Screening of Single-Stranded DNA (ssDNA) Aptamers against a

Dec 8, 2014 - E-mail: [email protected]., *Telephone: +86-2134206003. ... by the biotin–streptavidin–horseradish peroxidase system. ... Kissing C...
10 downloads 0 Views 651KB Size
Download PDF
Article pubs.acs.org/JAFC

Screening of Single-Stranded DNA (ssDNA) Aptamers against a Zearalenone Monoclonal Antibody and Development of a ssDNABased Enzyme-Linked Oligonucleotide Assay for Determination of Zearalenone in Corn Yuan-Kai Wang,†,‡ Qi Zou,†,‡ Jian-He Sun,*,‡ Heng-an Wang,‡ Xingmin Sun,§ Zhi-Fei Chen,∥ and Ya-Xian Yan*,‡ ‡

Shanghai Key Laboratory of Veterinary Biotechnology, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai 200240, People’s Republic of China § Department of Infectious Disease and Global Health, Tufts University, Cummings School of Veterinary Medicine, 200 Westboro Road, North Grafton, Massachusetts 01536, United States ∥ Shanghai Entry-Exit Inspection and Quarantine Bureau, Shanghai 200135, People’s Republic of China S Supporting Information *

ABSTRACT: A hypotoxic immunosorbent assay for the detection of zearalenone (ZEN) was developed, by identifying a singlestranded DNA (ssDNA) aptamer with high specificity and affinity for a ZEN monoclonal antibody (mAb-ZEN). ssDNA aptamers, which could mimic ZEN epitopes, were identified using the modified systematic evolution of ligands by an exponential enrichment (SELEX) technique. The purified mAb-ZEN was coated on microtiter plates as a target recognized by the random oligonucleotide ssDNA library. The binding affinity between the aptamers and mAb-ZEN during each round was measured by the biotin−streptavidin−horseradish peroxidase system. During 15 rounds of screening, an increasing binding affinity was observed. The enriched ssDNA library binding to mAb-ZEN with high affinity was cloned, sequenced, and analyzed. One aptamer (number 46), which displays the highest affinity and specificity for the mAb-ZEN, was used to establish an indirect competition enzyme-linked oligonucleotide assay (ELONA) to measure the ZEN concentration in corn. Under optimal conditions, the regression equation for quantification of ZEN was y = −0.0778x + 0.713 (R2 = 0.9981). The detection limit and IC50 were 0.01 and 0.2 ng/mL, respectively, with a working range of 0.03−2.5 ng/mL. The recovery rates of the spiked samples in the ELONA ranged from 95 to 105%. Aptamers, which can mimic many types of low-weight analytes in agricultural products, could serve as surrogates for the development of hypotoxic, environmentally friendly immunological detection methods. KEYWORDS: aptamer, zearalenone, monoclonal antibody, affinity, ELONA

■

INTRODUCTION Zearalenone (ZEN) is a secondary metabolite produced by fungi belonging to the genus Fusarium, including Fusarium graminearum and Fusarium roseum, and a mycotoxin that contaminates various agricultural products worldwide.1,2 ZEN is estrogenic and carcinogenic, causes DNA damage, and is reproductively toxic to humans and animals.3 Infants and children are reported more vulnerable to the effects of ZEN than adults.4 To decrease the incidence of ZEN-based toxicity in infants and children, the European Commission regulations specify a maximum ZEN level of 20 μg/kg in cereal-based foods manufactured for consumption by children.5 This upper limit is considerably lower than the maximum amount permitted in cereals (100 μg/kg) for adults. The need for more stringent limits of ZEN levels in the foods of infants and young children has necessitated more sensitive measures. To this end, highly sensitive, rapid, and simple methods to monitor the ZEN content in food and feed products have been recently developed. Currently, low-molecular-weight analytes (both free and conjugates) are widely used in quantitative chromatographic and immunologic assays to detect mycotoxin in agriculture © 2014 American Chemical Society

commodities for production of food and feed products. However, some low-molecular-weight analytes are quite toxic (such as pesticides and mycotoxins), and the use of an analyte and/or it is conjugate in an assay may be harmful to the operator and/or environment. Furthermore, analytes are expensive to produce, and the efficiency of chemical conjugation between low-molecular-weight analytes and a carrier, such as a protein or enzyme, is low.6 To improve the analytical methods, anti-idiotypic antibodies7 and phagedisplayed peptides8 have been developed to mimic antigenic epitopes on analyte surfaces. However, screening of antiidiotypic antibodies is costly and time-consuming. In addition, phage-displayed peptides can fail because of their inherent cytotoxicity. The systematic evolution of ligands by exponential enrichment (SELEX) technology was developed in the 1990s9 to generate highly specific nucleic acid sequences (aptamers) with high affinity for various ligands. Recently, aptamers have Received: Revised: Accepted: Published: 136

August 6, 2014 December 4, 2014 December 8, 2014 December 8, 2014 dx.doi.org/10.1021/jf503733g | J. Agric. Food Chem. 2015, 63, 136−141

Journal of Agricultural and Food Chemistry

Article

buffer (pH 7.4, containing 20 mM Tris−HCl, 100 mM NaCl, 5 mM KCl, 1 mM CaCl2, and 2 mM MgCl2), denatured at 94 °C for 10 min, and immediately cooled on ice for 10 min, followed by incubation at room temperature for 10 min. The denatured 100 μL ssDNA pool solution was added to blank wells coated with 3% BSA only as a negative control and incubated at 37 °C for 1 h to remove residual ssDNA bound to the BSA. Then, 100 μL of the counter BSA-treated ssDNA solution was added to the antibody mixture wells and incubated at 37 °C for 1 h to further subtract the residual ssDNA bound to the three antibodies (mAb-FB1, mAb-AFB1, and mAbDON) as a second counter selection to increase the specificity and affinity of the selected ssDNA pool. Thereafter, the counter BSA and three antibody-selected ssDNA solution was moved to the mAb-ZENcoated wells and incubated at 37 °C for 1 h. After washing with washing buffer (0.02−0.05% Tween in binding buffer) 5 times to remove unbound ssDNA, 100 μL of elution buffer (20 mM Tris-HCl, 4 M guanidine thiocyanate, and 1 mM dithiothreitol) was added to the wells and the plates were incubated at 80 °C for 10 min to dissociate the ssDNA from the antibodies. The eluted ssDNA was extracted using phenol/chloroform/isoamyl alcohol and precipitated with ethanol. Finally, the selected ssDNA was dissolved in 20 μL of TE buffer (10 mM Tris-HCl and 1 mM ethylenediaminetetraacetic acid at pH 8.0) and stored at −20 °C for future use. To improve the specificity and affinity of the selected ssDNA pool, the amounts of ssDNA and mAb-ZEN, incubation time of the ssDNA with the target IgG, and Tween concentration in the washing buffer were changed in subsequent selection rounds, as shown in Supplementary Table 1 of the Supporting Information. Optimization of Symmetry and Asymmetry Polymerase Chain Reaction (PCR). To enrich the eluted ssDNA pool of each round of selection, dsDNA was generated by PCR in 25 μL reactions consisting of 12.5 μL of 2× EasyTaq PCR MasterMix, 1.0 μL of eluted ssDNA as a template, 1.0 μL of forward primer (biotin-P1), 1.0 μL of reverse primer (P2), and 9.5 μL of deionized water. Amplification consisted of a pre-denaturation cycle at 94 °C for 5 min, followed by denaturation at 94 °C for 30 s, annealing at 50 °C for 30 s, and extension at 72 °C for 20 s. One sample was taken out at each 5, 8, 12, 16, 20, and 25 cycle for amplification analysis. All remaining samples underwent a final extension cycle at 72 °C for 2 min. The PCR products were then separated by 12% PAGE and stained with silver nitrate.19 After generation of the dsDNA via symmetry PCR, asymmetry PCR was employed to produce a sufficient amount of ssDNA for affinity assays. The asymmetry PCR was performed in a 25 μL reaction volume consisting of 12.5 μL of 2× EasyTaq PCR MasterMix, 1.0 μL of dsDNA as a template, 1.0 μL of forward primer (biotin-P1), 1.0 μL of reverse primer (P2), and 9.5 μL of deionized water. To optimize the yield of ssDNA, the ratios of forward and reverse primers were tested at 1:0, 10:1, 30:1, 50:1, 80:1, and 100:1. The amplification conditions for the asymmetry PCR were performed as described above for the symmetry PCR. All PCR samples were separated on denaturing 8% PAGE containing 7 M urea, and the ssDNA band was extracted from the gel using the UNIQ-10 spin column DNA gel extraction kit as described in the manual. Purified ssDNA was stored at −20 °C until use in the ELONA to determine the optical density (OD) in 450 nm. OD Values in ELONA and Specificity Assay of ssDNA in Each Screening Round. Each well of the microtiter plate was coated with 100 μL (1 μg/mL) of mAb-ZEN and incubated at 4 °C overnight. After washing with PBST 3 times, the coated wells were blocked with 3% BSA. Then, 50 μL of biotinylated ssDNA aptamer (100 pM), which was generated in the asymmetry PCR assay, was mixed with 50 μL of binding buffer, added to the antibody-coated wells, and incubated at 37 °C for 1 h. After washing, 100 μL of 1 μg/mL HRPconjugated streptavidin was added to the wells and the plate was incubated at 37 °C for 1 h. After washing 3 times, 100 μL of substrate solution [3,3′,5,5′-tetramethylbenzidine (TMB)] was added to the wells and the plates were incubated at 37 °C for 10 min. Finally, 50 μL of 2 M H2SO4 was added to stop the reaction, and the absorbance of the wells was determined using a microplate reader at 450 nm. The ELONA was performed in triplicate.

been widely used in diagnosis, detection, and chemical analysis of various substances, such as thrombin,10 Mycobacterium tuberculosis,11 and cocaine.12 Aptamers have also been employed to mimic antibodies for detection of mycotoxins, such as ochratoxin A,13,14 fumonisin B1 (FB1),15 and ZEN.16 In light of less expensive screening procedures, aptamers can now be used to mimic analytes and are more suitable than phagedisplayed peptides and anti-idiotypic antibodies for hypotoxic analysis. To date, however, there have been no studies to develop aptamers as specific binding antibodies for the detection of low-molecular-weight analytes in agricultural products. In this study, we identified and charactierzed a single-stranded DNA (ssDNA) aptamer, which recognizes a monoclonal antibody against ZEN with high specificity and affinity. A hypotoxic immunoassay to detect ZEN was developed using this ssDNA aptamer to replace the ZEN conjugation, thereby avoiding environmental and operator exposure to toxin. Multiple low-molecular-weight analytes can be analyzed simultaneously using aptamers and an enzymelinked oligonucleotide assay (ELONA) in the future, which offers several advantages over other methods, such as high sensitivity, rapidity, and safety.

■

MATERIALS AND METHODS

Materials. ZEN and FB1 were purchased from Sigma Chemical (St. Louis, MO). Monoclonal antibodies (mAb) against ZEN (2C9, mAb-ZEN) and FB1 (6H3, mAb-FB1) were generated in our laboratory.17,18 Aflatoxin B1 (AFB1), deoxynivalenol (DON), and mAbs against DON (mAb-DON) or AFB1 (mAb-AFB1) were obtained from Huaan Megnech (Beijing, China). EasyTaq PCR MasterMix and a 50 base pair (bp) DNA ladder were purchased from CWbio (Beijing, China). A 20 bp DNA ladder was purchased from Thermo Scientific (Bremen, Germany). A UNIQ-10 column polyacrylamide gel electrophoresis (PAGE) gel extraction kit was purchased from Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). Dynabeads M-280 streptavidin was purchased from Invitrogen (Grand Island, NY). Horseradish peroxidase (HRP)-conjugated streptavidin was purchased from AnaSpec (Fremont, CA), and the pMD18-T vector was purchased from TaKaRa Bio, Inc. (Tokyo, Japan). A plasmid extraction kit was purchased from Omega Bio-Tek (Norcross, GA). A random ssDNA library with strands of an overall length of 71 nucleotides (nt) containing a 35 nt random sequence flanked by two 18 nt constant sequences (5′-CGGAATTCTTGATGTTGC-[35 nt]-CAACTTAGTAGGATCCCG-3′), a forward primer (P1, 5′-CGGAATTCTTGATGTTGC-3′), a reverse primer (P2, 5′-CGGGATCCTACTAAGTTG-3′), and a biotin-labeled forward primer (biotin-P1, 5′-biotin-CGGAATTCTTGATGTTGC3′) used for amplification of double-stranded DNA (dsDNA) were synthesized by Sangon Biotech (Shanghai, China). The ZEN-free corn samples were provided by the Shanghai Entry−Exit Inspection and Quarantine Bureau (Shanghai, China). Equipment. A NanoDrop 1000 spectrophotometer and 37 °C incubator were purchased from Thermo Scientific (Bremen, Germany); microtiter plates were purchased from Greiner Bio-One GmbH (Frickenhausen, Germany); and a microplate reader was purchased from BioTek Instruments, Inc. (Winooski, VT). SELEX Screening Procedure. The purified anti-ZEN mAb (mAbZEN) was diluted to 10 μg/mL with coating buffer (50 mM carbonate buffer at pH 9.6). Three antibodies (mAb-FB1, mAb-AFB1, and mAbDON) were mixed with equal concentrations and volumes and diluted to 10 μg/mL with coating buffer. Antibody solution (100 μL) was added to each microtiter plate well, followed by incubation at 4 °C overnight. The antigen-coated microtiter plate was washed 3 times with 10 mM phosphate-buffered saline (PBS) containing 0.05% Tween-20 (PBST) then blocked with 3% bovine serum albumin (BSA) at 37 °C for 2 h, followed by washing with PBST 3 times. The 20 μL original random ssDNA pool was dissolved in 500 μL of binding 137

dx.doi.org/10.1021/jf503733g | J. Agric. Food Chem. 2015, 63, 136−141

Journal of Agricultural and Food Chemistry

Article

Figure 1. Schematic illustration of ssDNA screening and ELONA. at 37 °C for 1 h. After washing with washing buffer 5 times, 100 μL of elution buffer was added to the wells and the plates were incubated at 80 °C for 10 min to dissociate the ssDNA from mAb-ZEN. The eluted ssDNA was quantified using a NanoDrop 1000 spectrophotometer. Each concentration of ssDNA was determined in triplicate. The data were analyzed by GraphPad Prism 5 to fit the nonlinear specific binding curve, and the equilibrium dissociation constant (Kd) was calculated. ELONA Development To Determine the ZEN Content. The ELONA was developed on the basis of the selected ssDNA aptamer, which had a relatively higher specificity and affinity. The concentrations of coating antibody, aptamer, and HRP-conjugated streptavidin were optimized by chessboard titration. The optimal ELONA contitions were as follows: a 100 μL aliquot of mAb-ZEN diluted to 1 μg/mL was added to each well of a microtiter plate and incubated at 4 °C overnight. After washing, 3% BSA was added to each well and the plate was incubated at 37 °C for 2 h. ZEN standard solutions (50 μL; 50, 10, 1, 0.1, 0.01, 0.001, 0.0001, and 0 ng/mL) were mixed with an equal volume of biotinylated ssDNA aptamer (100 pM). Each concentration of the standard was added to the plate in triplicate, which was incubated at 37 °C for 1 h and then washed 3 times. Afterward, 100 μL of HRP-conjugated streptavidin (1 μg/mL) was added to each well, and the plate was incubated at 37 °C for 1 h. After washing, 100 μL of TMB buffer was added to each well and the plate was incubated at 37 °C for 10 min. To stop the reaction, 50 μL of 2 M H2SO4 was added. The OD of the wells at 450 nm was recorded in a microplate reader. The standard curves were prepared using Origin 8.0 software (Northampton, MA). The log-transformed ZEN concentration was used as the x axis of the standard curve, and the y axis (B/B0) represents the OD value of the standard solutions divided by the OD value at 0 ng/mL. A schematic of ssDNA screening and the principle of ELONA is shown in Figure 1. Specificity Study of the ELONA. To evaluate the specificity of the ssDNA-based ELONA, cross-reactivity of other mycotoxins (AFB1, FB1, and deoxynivalenol) with the anti-ZEN mAb was

Preparation of a ssDNA Library Using Streptavidin-Coated Magnetic Beads. To yield a sufficient quantity of ssDNA for use as a seed pool in the next screening round, the selected ssDNA pool from each round of screening was used as a PCR template to generate dsDNA with primer pair biotin-P1 and P2 under the PCR reaction conditions as described above. Two strands of the PCR products were separated and the non-biotinlated ssDNA was recovered using streptavidin-coated magnetic beads. Briefly, the magnetic beads (100 μL containing about 6−7 × 107 Dynabeads) were separated from the storage buffer (PBS at pH 7.4 with 0.1% BSA and 0.02% sodium azide, v/v) in a magnetic field and washed 3 times with 2× binding and washing buffer (BW buffer, 10 mM Tris-HCl at pH 7.5 with 1 mM ethylenediaminetetraacetic acid and 2 M NaCl). A total of 200 μL of dsDNA was mixed with the magnetic beads and shaked gently for 20 min at room temperature. Then, the tube containing the mixture was placed under a magnetic field; the supernatant was removed; and the beads were washed 3 times in BW buffer. A total of 50 μL of 0.1 M NaOH was added to the tube containing beads and incubated at 37 °C for 30 min to uncoil the dsDNA. After the tube was placed in a magnetic field, non-biotinylated ssDNA was separated, while biotinylated ssDNA remained bound to the streptavidin beads. The supernatant containing the non-biotinylated ssDNA was recovered. Aptamer Sequence Analysis. After the final selection round, the eluted ssDNA aptamer was used as a template to generate dsDNA by PCR amplification. The purified dsDNA was cloned into the pMD18T. A total of 96 clones was randomly selected and sequenced by Sangon Biotech (Shanghai, China). The sequences were analyzed for homology and secondary structures using DNAMAN software (Lynnon Corporation, Pointe-Claire, Quebec, Canada). The clones with the correct sequences were used to prepare biotinylated ssDNA via asymmetry PCR amplification. The affinity and specificity of the ssDNA were also detected as described above. The binding of the selected ssDNA to mAB-ZEN was determined in a way similar to that used in the SELEX screening procedure. Briefly, the plate was coated with 100 μL per well of diluted mAb-ZEN and blocked with 3% BSA. Then, different concentrations of ssDNA aptamer (from 0 to 1000 nM) were added in the wells and incubated 138

dx.doi.org/10.1021/jf503733g | J. Agric. Food Chem. 2015, 63, 136−141

Journal of Agricultural and Food Chemistry

Article

determined using the following formula (IC50 indicates the 50% inhibiton):

cross‐reactivity (%) =

IC50 for ZEN × 100% IC50 for other mycotoxins

Recovery Study. The extracts of corn samples were prepared as described previously,20−25 and ZEN concentrations in the spiked samples were determined using a mAb-2C9-based enzyme-linked immunosorbent assay (ELISA)17 and ssDNA-based ELONA. ZENfree corn samples were ground and dried in a 60 °C incubator overnight. Standard ZEN solution was added to 10 g corn samples (1, 10, and 50 μg/kg for the ELONA and 50, 100, and 150 μg/kg for the ELISA) and allowed to incubate at room temperature overnight. Then, 40 mL of methanol/water (70:30, v/v) was added to each sample and shaken vigorously for 30 min at room temperature on a horizontal shaker. After an additional 10 min incubation period, the supernatant was centrifuged at 4000g for 20 min. For the 2C9-based ELISA, the supernatant was diluted 5-fold with 10 mM PBS, and for the ELONA, the supernatant was diluted 5-fold with binding buffer before analysis. Then, the extracts of the spiked samples were analyzed by ELISA and ELONA to determine the ZEN recovery rates. All spiked samples were analyzed in triplicate.

■

Figure 2. OD value of each round of ssDNA library screening using the biotin−streptavidin−HRP-based ELISA. The error bars indicate the interday standard deviation.

ssDNA, was predicted using DNAMAN software, and the results are also shown in Table 1. The putative secondary structures of these 10 aptamers were predicted using DNAMAN software and are shown in Supplementary Figure 3 of the Supporting Information. The main structure was a stem loop, which may bind antibody using this specific structure or through additional folding. Development of an ELONA To Determine the ZEN Content Based on the Selected Aptamer. On the basis of sequence structure, affinity, and specificity analyses in ELONA, aptamers 46, 54, and 72 were used to develop the ELONAs to determine the ZEN concentration in samples. Aptamer 46, which shows better sensitivity and detection limit, was chosen for further studies and optimization of the ELONA. The Kd between aptamer number 46 and mAb-ZEN was 50.5 ± 5.4 nM. The binding saturation curve is shown in Supplementary Figure 4 of the Supporting Information. The optimal concentrations of coating antibody and HRP-conjugated streptavidin were 1 and 3 μg/mL, respectively, and the optimal dilution ratio of the aptamers was 1:10 (100 pM). The standard curve of this ELONA is shown in Figure 3. The regression equation for ZEN quantification was y = −0.0778x + 0.713 (R2 = 0.9981). The detection limit and half maximal inhibitory concentration (IC50) were 0.01 and 0.2 ng/mL, respectively, with a working range of 0.03−2.5 ng/mL. The intra- and interday standard deviations were 7.6 and 9.3% (data not shown), respectively, which indicates that this method had good reproducibility. Moreover, there were no competitive combining abilities of AFB1, FB1, and DON with the anti-ZEN mAb (cross-reactivity < 0.01%) in the ELONA using ssDNA aptamer number 46. These results indicate that this method has good specificity for ZEN. Thus, the best aptamer should be considered with the comprehensive factors, such as Kd values, OD values in ELONA, free energy, and detection sensitivity. Recovery Rates of the ZEN Content in ELONA and ELISA. Previously, we showed that the limit of detection and IC50 are 0.051 and 1.9 ng/mL in ELISA, respectively.17 Thus, the sensitivity of the ELONA (0.01 and 0.2 ng/mL for detection limit and IC50, respectively) is greater than that of ELISA (Table 2). The 1, 10, and 50 μg/kg spiked corn samples were analyzed by ELONA, while 50, 100, and 150 μg/kg were determined by ELISA. As shown in Table 2, the recovery rates of the spiked samples in the ELONA ranged from 95 to 105%. Both the ELONA and ELISA could accurately detect ZEN

RESULTS AND DISCUSSION

Optimization of PCR Reaction Conditions. For the symmetry PCR, after 5, 8, 12, 16, 20, and 25 cycles of amplification, the dsDNA was analyzed by 12% PAGE. The results showed that, after 20 cycles, the yield of dsDNA reached a maximum and, after 25 cycles, the amount of non-specific DNA was greatest. Thus, 20 cycles were chosen for subsequent amplifications. Meanwhile, the annealing temperature (50−60 °C) had no effect on PCR amplification. For the asymmetry PCR, different ratios of forward and reverse primers (1:0, 10:1, 30:1, 50:1, 80:1, and 100:1) were evaluated to generate higher amounts of ssDNA. As shown in Supplementary Figure 1 of the Supporting Information, the optimal ratio of forward and reverse primers was 80:1, giving the highest yield of ssDNA. The cycles of the asymmetry PCR were also optimized, and 30−35 cycles were the optimal amplification cycles to produce the highest amount of specific ssDNA (see Supplementary Figure 2 of the Supporting Information). Selection of the ssDNA Aptamer Recognizing the Monoclonal Antibody. The affinity of each round of ssDNA for the anti-ZEN mAb was evaluated using a biotin− streptavidin−HRP-based ELISA. The OD values from rounds 1−15 are shown in Figure 2. The results indicate that affinity increased more than 5-fold after 15 rounds of screening, with OD values reaching a maximum after round 12. Aptamer Sequence Analysis, Affinity, and Specificity. After 15 rounds of selection, the enriched ssRNA pool was amplified by PCR and cloned into the pMD-18T vector. A total of 96 clones were selected for sequencing. Of these, 63 clones had a complete genome length of 71 nt covering a 35 nt random sequence flanked by two 18 nt constant sequences. Biotin-conjugated ssDNA aptamers were generated by asymmetric PCR using the 63 clones as templates. The affinities and specificities of 63 ssDNA aptarmers for mAb-ZEN as well as mAb-AFB1, mAb-FB1, and mAb-deoxynivalenol were determined by ELONAs using OD450 nm values as readouts. All 63 aptamers show no specific binding to mAb-AFB1, mAb-FB1, and mAb-deoxynivalenol (data not shown), and 10 ssDNA aptamers with higher affinity in ELONA are listed in Table 1. The free energy (ΔG), which indicates the stability of the 139

dx.doi.org/10.1021/jf503733g | J. Agric. Food Chem. 2015, 63, 136−141

Journal of Agricultural and Food Chemistry

Article

Table 1. Sequences, Free Energy, and Affinity of Selected Aptamers number

sequence (5′−3′)

free energy, ΔG (kcal/M)

OD at 450 nm

11 33 39 40 41 46 47 54 72 77

GGGATCCTACTAAGTTGACACAACAACCGAAATAACCTATACGCGCACACCAGCAACATCAAGAATTCCGAA GGGATCCTACTAAGTTGACAAGACACAACGCAGAGAAAGAAGCGTCGGAGGCAACATCAAGAATTCCGAA GGAATTCTTGATGTTGCAGCCTCCCGTAGTTTGCGTGTTTGTTGTGTGTGTGCAACTTAGTAGGATCCCGAA GGAATTCTTGATGTTGCTGGCTCGGCGGGTATTTCCAATGCGCGGGGGGTTTCAACTTAGTAGGATCCCGAA TTATTCTTGATGTTGCTCGACGACACACGCCTTATTTAGATGAAACTTCTGCAACTTAGTAGGATCCCGAA GGAATTCTTGATGTTGCCTGGGATTGTTTGGGCCTTGTGTTTTCTTCCGTTCCAACTTAGTAGGATCCCGAA GGAATTCTTGATGTTGCATTCTTGTACACCTCTCTCTGTGTCTCTCTTCTATCAACTTAGTAGGATCCCGAA GGGATCCTACTAAGTTGACAGCACCGGAATACACTCCACTCACGCGTCGACTGCAACATCAAGAATTCCGAA GGGATCCTACTAAGTTGGGAATAAAACTAACAAACGAACTCCGCTCAAGCCGGCAACATCAAGAATTCCGAA GGAATTCTTGATGTTGCATCTTGTGGCTTTTCTCTTTTTCGCGTCATATGGGCAACTTAGTAGGATCCCGAA

−2.85 −0.96 −2.45 −3.47 −0.60 −2.34 −0.99 −3.93 −5.30 −2.34

0.61 0.604 0.606 0.614 0.617 0.756 0.64 0.617 0.63 0.663

easier, less expensive, and less time-consuming than phagedisplayed peptides, and aptamers usually have greater specificity and affinity for their targets. In conclusion, in this study, ssDNA aptamers against ZEN mAb were selected and identified. Aptamer number 46, which had a lower ΔG and higher affinity, specificity, and sensitivity than other aptamers, was chosen as a ZEN substitute to develop an ELONA for determination of the ZEN content in corn. This ELONA is less expensive and has greater sensitivity than previous hypotoxic screening technologies. The sensitivity and stability may be improved further by new detection platforms and optimization. Other aptamer-based hypotoxic analytical methods, such as fluorescent strip sensors,14 electrochemical immunoassays, and chemiluminescence immunoassays could be developed in the future.

■

Figure 3. Standard curve of the DNA aptamer-based ELISA. The error bars indicate the interday standard deviation. The log-transformed ZEN concentration was used as the x axis of the standard curve, and the y axis (B/B0) represents the OD value of the standard solutions divided by the OD value at 0 ng/mL.

S Supporting Information *

product of asymmetric PCR with different ratios of forward and reverse primer (Supplementary Figure 1), product of different asymmetric PCR cycles (Supplementary Figure 2). secondary structure of the selected aptamers (Supplementary Figure 3), binding saturation curve of number 46 aptamer to a mAb-ZENcoated plate (Supplementary Figure 4), protocol of aptamer screening in different rounds (Supplementary Table 1), and comparison of high sensitivity and hypotoxic analytical methods for detection of ZEN (Supplementary Table 2). This material is available free of charge via the Internet at http://pubs.acs.org.

Table 2. Recovery Rates of Spiked Samples by ELONA and ELISA ELONA

ELISA

spiked (μg/kg)

found (μg/kg) (mean ± SDa)

recovery rate (%)

found (μg/kg) (mean ± SDa)

recovery rate (%)

1 10 50 100 150

0.97 ± 0.03 10.5 ± 0.42 47.7 ± 1.56 b b

97 105 95 b b

b b 48.4 ± 1.43 96.1 ± 3.56 137 ± 7.14

b b 97 96 91

a

ASSOCIATED CONTENT

■

AUTHOR INFORMATION

Corresponding Authors

SD = standard deviation (n = 3). bNot detected.

*Telephone: +86-2134206926. E-mail: [email protected]. *Telephone: +86-2134206003. E-mail: [email protected].

from the spiked samples and showed similar sensitivity in determining the ZEN content in the 50 μg/kg spiked sample. As shown in Supplementary Table 2 of the Supporting Information, many highly sensitive analytical methods have been proposed to detect mycotoxins in agricultural products. Because the ELONA is an easy, rapid, and hypotoxic method, it is a significant improvement in detecting mycotoxins compared to other highly sensitive methods, including electrochemical sensor, immunoassay, and surface plasmon resonance. In addition, the ssDNA aptamer method has several advantages over the phage-displayed peptide technology, which can also mimic an antigenic epitope in a hypotoxic method,8 including no requirement for bacterial transformation and protein expression.12,13 Preparation of ssDNA aptamers is relatively

Author Contributions †

Yuan-Kai Wang and Qi Zou contributed equally to this work.

Funding

This work was financially supported by the Chinese National Programs for High Technology Research and Development (2007AA10Z424). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors thank Dr. Diane Schmidt (Tufts University) for critical review of the manuscript. 140

dx.doi.org/10.1021/jf503733g | J. Agric. Food Chem. 2015, 63, 136−141

Journal of Agricultural and Food Chemistry

■

Article

zearalenone in baby food: An anticipated analytical tool for food safety. Anal. Chim. Acta 2009, 653, 167−172. (23) Wang, Y. K.; Yan, Y. X.; Mao, Z. W.; Wang, H. a.; Zou, Q.; Hao, Q. W.; Ji, W. H.; Sun, J. H. Highly sensitive electrochemical immunoassay for zearalenone in grain and grain-based food. Microchim. Acta 2013, 180, 187−193. (24) Wang, Y. K.; Yan, Y. X.; Ji, W. H.; Wang, H. A.; Zou, Q.; Sun, J. H. Novel chemiluminescence immunoassay for the determination of zearalenone in food samples using gold nanoparticles labeled with streptavidin−horseradish peroxidase. J. Agric. Food Chem. 2013, 61, 4250−4256. (25) Choi, S. W.; Chang, H. J.; Lee, N.; Kim, J. H.; Chun, H. S. Detection of mycoestrogen zearalenone by a molecularly imprinted polypyrrole-based surface plasmon resonance (SPR) sensor. J. Agric. Food Chem. 2009, 57, 1113−1118.

REFERENCES

(1) Placinta, C. M.; D’Mello, J. P. F.; Macdonald, A. M. C. A review of worldwide contamination of cereal grains and animal feed with Fusarium mycotoxins. Anim. Feed Sci. Technol. 1999, 78, 21−37. (2) Tanaka, K.; Sago, Y.; Zheng, Y.; Nakagawa, H.; Kushiro, M. Mycotoxins in rice. Int. J. Food Microbiol. 2007, 119, 59−66. (3) Kim, I. H.; Son, H. Y.; Cho, S. W.; Ha, C. S.; Kang, B. H. Zearalenone induces male germ cell apoptosis in rats. Toxicol. Lett. 2003, 138, 185−192. (4) European Food Safety Authority (EFSA).. Scientific opinion on the risks for public health related to the presence of zearalenone in food. EFSA J. 2011, 9, 2197−2321. (5) European Commission.. European Commission Regulation (EC) no. 856/2005 of 6th June 2005, amending Regulation (EC) no. 466/ 2001 as regards Fusarium toxins. Off. J. Eur. Union 2005, 143, 3−8. (6) Xiao, H.; Clarke, J. R.; Marquardt, R. R.; Frohlich, A. A. Improved methods for conjugating selected mycotoxins to carrier proteins and dextran for immunoassays. J. Agric. Food Chem. 1995, 43, 2092−2097. (7) Yu, F. Y.; Chu, F. S. Production and characterization of a monoclonal anti-anti-idiotype antibody against fumonisin B1. J. Agric. Food Chem. 1999, 47, 4815−4820. (8) He, Q. H.; Xu, Y.; Huang, Y. H.; Liu, R. R.; Huang, Z. B.; Li, Y. P. Phage-displayed peptides that mimic zearalenone and its application in immunoassay. Food Chem. 2011, 126, 1312−1315. (9) Ellington, A. D.; Szostak, J. W. In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818−822. (10) White, R.; Rusconi, C.; Scardino, E.; Wolberg, A.; Lawson, J.; Hoffman, M.; Sullenger, B. Generation of species cross-reactive aptamers using “Toggle” SELEX. Mol. Ther. 2001, 4, 567−573. (11) Chen, F.; Zhou, J.; Luo, F.; Mohammed, A.-B.; Zhang, X.-L. Aptamer from whole-bacterium SELEX as new therapeutic reagent against virulent Mycobacterium tuberculosis. Biochem. Biophys. Res. Commun. 2007, 357, 743−748. (12) Stojanovic, M. N.; de Prada, P.; Landry, D. W. Aptamer-based folding fluorescent sensor for cocaine. J. Am. Chem. Soc. 2001, 123, 4928−4931. (13) Cruz-Aguado, J. A.; Penner, G. Determination of ochratoxin a with a DNA aptamer. J. Agric. Food Chem. 2008, 56, 10456−10461. (14) Wang, L.; Chen, W.; Ma, W.; Liu, L.; Zhao, Y.; Zhu, Y.; Xu, L.; Kuang, H.; Xu, C. Fluorescent strip sensor for rapid determination of toxins. Chem. Commun. (Cambridge, U. K.) 2011, 47, 1574−1576. (15) McKeague, M.; Bradley, C. R.; Girolamo, A. D.; Visconti, A.; Miller, J. D.; DeRosa, M. C. Screening and initial binding assessment of fumonisin B1 aptamers. Int. J. Mol. Sci. 2010, 11, 4864−4881. (16) Chen, X.; Huang, Y.; Duan, N.; Wu, S.; Ma, X.; Xia, Y.; Zhu, C.; Jiang, Y.; Wang, Z. Selection and identification of ssDNA aptamers recognizing zearalenone. Anal. Bioanal. Chem. 2013, 405, 6573−6581. (17) Wang, Y. K.; Wang, J.; Wang, Y. C.; Chen, Z. F.; Yan, Y. X.; Hao, Q. W.; Li, S. Q.; Yu, C.; Yang, C. Y.; He, S. J. Preparation of antizearalenone monoclonal antibodies and development of an indirect competitive ELISA for zearalenone. Microbiol. China 2011, 38, 1793− 1800. (18) Wang, Y. C.; Wang, J.; Wang, Y. K.; Yan, Y. X. Preparation of monoclonal antibodies and development of an indirect competitive ELISA for fumonisin B-1 detection. J. Shanghai Jiaotong Univ., Agric. Sci. 2011, 29, 69−74. (19) Morrissey, J. H. Silver stain for proteins in polyacrylamide gels: A modified procedure with enhanced uniform sensitivity. Anal. Biochem. 1981, 117, 307−310. (20) Chen, J.; Fang, Z.; Liu, J.; Zeng, L. A simple and rapid biosensor for ochratoxin A based on a structure-switching signaling aptamer. Food Control 2012, 25, 555−560. (21) Wang, Y. K.; Shi, Y. B.; Zou, Q.; Sun, J. H.; Chen, Z. F.; Wang, H. a.; Li, S. Q.; Yan, Y. X. Development of a rapid and simultaneous immunochromatographic assay for the determination of zearalenone and fumonisin B1 in corn, wheat and feedstuff samples. Food Control 2013, 31, 180−188. (22) Hervás, M.; López, M. Á .; Escarpa, A. Electrochemical immunoassay using magnetic beads for the determination of 141

dx.doi.org/10.1021/jf503733g | J. Agric. Food Chem. 2015, 63, 136−141