above 90 °C. The remaining unusual profile can be explained by the competition between the quadruplex and duplex structures. With the increase in number of modifications in complementary strand, we observe initially a lesser decrease in the fluorescence at higher temperatures (90-65 °C), followed by a subsequent increase in fluorescence with a decrease in temperatures (65-15 °C) in contrast to unmodified complementary strand. From the analysis of fluorescence annealing curves we observe that both quadruplex and WC duplex are thermodynamically stable and coexist at equilibrium, but their predominance can be modulated by using a large excess of complementary strand or by employing LNA-modified complementary strands. To further understand the efficiency of LNAmodified strand in shifting the equilibrium to duplex formation, we determined the binding affinity, kinetic parameters, and thermodynamic parameters of hybridization of preformed quadruplex to its unmodified and LNA-modified complementary strands. Binding Affinity. To examine the efficiency of LNAmodified complementary strands to invade the stable telomeric quadruplex, we determined the binding affinity of unmodified and modified complementary strands toward the quadruplex by three different techniques (fluorescence, SPR, and ITC). The binding affinities obtained from fluorescence studies were 3.8 ((0.2) × 107 M-1 for the unmodified complementary strand DNA, and 1.0 ((0.15) × 108, 1.5 ((0.18) × 108, and 3.3 ((0.21) × 108 for LNA 1, LNA 2, and LNA 3, respectively. The binding affinity derived from the kinetic parameters using the SPR technique was 5.2 ((0.78) × 107, 2.8 ((0.42) × 108, 4.5 ((0.67) × 108, and 7.5 ((1.12) × 108 M-1 for DNA, LNA 1, LNA 2, and LNA 3, respectively. Using ITC, the binding affinity determined was 1.5 ((0.3) × 106, 4.2 ((0.5) × 106, 7 ((0.4) × 106, and 2.0 ((0.2) × 107 M-1 for DNA, LNA 1, LNA 2, and LNA 3, respectively. The binding affinity values for hybridization of preformed quadruplex to its unmodified and LNA-modified complementary strands obtained from fluorescence were slightly lower than the values obtained from the SPR method although they were of the same order of magnitude (Table 2). However, binding affinities obtained from ITC

Quadruplex-WC Duplex Equilibrium experiments are 1 order of magnitude less than the binding affinities obtained from fluorescence and SPR methods (Table 3). Nonetheless, these techniques independently reveal a similar trend in binding affinities upon employing LNA-modified complementary strand. These observations affirm the superior ability of the LNA-modified complementary strand to invade stable quadruplex structures. The difference in the binding affinities from fluorescence and SPR may arise due to the fact that in SPR experiments the quadruplex has been immobilized onto a sensor chip surface through a T9 linker. Such immobilization often destabilizes DNA structures and thus may allow better binding toward its complementary strands, showing higher binding affinities than the values obtained by fluorescence methods. Other factors, such as probe density, surface heterogeneity, and nonspecific adsorption onto a sensor chip, may cause discrepancies in the binding affinity measurements. Zhao et al.29 determined association and dissociation rate constants for hybridization of telomeric sequence (TTAGGG)4 to its complementary strand (CCCTAA)4 through surface plasmon resonance in NaCl buffer, and the binding affinity for hybridization obtained was 1.2 × 1010 M-1. This is much higher than the value obtained in the present study for quadruplex hybridization to its unmodified DNA complementary strand in KCl buffer, where the binding affinity obtained was 5.2 ((0.78) × 107 M-1. The difference observed in the binding affinities obtained in both these studies is attributed to the increased stability of quadruplex in KCl buffer relative to that in NaCl buffer, thus resulting in a lowered binding affinity for hybridization in KCl buffer. The larger difference in the binding affinities measured by ITC and by two other methods, fluorescence and SPR, is mainly due to the use of different concentrations of the quadruplex for different methods. The binding constant can be determined accurately when titrant is added to fixed and at constant concentration [Q0] of quadruplex, such that [Q0] is in the range of 1/KA; otherwise the obtained KA would be underestimated. However, the ITC experiment was performed at [Q0] ) 20 µM, which is much higher than 1/KA if we consider that KA values obtained from fluorescence and SPR methods are more accurate. An ITC experiment at low DNA concentration would give a heat of reaction below the sensitivity of the instrument. It should be noted when KA values for biomolecular interactions are too high and reaction heats are too low for determination by ITC at an appropriate (1/KA) concentration range. However, ITC allows the determination of accurate enthalpy of reaction, which is difficult to obtain from fluorescence and SPR. Thus, using a combination of fluorescence and SPR (KA or ∆G) and ITC (∆H) would provide a precise thermodynamic description for the bimolecular interaction being investigated in the present study. Using the equilibrium binding constants obtained from fluorescence study, we calculated the amount of duplex (Deq) and free quadruplex (Qf) obtained upon mixing equimolar concentration (30 nM) of preformed quadruplex with its unmodified or modified complementary strand after the attainment of equilibrium under experimental conditions. We found an increase in duplex population with increase in LNA modifications as shown in Table 1. The duplex concentration obtained at equilibrium under the experimental conditions was 12.4, 17.9, 19.8, and 21.8 nM for DNA, LNA 1, LNA 2, and LNA 3, respectively. In our earlier study on the influence of natural (molecular crowding) and pharmacological (quadruplex interactive ligand) agents on telomeric quadruplex-duplex equilibrium, we found that these perturbants stabilize quadruplex, delay hybridization to complementary strand, and push

J. Phys. Chem. B, Vol. 111, No. 42, 2007 12335 the equilibrium toward quadruplex formation.28 Our previous study and current work on telomeric quadruplex suggest that the sensitivity of equilibrium and rate of the interconversion between quadruplex and WC duplex can be modulated by the fluctuation in solute concentration, and with the introduction of selective pharmacological/therapeutic perturbation inside the cell. Kinetic Parameters. Understanding the kinetics of therapeutic oligonucleotide binding to DNA or RNA target is essential for proving its potential application. The oligonucleotides having high binding affinities should have fast target binding kinetics to produce their desired effects in living cells before being degraded by cellular enzymes. We employed fluorescence and SPR to determine the role of LNA substitution in the complementary strands on hybridization kinetics. Upon employing LNA-modified complementary strand, we observed an increase in the rate constant with an increase in the number of modifications from 1.0 × 10-4 to 2.7 × 10-4 s-1 for DNA to LNA 3 at 20 °C in potassium buffer as obtained from fluorescence studies. SPR studies provided more quantitative data on the kinetic parameters. The association and dissociation rates for quadruplex hybridization to unmodified complementary strand were 9.4 × 104 M-1 s-1 and 1.8 × 10-3 s-1, respectively. However, LNA 3, with the maximum number of modifications, showed an increase in the association rate to 2.1 × 105 M-1 s-1 with a concomitant decrease in the dissociation rate constant to 2.8 × 10-3 s-1. We also noticed a significant difference between solution and surface hybridization kinetics. The confinement of ss-DNA on the surface causes steric hindrance which destabilizes the intramolecular structure, and thus affects the surface kinetics of DNA hybridization versus solution kinetics. Surface analytical methods such as quartz crystal microbalance (QCM) and surface plasmon resonance (SPR) do not detect complete duplex hybridization, but instead detect duplex nucleation or “initial target recognition” which thus influences the efficiency and kinetics of hybridization.42 Nevertheless, our fluorescence and SPR studies indicate that association kinetics become faster upon employing LNAmodified strand. The faster association and concomitant slower dissociation kinetics account for the enhanced binding of LNAmodified complementary strands to the preformed quadruplex compared to the unmodified reference oligonucleotides. This is due to the fact that the locked 3′ endo conformation of LNAmodified bases reduces the conformational flexibility of ribose and allows better preorganization and stacking. This facilitates faster hybridization of the complementary strand to quadruplex to form duplex. A similar observation has been reported by using 10 times excess of PNA probes, which increases the opening rate from 5 × 10-4 to 2 × 10-3 s-1 compared with the unmodified reference oligonucleotides in NaCl buffer.24 Thermodynamic Parameters. ITC experiments were performed to obtain the complete thermodynamic parameters for quadruplex hybridization to its unmodified and modified complementary strands. The obtained ∆H°ITC was -53 ((1.5) kcal/mol when unmodified complementary strand was injected into preformed quadruplex in KCl buffer. The obtained ∆H° value is much lower than the expected value for duplex formation (-157 kcal/mol) which can be obtained from the nearest-neighbor method.43 The enthalpy change in this process involves endothermic and exothermic contributions from opening up of preformed quadruplex and hybridization between Gand C-rich strands, respectively. The overall enthalpy change is the sum of the contribution from each process, leading to the lower ∆H°ITC than the calculated (expected) value obtained from

12336 J. Phys. Chem. B, Vol. 111, No. 42, 2007 the nearest-neighbor method. The binding enthalpy for duplex formation for preformed quadruplex to its complementary strand in NaCl buffer was reported as -95 kcal/mol,27 in contrast to -53 ((1.5) kcal/mol in KCl buffer as obtained in our study. The ∆G°ITC for duplex formation in NaCl buffer was -9.5 kcal/ mol,27 compared to -8.2 kcal/mol in KCl buffer obtained in our study. The higher stability of quadruplex in KCl in contrast to NaCl buffer38 makes duplex formation more favorable in the presence of Na+ ions in comparison with K+ ions. This comparison also highlights the influence of monovalent cation in modulating the quadruplex to duplex structural transition. When LNA-modified complementary strand was employed, we observed that hybridization to quadruplex was more exothermic in comparison with unmodified strand. ∆H°ITC increased with increase in modification from -53 ((1.5) kcal/mol for DNA to -85 ((1.5) kcal/mol for LNA 3, as shown in Table 3. We also observed a decrease in entropy for LNA-modified duplex in comparison with unmodified duplex. The locked conformation of sugar makes the nucleotide conformationally constrained and reduces the flexibility of the base pair. The ∆S° for duplex formed by DNA is -153 kcal/mol, and for duplex formed by LNA 3 it is -257 kcal/mol. The ∆G°ITC obtained for duplex formation in the case of DNA was -8.2 kcal/mol and in the case of LNA 3 was -9.7 kcal/mol. These results indicate that the modified complementary strand can perform an efficient invasion and drive better conversion of stable telomeric quadruplex to duplex, and out-compete quadruplex in this competitive structural equilibrium. To understand the role of LNA strand on quadruplex-WC equilibrium, individual thermodynamic profiles of quadruplex and duplexes were extracted. Our CD, steady-state fluorescence, and fluorescence annealing experiments show that, in the presence of 10 times excess complementary strand, duplex is the predominant state. To obtain a thermodynamic profile for duplex formation, we performed UV annealing experiments for a mixture of G-rich strand and 10 times excess complementary strand and monitored the absorbance at 260 nm. The ∆G°20 values obtained from the UV annealing experiments for quadruplex alone and duplex formed with unmodified complementary strand were -3.2 and -15 kcal/mol, respectively (Table 3). The thermodynamic stability of modified complementary strand increased with an increment in the number of LNA modifications, and the ∆G°20 obtained was -17.1 kcal/mol for LNA 1, -19.7 kcal/mol for LNA 2, and -21.4 kcal/mol for LNA 3 (Table 3). The higher stability of each modified duplex results from the characteristic compensation of a favorable enthalpy with an unfavorable entropy term. The favorable enthalpy term corresponds to exothermic contributions from base pairing and endothermic contributions from the release of electrostricted water molecules and/or uptake of structural water. NMR studies have shown that the incorporation of LNA causes local structural perturbation which allows preorganization and better base stacking interaction than the unmodified counterpart.44 The unfavorable entropy contributions are the result of the conformational rearrangement of the bimolecular association of two strands and the uptake of counterions and uptake of water molecules in the case of the modified duplex. Recently, by UV melting experiments we have shown that the formation of LNAmodified duplexes is associated with a higher counterion uptake than their DNA counterpart.36 These observations can be correlated with the structural changes observed in the duplex upon introduction of LNA modifications. NMR studies have shown that the presence of the LNA modification in one of the oligonucleotide strands of the duplex leads to a change in the

Kumar and Maiti conformation of the helix from a B-type to A-type structure.45 Both the linear and three-dimensional charge densities of the A-form DNA are known to be high compared to those of the B-form,46 which allows a higher uptake of counterions upon duplex formation, and possibly explains the unfavorable entropy change associated with the introduction of LNA modification. The relative free energy difference (∆∆G°20) between duplex and quadruplex controls the predominance of a particular population at equilibrium. This difference in free energy (∆∆G°20) increases from -11.8 kcal/mol for the duplex formed by DNA to -14,-16.5, and -18.2 kcal/mol for duplexes formed by LNA 1, LNA 2, and LNA 3, respectively. The greater negative magnitude of ∆∆G°20 implies that the equilibrium favors greater duplex formation and out-competes quadruplex. Thus our fluorescence and UV annealing curves concurrently indicate the efficiency of LNA-modified complementary strands to drive greater duplex formation in quadruplex/Watson-Crick competition. However, thermodynamic parameters for hybridization of quadruplex to its complementary strand are lower than those obtained upon hybridization of G-rich strand to its complementary strand. This is evident from the ∆G°ITC value for duplex formation, which is less than the ∆G°UV value obtained for both unmodified and LNA-modified complementary strands. The difference in ∆G° values obtained in ITC and UV experiments is because in ITC experiments the binding energy for hybridization of complementary strand to preformed quadruplex is determined, in which energy is required for the disruption of stable quadruplex before the final hybridization of complementary strand, which decreases the magnitude of overall ∆G°. However, in the UV experiment, we determined the duplex formation by annealing the mixture of G-rich strand and 10 times excess of its C-rich complementary strand, which results in maximum duplex and negligible quadruplex formation, thus resulting in higher ∆G°UV values. Conclusion This study shows that both quadruplex and duplex are thermodynamically stable and coexist in equilibrium. However, this equilibrium can be perturbed with the introduction of a selective pharmacological/therapeutic agent. Our results demonstrate that locked nucleic acid (LNA) modified complementary strand possesses superior ability to invade and hybridize to the stable quadruplex to form duplex, in contrast to its DNA analogue, and thus favors duplex formation in structural competitive equilibrium. With quadruplexes being involved in gene regulation at both the DNA and RNA level, the quantitative information provided by our experiments would assist in better design of oligonucleotides considering the position and number of modifications to improve their potency and selectivity. This attempt would make diagnostics and therapeutics cost effective in targeting quadruplex structures in telomeric ends and other biologically relevant regions by modulating their recognition and function via the quadruplex/Watson-Crick duplex equilibrium. Acknowledgment. N.K. acknowledges a research fellowship from CSIR. S.M. acknowledges CSIR for funding this research (structure-function relation of modified nucleic acids). We wish to thank The Centre for Genomics Applications (TCGA) at IGIB granted by CSIR and DST for providing instrumental facilities and technical help. We would also like to thank the reviewers for their suggestions which helped us to improve the manuscript. Supporting Information Available: UV melting and SPR sensorograms. This material is available free of charge via the Internet at http://pubs.acs.org.

Quadruplex-WC Duplex Equilibrium References and Notes (1) Wright, W. E.; Tesmer, V. M.; Huffman, K. E.; Levene, S. D.; Shay, J. W. Genes DeV. 1997, 11, 2801. (2) McElligott, R.; Wellinger, R. J. EMBO J. 1997, 16, 3705. (3) Markov, V. L.; Hirose, Y.; Langmore, J. P. Cell 1997, 88, 657. (4) Smogorzewska, A.; de Lange, T. Annu. ReV. Biochem. 2004, 73, 177. (5) Parkinson, G. N.; Lee, M. P.; Neidle, S. Nature 2002, 417, 876. (6) Balagurumoorthy, P.; Brahmachari, S. K. J. Biol. Chem. 1994, 269, 21858-21869. (7) Griffth, J. D.; Comeau, L.; Rosenfield, S.; Stansel, R. M.; Bianchi, A.; Moss, H.; de Lange, T. Cell 1999, 97, 503. (8) Bodnar, A. G.; Ouellette, M.; Frolkis, M.; Holt, S. E.; Chiu, C. P.; Morin, G. B.; Harley, C. B.; Shay, J. W.; Lichtsteiner, S.; Wright, W. E. Science 1998, 279, 349. (9) Zahler, A. M.; Williamson, J. R.; Cech, T. R.; Prescott, D. M. Nature 1991, 350, 718. (10) Shammas, M. A.; Reis, S.; Akiyama, M.; Koley, H.; Chauhan, D.; Hideshima, T.; Goyal, R. K; Hurley, L. H.; Anderson, K. C.; Munshi, N. C. Mol. Cancer Ther. 2003, 2, 825. (11) Tahara, H.; Shin-ya, K.; Seimiya, H.; Yamada, H.; Tsuruo, T.; Ide, I. Oncogene 2006, 25, 1955. (12) Braasch, D. A.; Corey, D. R. Biochemistry 2002, 41, 4503. (13) Elayadi, A. N.; Braasch, D. A.; Corey, D. R. Biochemistry 2002, 41, 9973. (14) Weitzmann, M. N.; Woodford, K. J.; Usdin, K. J. Biol. Chem. 1998, 273, 30742. (15) Sen, D.; Gilbert, W. Nature 1988, 334, 364. (16) Simonsson, T.; Pecinka, P.; Kubista, M. Nucleic Acids Res. 1998, 26, 1167. (17) Cogoi, S.; Xodo, L. E. Nucleic Acids Res. 2006, 34, 2536. (18) Todd, A. K.; Johnston, M.; Neidle, S. Nucleic Acids Res. 2005, 33, 2901. (19) Huppert, J. L.; Balasubramanian, S. Nucleic Acids Res. 2007, 35, 406. (20) Kumar, N.; Maiti, S. Biochem. Biophys. Res. Commun. 2004, 319, 759. (21) Datta, B.; Armitage, B. A. J. Am. Chem. Soc. 2001, 123, 9612. (22) Phan, A. T.; Mergny, J. L. Nucleic Acids Res. 2002, 30, 4618. (23) Li, W.; Wu, P.; Ohmichia, T.; Sugimoto, N. FEBS Lett. 2002, 526, 77.

J. Phys. Chem. B, Vol. 111, No. 42, 2007 12337 (24) Green, J. J.; Ying, L.; Klenerman, D.; Balasubramanian, S. J. Am. Chem. Soc. 2003, 125, 3763. (25) Ying, L.; Green, J. J.; Li, H.; Klenerman, D.; Balasubramanian, S. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 14629. (26) Risitano, A.; Fox, K. R. Biochemistry 2003, 42, 6507. (27) Li, W.; Miyoshi, D.; Nakano, S.; Sugimoto, N. Biochemistry 2003, 42, 11736. (28) Kumar, N.; Maiti, S. Nucleic Acids Res. 2005, 33, 6723. (29) Zhao, Y.; Kan, Z.-y.; Zeng, Z.-x.; Hao, Y.-h.; Chen, H.; Tan, Z. J. Am. Chem. Soc. 2004, 126, 13255. (30) Halder, K.; Chowdhury, S. Nucleic Acids Res. 2005, 33, 4466. (31) Marin, V. L.; Armitage, B. A. J. Am. Chem. Soc. 2005, 127, 8032. (32) Wengel, J.; Petersen, M.; Nielsen, K. E.; Jensen, G. A.; Håkansson, A. E.; Kumar, R.; Sorensen, M. D.; Rajwanshi, V. K.; Bryld, T.; Jacobsen, J. P. Nucleosides, Nucleotides Nucleic Acids 2001, 20, 389. (33) Koshkin, A. A.; Singh, S. K.; Nielsen, P.; Rajwanshi, V. K.; Kumar, R.; Meldgaard, M.; Olsen, C. E.; Wengel, J. Tetrahedron 1998, 54, 3607. (34) Petersen, M.; Wengel, J. Trends Biotechnol. 2003, 21, 74. (35) Wahlestedt, C.; Salmi, P.; Good, L.; Kela, J.; Johnsson, T.; Hokfelt, T.; Broberger, C.; Porreca, F.; Lai, J.; Ren, K.; Ossipov, M.; Koshkin, A.; Jakobsen, N.; Skouv, J.; Oerum, H.; Jacobsen, M. H.; Wengel, J. Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 5633. (36) Kaur, H.; Arora, A.; Wengel, J.; Maiti, S. Biochemistry 2006, 45, 7347. (37) Torigoe, H.; Hari, Y.; Sekiguchi, M.; Obika, S.; Imanishi, T. J. Biol. Chem. 2001, 276, 2354. (38) Kankia, B. I.; Marky, L. A. J. Am. Chem. Soc. 2000, 123, 10799. (39) Cantor, C. R.; Warshaw, M. M.; Shapiro, H. Biopolymers 1970, 9, 1059. (40) Marky, L. A.; Bloomfield, K. S.; Kozlowski, S.; Breslauer, K. J. Biopolymers 1983, 9, 1247. (41) Sjo¨back, R.; Nygren, J.; Kubista, M. Biopolymers 1998, 464, 445. (42) Wong, E. L. S.; Chow, E.; Gooding, J. J. Langmuir 2005, 21, 6957. (43) SantaLucia, J., Jr. Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 1460. (44) Petersen, M.; Nielsen, C. B.; Nielsen, K. E.; Jensen, G. A.; Bondensgaard, K.; Singh, S. K.; Rajwanshi, V. K.; Koshkin, A. A.; Dahl, B. M.; Wengel, J.; Jacobsen, J. P. J. Mol. Recognit. 2000, 13, 44. (45) Nielsen, K. E.; Rasmussen, J.; Kumar, R.; Wengel, J.; Jacobsen, J. P.; Petersen, M. Bioconjugate Chem. 2004, 15, 449. (46) Manning, G. S. Biophys. Chem. 2002, 101-102, 461.