Article pubs.acs.org/jnp
Scutellarin from Scutellaria baicalensis Suppresses Adipogenesis by Upregulating PPARα in 3T3-L1 Cells Kaihui Lu, Miaomiao Han, Hui Lin Ting, Zeyu Liu, and Dawei Zhang* Division of Chemistry and Biological Chemistry, School of Physical and Mathematical Sciences, Nanyang Technological University, Singapore 637371, Singapore
ABSTRACT: Adipocyte dysfunction is a major cause of obesity, which is associated strongly with many disorders including psychological and medical morbidities, metabolic abnormalities, and cardiovascular diseases as well as a series of cancers. This study investigated the antiadipogenic activity of scutellarin (1) in 3T3-L1 preadipocytes as well as the underlying molecular mechanisms. It was observed that 1 reduced adipocyte differentiation of 3T3-L1 cells potently, as evidenced by a decrease in cellular lipid accumulation. At the molecular level, mRNA expression of the master adipogenic transcription factors, PPARγ and C/EBPα, was decreased markedly. However, mRNA levels of C/EBPβ, the upstream regulator of PPARγ and C/EBPα, were not decreased by 1. Moreover, a dose-dependent upregulation of PPARα was observed for 1. Computational modeling indicated that 1 can bind to PPARα, γ, and δ each in a distinct manner, while it can activate PPARα only by forming a hydrogen bond with Y464, thus stabilizing the AF-2 helix and activating PPARα. Therefore, these results suggest that 1, a major component of Scutellaria baicalensis, attenuates fat cell differentiation by upregulating PPARα as well as downregulating the expression of PPARγ and C/EBPα, thus showing therapeutic potential for obesity-related diseases.
O
PPARδ, and PPARγ) play essential roles in fatty acid metabolism and thus serve as the major drug targets in treating obesity.6 PPARα regulates genes in the fatty acid synthesis, fatty acid oxidation, and lipid metabolism pathways,7 and emerging in vitro and in vivo evidence shows that activation of PPARα is beneficial for treating obesity and obesity-related diseases.8,9 PPARγ plays an essential role in adipocyte differentiation. Induced during adipogenesis, it acts cooperatively with C/ EBPα to regulate target genes involved in adipocyte differentiation such as lipoprotein lipase (LPL).4,10 PPARδ is expressed ubiquitously and is also involved in fatty acid catabolism and adaptive thermogenesis. Currently, there is still no efficient treatment for obesity because of its complex etiology.11 The use of certain Western antiobesity drugs has been limited by high costs and side effects such as mood changes and gastrointestinal or cardiovascular complications.12 Thus, natural products have been proposed to provide excellent alternative therapies for this medical challenge due to their potential effectiveness and safety.
besity, a complex abnormality characterized by excessive fat deposition, has become a prominent health problem in both developed and developing countries. Triggered by multiple environmental and genetic factors, obesity is also strongly associated with psychological and medical morbidities, metabolic abnormalities, and cardiovascular diseases as well as a number of types of cancer.1 Adipocyte dysfunction is a major cause of obesity. Generally, when in vivo energy homeostasis that controls lipid and glucose dynamics cannot be maintained under conditions of excess energy, adipose tissue differentiates preadipocytes into adipocytes, and excessive accumulation of lipid and triglycerides in adipose tissue causes an obese condition.2,3 Therefore, tight regulation of adipogenesis is crucial for maintaining energy homeostasis and treating obesity and obesity-related diseases. Adipogenesis is a well-organized process accompanied by coordinated morphological and genetic changes. Multiple adipogenic transcription factors such as peroxisome proliferator activated receptors (PPARs), the sterol regulatory element binding protein (SREBP) family, and the CCAAT-enhancer binding protein (C/EBP) family are involved in the regulation of adipogenesis.4,5 Of these factors, PPARs (namely, PPARα, © 2013 American Chemical Society and American Society of Pharmacognosy
Received: December 21, 2012 Published: March 22, 2013 672
dx.doi.org/10.1021/np300889y | J. Nat. Prod. 2013, 76, 672−678
Journal of Natural Products
Article
upstream regulator of PPARγ and C/EBPα, was not downregulated by 1. Moreover, a dose-dependent upregulation of PPARα mRNA level was also observed in cells on 1 treatment, suggesting that scutellarin reduces adipocyte differentiation through simultaneous suppression of adipogenic gene expression and upregulation of PPARα expression. No significant effect on the expression of PPARδ was observed. Molecular Modeling of Scutellarin (1) Binding to PPARs. Detailed theoretical and computational analyses for the binding of 1 to PPARα, PPARγ, and PPARδ were conducted to provide insights into the possible mechanisms of action of this compound using an approach that combines AutoDock, MD, and free energy calculations. The crystal structures of ligandbinding domains of the PPARs were used in the modeling. Molecular docking was conducted first to generate several distinct binding orientations, and molecular dynamics simulation was performed to further relax the complex. Then, the affinity for each binding mode was estimated; those with the lowest binding free energy were selected and analyzed. From the predicted binding modes shown in Figure 3, 1 can bind to all three PPARs in a distinct manner, among which only the AF-2 helix in PPARα has a direct interaction with 1 via a hydrogen bond. More detailed binding information between scutellarin and PPARα is shown in Figure 4. Thus, 1 may occupy the Y-shaped ligand-binding pocket in a very similar fashion with the known high-affinity PPAR agonists GW40954419 and AZ242.20 Comparison of the binding modes of these molecules in the binding structures may provide insights into the binding property of 1 with PPARα. An overlay of bound 1, GW409544, and AZ242 in their configurations is shown in Figure 4B. The glucuronide group of 1 is located in a similar position and orientation as the carboxylate groups of GW409544 and AZ242 and is held in place through a network of hydrogen bonds with Y464, H440, Y314, and S280. Among them, Y464 is located in the middle of the AF-2 helix. The same hydrogen bond is seen in the binding of ligands (GW409544 and AZ242) to PPARα and ligands (rosiglitazone and GI262570) to PPARγ. This conservation of the hydrogen bond is believed to be crucial for ligand-mediated activation of PPARα. As a result, the binding of the molecule of 1 may shift the equilibrium toward the active configuration of PPARα via direct stabilization of the AF-2 helix through hydrogen bond and hydrophobic interactions with 1. Thus, these data suggest that treatment with 1 can lead to activation of PPARα. In this study, the effect of 1 on adipocyte differentiation and the underlying mechanisms involved were evaluated in 3T3-L1 preadipocytes. The results obtained demonstrated that 1 inhibits 3T3-L1 adipocyte differention through decreasing the expression of adipogenic genes while increasing the gene expression of PPARα. PPARα, a transcription factor activated by ligand binding, regulates the expression of genes involved in cellular lipid uptake and oxidation.7 PPARα deregulation may have a role in the pathology of obesity and obesity-related diseases since its pharmacological activation helps reduce the risk of cardiovascular disease and many PPARα agonists show beneficial effects in the treatment of various metabolic diseases.8,21,22 PPARα-deficient mice also exhibit a state of high adiposity and inflammation.23 Herein, it was shown that 1 upregulated PPARα mRNA expression and might activate PPARα through possible hydrogen bonding with Y464 in the AF-2 helix of PPARα, suggesting its potential as an antiobesity agent.19,20
Plant phenols, secondary metabolites that are consumed commonly as food ingredients or herbal medicines, are associated with the prevention of some obesity-related diseases. Oleuropein, a phenolic compound in olive leaves and oil, has shown a strong inhibitory effect on 3T3-L1 preadipocyte differentiation.13 Investigators have also found its inhibitory effect on atherosclerosis, through possible binding with all three PPARs.14 Inspired by the antiobesity potential of oleuropein, it may be proposed that scutellarin (1), a major bioactive flavonoid glucuronide isolated from the Chinese medicinal herb Scutellaria baicalensis Georgi (Lamiaceae), has potential as an antiobesity agent because it demonstrates potent antiinflammatory, antioxidant, cardioprotective, hypotensive, and neuroprotective effects.15−17 Also, medicinal plants that contain 1 have been used in treating various cardio-cerebral vascular diseases.18 In this study, the effects of 1 on adipogenesis and adipogenic gene expression were investigated. Adipogenesis may be mimicked in vitro using 3T3-L1 preadipocytes, while adipocyte differentiation may be evaluated by Oil Red O staining for lipid with the expression of adipocyte-specific genes monitored by reverse transcription polymerase chain reaction (RT-PCR). The molecular mechanism of 1 was investigated via focusing on its role in PPAR family regulation. The binding modes of 1 to three PPARs were analyzed computationally through a combinational approach employing molecular docking, molecular dynamics (MD) simulation, and free energy calculations.
■
RESULTS AND DISCUSSION Scutellarin (1) Suppresses Adipocyte Differentiation in 3T3-L1 Cells. 3T3-L1 cells were differentiated for eight days with the treatment of 1 at the indicated concentration. No significant cytotoxicity was observed for concentrations less than 100 μm (Figure 1C). After the differentiation of preadipocytes into adipocytes, Oil Red O staining and subsequent quantification were performed to observe the intracellular lipid accumulation. As shown in Figure 1A, the lipid accumulation in cells treated with 1 was significantly lower than the lipid accumulation in control cells, as evidenced by the decrease in size and the number of lipid drops. Results from Oil Red O quantification showed that 1 suppressed lipid accumulation in a dose-dependent manner. At a concentration of 100 μm, 1 was shown to inhibit most of the adipocyte differentiation (Figure 1B). Scutellarin (1) Downregulates Adipogenic Genes and Upregulates PPARα. The inhibitory effect of 1 on adipocyte differentiation prompted the investigation of their roles in the regulation of adipogenic gene expression upon adipogenesis of 3T3-L1 cells. As shown in Figure 2, RT-PCR revealed that 1 decreased significantly the expression of the master adipogenic transcription factors, PPARγ and C/EBPα, in a dose-dependent fashion. The expression of the PPARγ target gene LPL was also decreased during adipocyte differentiation in response to treatment with 1. However, the mRNA level of C/EBPβ, the 673
dx.doi.org/10.1021/np300889y | J. Nat. Prod. 2013, 76, 672−678
Journal of Natural Products
Article
Figure 1. Effect of scutellarin (1) on adipocyte differentiation in 3T3-L1 cells. Adipocyte differentiation was performed with or without the indicated concentration of 1 for the whole adipogenic period. On day 8, cells were stained with Oil Red O. (A) Observation of cells after Oil Red O staining under phase-contrast microscopy with 40× objective (row 1), 4× objective (row 2), or the naked eye (row 3). (B) Quantitation of lipid accumulation determined by Oil Red O. Three replicates were used to represent the error bars. (C) Cytotoxicity of 1 measured by MTT assays. Three replicates were used to represent the error bars. Negative: negative control; Positive: positive control (without treatment of 1). *p < 0.01 compared with positive control; **p < 0.005 compared with positive control.
Scutellarin (1), a flavonoid glucuronide, has a chemical structure similar to but more rigid than that of oleuropein, which has been reported to have inhibitory effects on adipocyte differentiation and atherosclerosis.13,14 Indeed, 1 has been shown, like oleuropein, to suppress adipocyte differentiation in 3T3-L1 cells. Besides having an antiadipogenic effect, 1 also shares other bioactivies with oleuropein such as antioxidant, anti-inflammatory, anti-HIV-1, and anticancer potential.24−28 Scutellarin has been used clinically in mainland China, and it has various protective mechanisms toward cardio-cerebral vascular diseases, liver injury, lung diseases, and oral squamous cell carcinoma,17,27,29−33 implying that it is a relatively safe and potent drug candidate in treating obesity and obesity-related diseases. However, in vivo studies are required to investigate whether 1 will exert its regulatory effects through upregulation of PPARα under pathological conditions. The present results showed that although exposing 3T3-L1 preadipocytes to 1 during adipogenesis attenuated the mRNA level of C/EBPα and PPARγ, it did not affect the expression of C/EBPβ, the upstream regulator of C/EBPα and PPARγ. When adipogenesis is initiated, upregulation of C/EBPβ is required for mitotic clonal expansion and the subsequent downstream C/EBPα and PPARγ upregulation.34,35 Therefore, the present data suggest that the downregulation of C/EBPα and PPARγ during adipocyte differentiation by 1 acts independently of C/EBPβ gene expression. This regulatory
pattern is similar to the effects of isorhamnetin and 18αglycyrrhetinic acid,36,37 suggesting that there may be a common inhibitory mechanism. Taken together, the results of this study demonstrate that scutellarin (1) reduces 3T3-L1 adipocyte differentiation by increasing PPARα mRNA levels while at the same time reducing the levels of C/EBPα and PPARγ mRNA. Through computational analysis, 1 is predicted to form a hydrogen bond with Y464 in the AF-2 helix of PPARα, thus leading to stabilization of the AF-2 helix and activation of PPARα. Although further investigation is required to study the physiological relevance of these results, these data highlight the potential of 1 as an agent for the treatment of obesity and obesity-related disorders.
■
EXPERIMENTAL SECTION
Reagents. Scutellarin (1) (purity ≥99%) was purchased from Push Biotechnology (Chengdu, People’s Republic of China), and 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), Oil Red O, dexamethasone, 3-isobutyl-1-methylxanthine (IBMX), insulin, and dimethyl sulfoxide (DMSO) were purchased from Sigma (St. Louis, MO, USA). DMEM (#11965-092), phenol red-free DMEM (#21063-029), PBS, fetal bovine serum (FBS), and bovine serum (BS) were obtained from Gibco (Grand Island, NY, USA). TRIzol reagent, Purelink RNA mini kit, and penicillin/streptomycin were from Invitrogen (Carlsbad, CA, USA). The IScript cDNA synthesis kit was from Bio-Rad (Hercules, CA, USA). GoTaq Colorless master mix 674
dx.doi.org/10.1021/np300889y | J. Nat. Prod. 2013, 76, 672−678
Journal of Natural Products
Article
Figure 2. Effect of scutellarin (1) on the expression of adipogenic genes in 3T3-L1 cells. Adipocyte differentiation was performed without or with the indicated concentration of 1 for the whole adipogenic period. On day 8, cells were harvested and mRNA expression was evaluated by RT-PCR. The bands were analyzed using Image J. Three replicates were used to represent the error bars. Negative: negative control; Positive: positive control (without treatment of 1). *p < 0.05 compared with positive control; **p < 0.005 compared with positive control.
Figure 3. Predicted PPAR−scutellarin (1) binding structures. The AF2 helix is colored purple. PPARα, PPARδ, and PPARγ are colored pink, yellow, and blue, respectively. Hydrogen bonding is highlighted with dotted lines. was from Promega (Madison, WI, USA). Primers were synthesized by First Base Pte. Ltd. (Singapore). Adipocyte Differentiation. 3T3-L1 preadipocytes (ATCC, Manassas, VA, USA) were grown in DMEM supplemented with 10% BS and 1% penicillin/streptomycin at 37 °C in a humidified incubator with 5% CO2 to confluence. Confluence cells (d0) were induced to adipocyte differentiation with DMEM supplemented with 10% FBS, 2.5 μg/mL insulin, 0.5 μM dexamethasone, and 100 μM
IBMX. After two days (d2), the medium was then replaced with DMEM containing 2.5 μg/mL insulin and 10% FBS for another 48 h. On day 4 (d4), the medium was changed to fresh DMEM containing 10% FBS. Every two days thereafter, cells were switched to the same fresh medium. On day 8, cells were harvested for analysis. Scutellarin (1) was dissolved in DMSO and added into DMEM to achieve the indicated concentration for the whole adipogenic period. 675
dx.doi.org/10.1021/np300889y | J. Nat. Prod. 2013, 76, 672−678
Journal of Natural Products
Article
Figure 4. Predicted PPARα−scutellarin (1) binding structure. (A) Lowest energy snapshot of the 20 ns MD simulation of the PPARα−1 complex. The PPARα backbone is represented by a pink ribbon, and 1 is represented with van der Waals spheres and is color coded as follows: carbon, cyan; oxygen, red. (B) Superposition of the structures of GW409544 (mauve) and AZ242 (yellow) bound to PPARα. (C) Chemical structures of the compounds described as in (B). (D) Hydrogen bonds formed by 1 and the surroundings are indicated as green dotted lines.
Table 1. Primer Sequences Used for PCR gene
forward primer
reverse primer
annealing temperature (°C)
ref
PPAR-α PPAR-β PPAR-γ C/EBP-α C/EBP-β aP2 LPL GAPDH
AGGCTGTAAGGGCTTCTTTCG TCCATCGTCAACAAAGACGGG CGCTGATGCACTGCCTATGA CGCAAGAGCCGAGATAAAGC GGGGTTGTTGATGTTTTTGG CATGGCCAAGCCCAACAT ATCGGAGAACTGCTCATGATGA GGTGAAGGTCGGTGTCAACG
GGCATTTGTTCCGGTTCTTC ACTTGGGCTCAATGATGTCAC AGAGGTCCACAGAGCTGATTCC CACGGCTCAGCTGTTCCA CGAAACGGAAAAGGTTCTCA CGCCCAGTTTGAAGGAAATC CGGATCCTCTCGATGACGAA CAAAGTTGTCATGGATGACC
54 55 57 56 52 54 55 51
43 44 43 43 43 43 43 45
Oil Red O Staining. The cellular lipid content was assessed by Oil Red O staining. 3T3-L1 cells differentiated for eight days were washed twice with PBS (pH 7.4) and then fixed with 3.7% formalin for 20 min. The cells were washed twice with distilled water and stained with freshly diluted Oil Red O solution (six parts of 0.5% Oil Red O stock solution and four parts H2O) for 60 min with gentle agitation. Excess stain was removed with 60% ethanol, and then cells were washed three times with distilled water before observation under an Olympus CKX41 phase-contrast microscope. For quantitative determinations of accumulated lipid in cells, Oil Red O staining was eluted with 2-
propanol. The amount of dye elute was quantified by using a spectrophotometer at 510 nm. Cell Viability Assay. Cell viability was determined by using an MTT colorimetric assay. Briefly, 2000 cells were seeded into each well of the 96-well plate and cultured in phenol red-free DMEM supplemented with 10% BS and 1% penicillin/streptomycin at 37 °C in a humidified incubator with 5% CO2 for 48 h. The medium was then changed to phenol red-free differentiation medium with or without 1. The cells were then incubated in a humidified incubator at 37 °C with 5% CO2 for 68 h. Then, 50 μL of MTT solution (2 mg/ mL) was added into each well, and the plate was incubated in the dark 676
dx.doi.org/10.1021/np300889y | J. Nat. Prod. 2013, 76, 672−678
Journal of Natural Products
Article
for another 4 h. Formazan dye was then solubilized with 150 μL of DMSO, and the absorbance was measured at 570 nm with a Synergy 4 Multifunction microplate reader (Bio-Tek Instruments, Winooski, VT, USA). RNA Extraction and RT-PCR. Total RNA was extracted from 3T3-L1 cells using TRIzol reagent and a Purelink RNA mini kit on day 8. Reverse-transcription was performed with an Iscript cDNA synthesis kit, according to the manufacturer’s instructions. PCR reactions were performed using the GoTaq colorless master mix and Takara TP600 thermal cycler. The thermal cycle conditions were as follows: after heating at 95 °C for 5 min, PCR amplification was done with 40 cycles of 95 °C for 30 s, the respective annealing temperature for 30 s (Table 1), 72 °C for 30 s, followed by a terminal extension at 72 °C for 7 min. Primers used for PCR are shown in Table 1. The PCR products were subjected to electrophoresis on 2% agarose gels stained with ethidium bromide. The bands were scanned by a UV scanner; GAPDH was employed as the internal control. Molecular Modeling. Molecular modeling was performed by a combinational approach using molecular docking, molecular dynamics simulation, and free energy calculations.38,39 Autodock 4.0 was used in the docking.40 Molecular dynamics simulations were carried out using the SANDER module of the AMBER 9 program with ff03 version of the Amber force field.41 Free energy was calculated using the Sietraj program, which is an alternative to the MM-PBSA calculation in AMBER 9.42 Statistical Analysis. Data are expressed as means ± SEM. Differences were considered statistically significant when the p value was less than 0.05, assessed using an unpaired Student’s t-test.
■
(15) Yang, X. F.; He, W.; Lu, W. H.; Zeng, F. D. Acta Pharmacol. Sin. 2003, 24, 1118−1124. (16) Liu, H.; Yang, X.; Tang, R.; Liu, J.; Xu, H. Pharmacol. Res. 2005, 51, 205−210. (17) Tan, Z. H.; Yu, L. H.; Wei, H. L.; Liu, G. T. J. Asian Nat. Prod. Res. 2010, 12, 175−184. (18) Chen, X.; Cui, L.; Duan, X.; Ma, B.; Zhong, D. Drug Metab. Dispos. 2006, 34, 1345−1352. (19) Xu, H. E.; Lambert, M. H.; Montana, V. G.; Plunket, K. D.; Moore, L. B.; Collins, J. L.; Oplinger, J. A.; Kliewer, S. A.; Gampe, R. T., Jr.; McKee, D. D.; Moore, J. T.; Willson, T. M. Proc. Natl. Acad. Sci. U. S. A. 2001, 98, 13919−13924. (20) Cronet, P.; Petersen, J. F.; Folmer, R.; Blomberg, N.; Sjoblom, K.; Karlsson, U.; Lindstedt, E. L.; Bamberg, K. Structure 2001, 9, 699− 706. (21) Nohara, A.; Kobayashi, J.; Mabuchi, H. J. Atheroscler. Thromb. 2009, 16, 303−318. (22) Shah, A.; Rader, D. J.; Millar, J. S. Atherosclerosis 2010, 210, 35− 40. (23) Yessoufou, A.; Ategbo, J. M.; Attakpa, E.; Hichami, A.; Moutairou, K.; Dramane, K. L.; Khan, N. A. Mol. Cell. Biochem. 2009, 323, 101−111. (24) Hong, H.; Liu, G. Q. Planta Med. 2004, 70, 427−431. (25) Zhang, G. H.; Wang, Q.; Chen, J. J.; Zhang, X. M.; Tam, S. C.; Zheng, Y. T. Biochem. Biophys. Res. Commun. 2005, 334, 812−816. (26) Luo, P.; Tan, Z. H.; Zhang, Z. F.; Zhang, H.; Liu, X. F.; Mo, Z. J. Yakugaku Zasshi 2008, 128, 1293−1299. (27) Guo, H.; Hu, L. M.; Wang, S. X.; Wang, Y. L.; Shi, F.; Li, H.; Liu, Y.; Kang, L. Y.; Gao, X. M. Chin. J. Physiol. 2011, 54, 399−405. (28) Wang, S.; Wang, H.; Guo, H.; Kang, L.; Gao, X.; Hu, L. Neuroscience 2011, 185, 150−160. (29) Lin, L. L.; Liu, A. J.; Liu, J. G.; Yu, X. H.; Qin, L. P.; Su, D. F. J. Cardiovasc. Pharmacol. 2007, 50, 327−332. (30) Tan, Z. H.; Yu, L. H.; Wei, H. L.; Liu, G. T. J. Pharm. Pharmacol. 2007, 59, 115−121. (31) Li, H.; Huang, D.; Gao, Z.; Lv, Y.; Zhang, L.; Cui, H.; Zheng, J. Oncol. Rep. 2010, 24, 1153−1160. (32) Pan, Z. W; Zhang, Y.; Mei, D. H.; Zhang, R.; Wang, J. H.; Zhang, X. Y.; Xu, C. Q.; Lu, Y. J.; Yang, B. F. Naunyn Schmiedebergs Arch. Pharmacol. 2010, 381, 137−145. (33) Jiang, D. P.; Li, Q.; Yang, J.; Perelman, J. M.; Kolosov, V. P.; Zhou, X. D. Am. J. Chin. Med. 2011, 39, 1193−1206. (34) Wan, X.; Kong, J.; Li, Y. C. Biochem. Biophys. Res. Commun. 2001, 284, 99−105. (35) Tang, Q. Q.; Otto, T. C.; Lane, M. D. Proc. Natl. Acad. Sci. U. S. A. 2003, 100, 850−855. (36) Yanagiya, T.; Tanabe, A.; Hotta, K. Obesity 2007, 15, 572−582. (37) Lee, J.; Jung, E.; Kim, S.; Huh, S.; Kim, Y.; Byun, S. Y.; Kim, Y. S.; Park, D. Obesity 2009, 17, 226−232. (38) Duan, Y.; Wu, C.; Chowdhury, S.; Lee, M. C.; Xiong, G.; Zhang, W.; Yang, R.; Cieplak, P.; Luo, R.; Lee, T.; Caldwell, J.; Wang, J.; Kollman, P. J. Comput. Chem. 2003, 24, 1999−2012. (39) Case, D. A.; Cheatham, T. E., III; Darden, T.; Gohlke, H.; Luo, R.; Merz, K. M., Jr.; Onufriev, A.; Simmerling, C.; Wang, B.; Woods, R. J. J. Comput. Chem. 2005, 26, 1668−1688. (40) Goodsell, D. S.; Morris, G. M.; Olson, A. J. J. Mol. Recognit. 1996, 9, 1−5. (41) Wang, J. M.; Cieplak, P.; Kollman, P. A. J. Comput. Chem. 2000, 21, 1049−1074. (42) Cui, Q. Z.; Sulea, T.; Schrag, J. D.; Munger, C.; Hung, M. N.; Naim, M.; Cygler, M.; Purisima, E. O. J. Mol. Biol. 2008, 379, 787− 802. (43) Fan, S.; Zhang, Y.; Hu, N.; Sun, Q.; Ding, X.; Li, G.; Zheng, B.; Gu, M.; Huang, F.; Sun, Y. Q.; Zhou, Z.; Lu, X.; Huang, C.; Ji, G. PLoS One 2012, 7, e51007. (44) Garcia, M.; Pujol, A.; Ruzo, A.; Riu, E.; Ruberte, J.; Arbos, A.; Serafin, A.; Albella, B.; Feliu, J. E.; Bosch, F. PLoS Genet. 2009, 5, e1000615.
AUTHOR INFORMATION
Corresponding Author
*Tel: (65)65137367. Fax: (65)67911961. E-mail: zhangdw@ ntu.edu.sg. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS D.Z. was supported by Nanyang Technological University startup grant and in part by Singapore AcRF Tier 1 Grant (M52110095) and also thanks the NTU HPC for support and resources.
■
REFERENCES
(1) Haslam, D. W.; James, W. P. Lancet 2005, 366, 1197−1209. (2) Trujillo, M. E.; Scherer, P. E. Endocr. Rev. 2006, 27, 762−778. (3) Cristancho, A. G.; Lazar, M. A. Nat. Rev. Mol. Cell Biol. 2011, 12, 722−734. (4) Farmer, S. R. Cell Metab. 2006, 4, 263−273. (5) White, U. A.; Stephens, J. M. Mol. Cell. Endocrinol. 2010, 318, 10−14. (6) Evans, R. M.; Barish, G. D.; Wang, Y. X. Nat. Med. 2004, 10, 355−361. (7) Chinetti, G.; Fruchart, J. C.; Staels, B. Inflamm. Res. 2000, 49, 497−505. (8) Kersten, S.; Desvergne, B.; Wahli, W. Nature 2000, 405, 421− 424. (9) Fruchart, J. C. Atherosclerosis 2009, 205, 1−8. (10) Tontonoz, P.; Spiegelman, B. M. Annu. Rev. Biochem. 2008, 77, 289−312. (11) Campfield, L. A.; Smith, F. J.; Burn, P. Science 1998, 280, 1383− 1387. (12) Sui, Y.; Zhao, H. L.; Wong, V. C.; Brown, N.; Li, X. L.; Kwan, A. K.; Hui, H. L.; Ziea, E. T.; Chan, J. C. Obes. Rev. 2012, 13, 409−430. (13) Drira, R.; Chen, S.; Sakamoto, K. Life Sci. 2011, 89, 708−716. (14) Huang, P. L.; Huang, P. L.; Lee-Huang, S. Open Conf. Proc. J. 2010, 110, 81−86. 677
dx.doi.org/10.1021/np300889y | J. Nat. Prod. 2013, 76, 672−678
Journal of Natural Products
Article
(45) Ma, J. Y.; Jiang, W. W.; Zhou, Z. T.; Li, J. M.; Wang, H. Y. J. Asian Nat. Prod. Res. 2008, 10, 1147−1153.
678
dx.doi.org/10.1021/np300889y | J. Nat. Prod. 2013, 76, 672−678
