730
J. Phys. Chem. B 2001, 105, 730-735
Probing the Interaction of [Ru(phen)2(dppz)]2+ with Single-Stranded DNAsWhat Degree of Protection Is Required for Operation of the “Light-Switch Effect”? Colin G. Coates, John J. McGarvey,* Philip L. Callaghan, Monica Coletti, and James G. Hamilton School of Chemistry, The Queen’s UniVersity of Belfast, Belfast BT9 5AG, Northern Ireland ReceiVed: August 7, 2000; In Final Form: NoVember 27, 2000
Time-resolved and steady-state luminescence and transient resonance Raman measurements have been carried out on the complex [Ru(phen)2dppz]2+ (1) in the presence of single-stranded (ss) DNA that is either covalently attached to or mixed in 1:1 ratio with the complex. The well-known enhancement of luminescence (the “lightswitch” effect) exhibited by (1) when intercalated to double-stranded DNA is also observed in the presence of the single-stranded material, under conditions of covalent attachment or simple mixing. The evidence from both the luminescence and the transient Raman studies suggests that the enhancement need not necessarily reflect deep intercalation of the dppz ligand between the bases of the ss material.
Introduction The complex (1) (phen ) 1,10-phenanthroline; dppz ) dipyrido[3,2-a:2′,3′-c]phenazine) has been studied extensively, with primary emphasis on the photophysics in environments of varying polarity and hydrogen bonding ability.1,2 There has been particular interest in the “light-switch effect”3 exhibited by the complex in which the characteristically weak emission from the metal-to-ligand charge transfer (MLCT) excited state in aqueous solution is greatly enhanced upon interaction with double-stranded (ds) nucleic acids. A mechanism for the effect has recently been proposed,1 involving interaction between two MLCT states which differ markedly in the rate of solvent-dependent radiationless decay. However, surprisingly little has been reported concerning the interaction of the complex with single-stranded4 DNA. There exists a considerable global investment in the rapidly evolving development of sequence-specific nucleic acid detection platforms. Hybridization and nucleic acid amplification technologies are key to such systems, and the study of interactions of singlestranded (ss) nucleic acids is a central concern. It had previously been reported5 that complex (1), when tethered by a flexible chain to the 5′ end of synthetic ss DNA, exhibited negligible luminescence, but that greatly enhanced emission from the MLCT excited state was observed upon hybridization to the complementary strand. We have now investigated the influence of the interaction of complex (1) with ss material on the luminescent properties and transient resonance Raman spectroscopy of the complex. The effects of simple mixing of the components in solution and of covalently attaching6 the complex to ss oligonucleotide have both been explored in a series of internally comparative studies.
Luminescence spectra of the same samples as used for the kinetic measurements were recorded with a gated dual diode array multichannel detector (Princeton Instruments model DIDA 700G). An excitation wavelength of 354.7 nm was also used for the single-color pump and probe transient resonance Raman (TR2) studies, with spectra acquired by means of an EG&G OMA III multichannel detection system.7 Materials. Oligonucleotides were supplied by the Oligonucleotide Synthesis Unit of Queen’s University Belfast, with sequences (see Table 1) designed to avoid “hairpinning” and self-complementarity. Untethered complex (1) was prepared as described elsewhere.3 Complex (1) was covalently attached to the 5′ carbon of one phenanthroline ligand by means of a flexible 13-atom linker to the 5′ end of several oligonucleotides, through a phosphodiester bridge by means of the phosphonate approach as described by Meggers et al.,6a with structure as shown below.6b Racemic forms of the complex have been used throughout the experiment. All of the luminescence and Raman experiments with ss and ds DNA were initially carried out both at phosphate-buffered salt (NaCl) concentrations up to 100 mM and in pure water, to ascertain any possible influence of the ionic strength in these comparative studies of the ss and ds materials, where maintenance of internally consistent conditions for their study is the key issue. Concentrations of complex used for luminescence and UV-vis measurements were typically 5 µM.5 However, a concentration of 134 µM was used in the case of the transient resonance Raman measurements in order to obtain sufficient signal quality. In the case of the tethered system, the results obtained still reflected intramolecular interactions and were not influenced by possible intermolecular interactions at this higher concentration (see Discussion section).
Experimental Section
Results
Pulsed Nd3+/YAG lasers (Spectra -Physics Models DCR and GCR) were used as the excitation sources for both luminescent lifetime studies and for the transient resonance Raman (TR2) investigations. The emission lifetimes were measured at a probe wavelength of 590 nm, following excitation at 354.7 nm at pulse energies typically in the region of 5 mJ. Kinetic traces were recorded by conventional rapid response photometry and processed using a Tektronix digitizing oscilloscope (TDS 350).
Luminescent lifetime studies at a probe wavelength of 590 nm, following 354.7 nm excitation, were carried out on 5 µM solutions of (1) in the presence of either ds DNA (with a phosphate: complex ratio to match the corresponding ratio in the single-stranded oligos) or a series of ss oligonucleotides (tethered or untethered) of varying length, as shown in Table 1. The lowest 3MLCT state of (1) in aqueous solution is too short-lived1 to be detected using equipment with nanosecond
[Ru(phen)2dppz]2+
10.1021/jp002856w CCC: $20.00 © 2001 American Chemical Society Published on Web 12/29/2000
Interaction of [Ru(phen)2(dppz)]2+ with ss DNA
J. Phys. Chem. B, Vol. 105, No. 3, 2001 731
TABLE 1: Average Luminescence Lifetimesa of (1) in Various Nucleic Acid Environments: CT DNA, ss Oligonucleotide, and Tethered to ss Oligonucleotide nucleic acid (1) in water (1) in CT DNA (15[phosphate]: 1[Ru]) (1) with oligo A 15-mer (1:1) (1) with oligoB 16-mer (1:1) (1) with oligo C 12-mer (1:1) (1) with oligo D 17-mer (1:1) (1) with oligo E 15-mer (1:1) (1) with oligo F 34-mer (1:1) (1) tethered to oligo C (1) tethered to oligo E (1) tethered to oligo F a
sequence
3′
AGTGCCAACGTTGCA5′
3′AGTAACCCGTGAACGA5′ 3′
CAGGTGGAGTCG5′
3′GCCCCTATCCCTGCGAG5′ 3′
ACGTTCGAACCGTGA5′
3′CTCGCAGGGATAGGGGCATAATAGGTCAGGTTGG5′ 3′
CAGGTGGAGTCG5′s(1) ACGTTCGAACCGTGA5′s(1) 3′ CTCGCAGGGATAGGGGCATAATAGGTCAGGTTGG5′s(1) 3′
τ/nsb 440 400 500 430 570 500 540 660 470 580
See note 8. b All decays where (1) was bound to nucleic acid were observed to be nonexponential.
resolution,7 but when calf thymus DNA is present, transient emission is detected, with nonexponential decay consistent with that previously reported.3(b) Significantly, when ss oligonucleotides are present in a 1:1 ratio with (1), emissions with nonexponential decays are also observed, the nearest exponential fits yielding average lifetimes8 (Table 1) comparable to that seen with ds DNA. (For the range of oligos investigated so far, there is evidence of sequence dependence in the lifetimes, but much more extensive measurements will be necessary to explore this point fully.) Of additional significance is the fact that similar decay lifetimes were recorded for the tethered counterparts. For example, as Table 1 shows, the average MLCT state lifetimes of (1) in the presence of untethered and tethered 15-mer ss oligonucleotide were 500 and 470 ns respectively, whereas for a ss 34-mer, the corresponding values were 540 and 580 ns. Steady-state luminescence spectra recorded for (1) in the presence of ds DNA, or ss oligo, (both tethered and untethered in the latter case), showed comparable luminescence intensities. As an example, the spectral profiles recorded in the case of untethered and tethered 12-mer oligo are displayed in Figure 1(a). Further studies confirmed that at the typically high [phosphate]:[Ru] ratios used (e.g., 20:1 for ds DNA), where extensive binding9(b) of the complex to the nucleic acid can be expected, comparable enhancement of the luminescence from (1) was observed with ss or ds DNA at the various salt concentrations tested between 0 and 100 mM. Throughout all the studies presented, steady-state, kinetics and Raman, care was taken to ensure that the excitation geometry and solution conditions were maintained constant because the primary aim was to conduct internally consistent comparatiVe studies of the interactions of (1) with ss and ds DNA. For example, the presence or absence of a linker is the operational variable in the experiments which investigated the effect of tethering. At salt concentrations greatly in excess of 100 mM, there was evidence of a reduction in steady-state luminescence enhancement, suggesting some expulsion of (1) from DNA under these conditions, occurring slightly more readily for ss than for ds material. In parallel to this observation, temperaturedependent luminescence studies indicated more ready expulsion of the complex from ss than from ds DNA as temperature is increased. To explore any relationship between the luminescence enhancement of (1) and the length of the ss DNA, a series of short oligos, ranging from 3 to 10 bases (in 1:1 mixtures with (1), 5µM), were investigated by luminescence lifetime and steady-state luminescence measurements. Table 2 shows the lifetime of the luminescence of (1) as the strand length is increased from 3 to 10 bases. In the presence of shorter oligos, containing 3-5 bases, (in 1:1 mixtures with (1), at 5µM), some enhancement of luminescence compared to the complex alone is still observed but the lifetimes are notably shorter. Table 2 shows that a step increase in lifetime occurs, from ∼33 ns for
Figure 1. Steady-state luminescence spectra of (1), (a) either in 1:1 mixture or tethered to 5′ end of 12-mer oligonucleotidesC (see Table 1 for oligo labels); (b) in 1:1 mixture with series of short oligonucleotides, (sequences given in Table 2). Excitation λ 354.7 nm, 8 mJ/ pulse, [complex] ) 5µM. (Insetsplot of steady-state luminescence intensity at 600 nm vs oligo length).
732 J. Phys. Chem. B, Vol. 105, No. 3, 2001
Coates et al.
TABLE 2: Average Luminescence Lifetimesa of (1) in 1:1 Mixture with a Series of Short ss Oligonucleotides oligo length 3-mer 4-mer 5-mer 6-mer 7-mer 8-mer 9-mer 10-mer
sequence 3′
ATG5′
3′GATG5′ 3′
CGATG5′
3′ACGATG5′ 3′
CACGATG5′
3′TCACGATG5′ 3′
GTCACGATG5′
3′AGTCACGATG5′
average lifetime/nsb 37 26 33 270 509 473 515 493
a
See note 8. b Nonexponential decays were observed for 6 to 10mer oligonucleotides. Signal intensities of the 3, 4, and 5-mer decays (relative to the laser scatter) were insufficient to confidently confirm the profile of decay.
the 5-mer to 270 ns for the 6-mer, followed by a further significant increase to ∼500 ns in the case of the 7-mer. Qualitatively in parallel with the lifetime data, Figure 1b shows steady state luminescence spectra for a series of oligos, from which it is evident that a pronounced increase in relative intensity of luminescence occurs for oligos with > 5 bases, particularly in going from 6 to 7 bases. As a further pointer to the extent of interaction of (1) with ss DNA, UV-vis absorption spectra were recorded. Figure 2(a) shows the results for a 1:1 mixture of (1) with 15-mer oligo, trace (ii), and also for (1) tethered to an oligo with the same sequence of bases, (trace (iii)). The absorption band at ∼370 nm, due to π-π* intraligand transitions of the dppz ligand of the complex, shifted to the red and decreased in intensity to an extent similar to that previously reported for ds calf thymus DNA.9,10 Figure 2b shows a series of UV-vis spectra recorded for 5µM solutions of several short oligos in 1:1 mixtures with (1), from which it appears that, for oligos with 3-5 bases, minor perturbation of the intraligand dppz absorption is induced but a more marked change becomes evident on going to a 6-base oligo. Spectral subtractions reveal that no significant further change to the absorption band occurs upon addition of further bases to the strand. Transient resonance Raman experiments7 were used to probe the perturbations to the excited state transitions of the lowest MLCT state, (formally11 expressed as RuIII(phen)2dppz.-), of the complex due to interactions with oligonucleotide. Figure 3 shows TR2 spectra excited at 354.7 nm of (1) in aqueous solution (trace a) and in the presence of 12-mer ss oligonucleotide (in 1:1 ratio, trace b). It is clear in the latter case that several vibrational features attributable7 to the dppz.- entity, e.g., those at 1366 and 1312 cm-1, exhibit a significant reduction in intensity relative to neighboring bands assignable7,12 to the phenanthroline ancillary ligands, notably that at 1455 cm-1. Subtraction of the spectrum recorded in aqueous solution from that recorded in the presence of oligonucleotide shows (trace c) not only vibrations of the ancillary neutral phen, but also, prominently, a 1526 cm-1 feature attributable to dppz.-. Similar effects were observed in the spectra of (1) in the presence of other ss oligonucleotides of different sequence and length (e.g., Figure 4). By contrast, the TR2 spectra in Figure 3 (trace e), recorded for the complex tethered to the 5′ end of the 12-mer strand, show a much less marked decrease in the intensity of the principal vibrational features. Significantly, however, subtraction of the spectra (trace f), again reveals a 1526 cm-1 dppz.feature, as in the case of the untethered complex. Figure 5 shows a series of transient RR spectra generated for (1) in 1:1 mixture with the series of short oligos, containing from 3 to 10 bases. It is evident that the spectra corresponding to the shortest oligos, with strands containing 3 to 5 bases, are very similar to that of the free complex in aqueous solution. However, in the presence of oligos containing 6 or more bases,
Figure 2. UV-vis absorption spectra of (1), (a) (i) free in aqueous solution, (ii) in 1:1 mixture with 15-mer oligonucleotidesE, (iii) tethered to 5′ end of 15-mer oligonucleotidesE; (b) in 1:1 mixture with series of short oligonucleotides (sequences given in Table 2), and with CT DNA. [complex] ) 5µM.
a marked depletion of the dppz.- features at 1312 and 1366 cm-1 occurs, becoming more pronounced as chain length is increased. This change is represented in Figure 5 (inset), as a plot of the 1366/1455 cm-1 intensity ratio against oligo length. It is evident that the largest decrease in the relative intensity of the 1366 cm-1 feature occurs on going from 5 to 6 bases. Discussion On the basis of the evidence from the luminescence spectra of (1) in Figures 1 and 2 and the accompanying lifetime data (Table 1), where comparable emission intensities and lifetimes are observed in the presence of tethered or untethered oligonucleotide, but the intensity is negligible in their absence, it appears that (1) can function as a “light-switch” reporter for ss material, just as for duplex DNA. Indeed, the UV-vis spectra of the complex in the presence of ss 15-mer (Figure 2) display a degree of perturbation to the absorption band at ∼370 nm,
Interaction of [Ru(phen)2(dppz)]2+ with ss DNA
J. Phys. Chem. B, Vol. 105, No. 3, 2001 733
Figure 3. Transient resonance Raman spectra of (1) (a) and (d) in H2O, (b) [Ru] : 12-mer oligonucleotide (C) ratio of 1:1, (e) (1) tethered to 12-mer oligonucleotidesC. (c) and (f) are subtraction spectra scaled for the removal of the 1366 cm-1 excited-state feature. All spectra were recorded at 354.7 nm excitation, 3mJ/pulse, [complex] ) 134 µM.
Figure 4. Transient resonance Raman spectra of (1) (a) and (d) in H2O, (b) [Ru] : 15-mer oligonucleotide (E) ratio of 1:1, (e) (1) tethered to 15-mer oligonucleotides E. (c) and (f) are subtraction spectra scaled for the removal of the 1366 cm-1 excited-state feature. All spectra were recorded at 354.7 nm excitation, 3mJ/pulse, [complex] ) 134µM.
due to π-π* intraligand transitions of the dppz ligand of the complex, which is very similar to that observed for the complex upon interaction with ds DNA. In the latter instance, this perturbation is indicative9 of the intercalative interaction of the π-system of the extended aromatic framework of dppz with the
π-stacked bases of the nucleic acid. The present results suggest a similar “depth” of interaction with the π-stacked bases of the oligonucleotide, sufficient to perturb the π-π* transitions of the dppz ligand.9 Other instances where an intercalative interaction has been invoked in the case of ss nucleic acids include
734 J. Phys. Chem. B, Vol. 105, No. 3, 2001
Figure 5. Transient resonance Raman spectra of (1) in 1:1 mixture with series of short oligonucleotides (sequences given in Table 2) and with CT DNA. All spectra were recorded at 354.7 nm excitation, 3mJ/ pulse, [complex] ) 134 µM.
that of porphyrins in the presence of the single-stranded poly(dA), where hypochromicity and red-shifting of the Soret band have been interpreted4 in terms of a pseudo-intercalative interaction with the ss polymer, proposed to be extensively stacked at room temperature. The question arises as to the degree of interaction between (1) and the single-stranded oligos and in further consideration of this question, we turn to the results of the transient resonance Raman measurements. Previous studies have established the utility of the TR2 technique for studying the interactions of the MLCT excited states of both [Ru(phen)2dppz]2+ and [Ru(bpy)2dppz]2+ (bpy ) 2,2′-bipyridyl) with calf thymus DNA.7 Spectra recorded using 354.7 nm excitation showed that (a) in the presence of CT DNA, the intensities of several features assignable to the dppz.- entity of the state decreased with respect to bands of the ancillary (phen) ligands, and (b) subtraction of the spectrum recorded in buffer from that recorded in the presence of DNA yielded a spectrum consisting mainly of neutral ligand vibrations, but also containing a prominent feature at 1526 cm-1. Observation (a) was attributed7 to perturbation of the π*-π* transitions of dppz.- due to π-stacking of the ligand within the base pairs of DNA. Observation (b) in the same DNA environment of the prominent feature at 1526 cm-1 was attributed7 to resonance with a transition of dppz.- which is distinct from the dppz.- transitions enhanced in aqueous media alone. This feature at 1526 cm-1 also appeared prominently in the TR2 spectrum recorded of (1) in acetonitrile. Because complex (1) is emissive in the latter environment as well, with the same triplet MLCT state involved as in DNA and implicated in the light-switch mechanism proposed1 by Barbara et al., we are led to the conclusion that the 1526 cm-1 feature is in itself a ‘marker’ band or signature for the light-switch effect. Picosecond timeresolved RR studies which we have recently carried out on (1) in water13,14 do in fact show that the 1526 cm-1 feature appears at very short pump-probe delay times (ca. 5 ps) in this case also, in line with the proposal1 that the initially generated MLCT excited state in water is identical to the predominant long-lived state in pure acetonitrile and DNA. The observations established for ds DNA are paralleled in the findings reported here (Figures 3-5) for (1) in the presence
Coates et al. of ss oligonucleotides, enabling similar conclusions to be drawn. Thus, for example, the significant reduction in intensity of dppz.- features relative to neighboring ancillary phen bands (e.g., 1455 cm-1), as shown above, is indicative of a degree of interaction of the dppz ligand with the π-stacked bases of the ss DNA, comparable to that observed with ds DNA. Reinforcing the proposal that the 1526 cm-1 feature is a signature band for the light-switch effect, its appearance in the subtracted spectra of dppz.- (see Figure 3) is consistent with the markedly enhanced luminescence in the presence of the ss material. However, an additional, highly significant point emerges in the present work, as can be seen from Figure 3. Although a 1526 cm-1 feature appears in the TR2 spectra of (1) for both tethered and untethered oligonucleotide, it is only in the untethered case that a noticeable intensity reduction of other dppz.- bands occurs, pointing to a more marked extent of interaction of the dppz with oligo bases in the latter case than in the former. Tethering evidently has the effect of restricting the interaction of the dppz ligand with the π-stacked bases of the oligonucleotide. This observation also provides confirmatory evidence that although a higher concentration was necessary for the TR2 experiments, compared to the earlier luminescence studies, the findings may be accounted for in terms of intramolecular interactions within the tethered complex. Despite this, the fact that the 1526 cm-1 marker band for the light switch effect still appears in this case suggests that conditions for occurrence of the light-switch phenomenon continue to prevail, consistent with the luminescence measurements. It therefore seems, from this comparative study of the tethered and untethered systems, that full “intercalation” of the dppz ligand between the bases may not be a necessary requirement for operation of the light-switch effect. It is possible that the functioning of the light-switch mechanism is more dependent on structure in the strand, than on “intercalation” as such. Thus, the protection of the dppz ligand from water, afforded through shielding by the helical structure and ancillary phenanthroline ligands combined, may be sufficient to induce the light switch mechanism, and that deep insertion of the phenazine nitrogens of the dppz ligand between the stacked bases of the strand is not a necessity for the effect to be observed. It is interesting to examine the results (Table 2 and Figures 1b, 2b, and 5, above) of the studies performed on (1) in the presence of a series of short oligos of increasing length, from 3 to 10 bases. Consideration of luminescence lifetime, steadystate luminescence, UV-vis and transient RR studies indicates that both the degree of interaction and the level of luminescence enhancement are sensitive to the oligo length over this range. The most pronounced electronic perturbation (as judged from UV-vis and RR results on this series) due to intercalation of the dppz ligand between stacked bases of the strand appears to occur between 5 and 6 bases. Very short strands, 3 to 5 bases, clearly do not significantly influence the intraligand transition of the dppz ligand through π-stacking. However, some degree of protection of the dppz ligand appears to operate even when bound to these very short oligos because measurable luminescence decay still occurs. Furthermore, steady state and timeresolved luminescence measurements indicate that there is a marked increase in the degree of luminescence enhancement not only in going from 5 to 6 bases, but also from 6 to 7 bases. It is reasonable to suggest that the enhancement is being facilitated through a combination of both intercalative-type protection and some sort of “structural shielding” of the dppz ligand. With regard to the latter effect, as the number of bases exceeds 5, and more so 6, the degree of secondary structure is apparently sufficient to form a protective “cavity” from the aqueous environment, with the environmentally sensitive dppz.ligand sandwiched within this structure and additional shielding
Interaction of [Ru(phen)2(dppz)]2+ with ss DNA being afforded by the ancillary ligands. It is worth remarking that the general sigmoidal profile of the graphs generated for instance in the case of steady state luminescence experiments (Figure 1a), can more reasonably be related to the fact that the length of a short DNA strand is being increased, than merely to an increase in [DNA-Phosphate]/[Ru] ratio. The latter would be expected to give rise to the characteristic titration curves for binding, as, for example reported9(a) previously for longer double-strands, to which a McGhee/Von Hippel binding algorithm may be applied. The essential point here is that in the case of the short strands, addition of further bases is likely to be associated with the development of secondary structure, whereas in luminescence titrations with long double strands, the profiles reflect the competition for the ligand binding sites within the existing secondary structure. Evidently, tethering the complex to the longer ss oligos by a flexible methylene chain in the manner described6 is enough to curtail the extent to which the ligand may intercalate between the bases of the strand, but not enough to cause withdrawal of the complex from the confines of the protective helical structure. Thus, the luminescence remains largely unimpaired. At this point, it is worthwhile drawing attention to the previously reported investigation of the ∆ and Λ enantiomers of (1) with calf thymus ds DNA.7 Transient RR studies at 354.7 nm reflected previous luminescence observations in determining that the degree of “light-switch” enhancement is sensitive to the chirality of the complex, a stronger 1526 cm-1 feature being recorded7 for ∆ than for Λ, in agreement with the greater degree of enhancement for this enantiomer. This observation may be readily correlated with the present investigation in proposing that the Λ enantiomer interacting with ds DNA does so in such a restricted orientation as to afford less protection to the intercalated dppz ligand by the ancillary phen ligands. Thus, even in a situation where double-helical structure is present, enantiomeric restraints have “opened” the protective cavity to a degree, enabling more ready access of water to the dppz ligand contained within. The degree of protection offered by this combination of structural and intercalative effects may be directly correlated with the recent proposal for the light-switch mechanism1, wherein shielding of the reduced dppz.- ligand of the lowest excited charge-transfer state of (1) from the polar aqueous environment is considered to result in the more strongly emitting triplet MLCT state becoming favored.
J. Phys. Chem. B, Vol. 105, No. 3, 2001 735 studentship. We wish to thank Dr Clarke Stevenson for supplying the synthetic oligonucleotides. References and Notes (1) Olson, E. J. C.; Hu, D.; Hoermann, A.; Jonkman, A. M.; Arkin, M. R.; Stemp, E. D. A.; Barton, J. K.; Barbara, P. F. J. Am. Chem. Soc. 1997, 119, 11 458. (2) Nair, R. B.; Cullen, B. M.; Murphy, C. J. Inorg. Chem. 1997, 36, 962. (3) (a) Friedman, A. E.; Chambron, J.-C.; Sauvage, J.-P.; Turro, N. J.; Barton, J. K. J. Am. Chem. Soc. 1990, 112, 4960. (b) Jenkins, Y.; Friedman, A. E.; Turro, N. J.; Barton, J. K. Biochemistry 1992, 31, 10 809. (4) Pasternack, R. F.; Brigandi, R. A.; Abrams, M. J.; Williams, A. P.; Gibbs, E. J. Inorg. Chem. 1990, 29, 4483. (5) Jenkins, Y.; Barton, J. K. J. Am. Chem. Soc. 1992, 114, 8736. (6) (a) Meggers, E.; Kusch, D.; Giese, B. HelV. Chim. Acta 1997, 80, 640. (b)
(7) Coates, C. G.; Jacquet, L.; McGarvey, J. J.; Bell, S. E. J.; Al-Obaidi, A. H. R.; Kelly, J. M. J. Am. Chem. Soc. 1997, 119, 7130. (8) Although the decays are clearly nonexponential, a complete analysis using a multiexponential fitting program is not presented here. For this comparative study, where the primary aim was to examine the relative degree of luminescence enhancement, a nearest exponential fit of each trace was considered to be sufficient. (9) (a) Hiort, C. H.; Lincoln, P.; Norden, B. J. Am. Chem. Soc. 1993, 115, 3448. (b) Haq, I.; Lincoln, P.; Suh, D.; Norden, B.; Chowdhry, B. Z.; Chaires, J. B. J. Am. Chem. Soc. 1995, 117, 4788. (10) The shifts observed for the tethered complex are analogous to, but less pronounced than, the untethered case. The precise extent of the band shift is obscured by the appearance of additional absorption to the blue, presumably associated with the tethering arm. (11) McGarvey, J. J.; Callaghan, P.; Coates, C. G.; Schoonover, J. R.; Kelly, J. M.; Jacquet, L.; Gordon, K. C. J. Phys. Chem. B 1998, 102, 5941. Schoonover, J. R.; Bates, W. D.; Meyer, T. J. Inorg. Chem. 1995, 34, 6421. (12) Coates, C. G.; Callaghan, P.; McGarvey, J. J.; Kelly, J. M.; Kruger, P. E.; Higgins, M. E. J Raman Spectrosc. 2000, 31, 283. (13) The spectra below were recorded following excitation with a laser pulse of 3 ps duration. The 1526 cm-1 feature becomes more evident upon subtraction of the spectrum at longer pump-probe delays (e.g., 50 ps) from that at short delays (e 3ps). The high S:N quality spectra shown are unsmoothed.
Conclusion The experiments reported in the present work show that the complex [Ru(phen)2dppz]2+ exhibits luminescence enhancement and interaction with ss DNA comparable to that observed with ds DNA. The incorporation of tethering from the oligo terminus to the complex, via a flexible chain to one of the ancillary phen ligands, restricts the extent to which the dppz ligand intercalates within the stacked bases of the strand but does not inhibit the light switch effect. This observation, supplemented by spectroscopic studies on the interaction of complex with a series of very short oligos suggests the importance of other forms of protection, such as enclosure within the helical structure, in conjunction with the shielding ancillary ligands, in creating a “protective cavity” for the dppz.- entity, thus providing the necessary stabilization for the emitting 3MLCT state involved in the light switch mechanism. Acknowledgment. We thank the EPSRC for support of this research (Grant No. GR/M45696). PC thanks DENI for a
(14) In addition to water, extensive studies have been carried out in acetonitrile, water/acetonitrile mixtures, and methanol, which enabled the kinetic progression to be traced through the excited states involved in decay of the complex back to ground state. Coates, C. G.; McGarvey, J. J.; Tuite, E.; Norden, B.; Parker, A. W.; Matousek, P., manuscript in preparation.
