Sea Buckthorn Fruit Oil Extract Alleviates Insulin Resistance through

Jan 30, 2017 - The beneficial health aspects of sea buckthorn ( Elaeagnus rhamnoides (L.) A.Nelson) oil. Beata Olas. Journal of Ethnopharmacology 2018...
0 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/JAFC

Sea Buckthorn Fruit Oil Extract Alleviates Insulin Resistance through the PI3K/Akt Signaling Pathway in Type 2 Diabetes Mellitus Cells and Rats Shan Gao,† Qing Guo,† Chengguang Qin,† Rui Shang,† and Zesheng Zhang*,†,‡ †

Downloaded via KAOHSIUNG MEDICAL UNIV on July 11, 2018 at 09:59:12 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

Key Laboratory of Food Nutrition and Safety, Ministry of Education of China, Tianjin University of Science and Technology, Tianjin 300457, China ‡ Tianjin Food Safety & Low Carbon Manufacturing Collaborative Innovation Center, Tianjin, 300457, China S Supporting Information *

ABSTRACT: Sea buckthorn fruit oil is rich in palmitoleic acid (POA), which has been reported to play roles in many metabolic processes. In this study, a sea buckthorn fruit oil (SBFO) extract was evaluated through in vitro experiments (the doses were 50, 100, 200, and 400 μM) and in vivo experiments (the doses were 100, 200, and 300 mg/kg·day) to explore its mechanism of action in the treatment of type 2 diabetes mellitus (T2DM). The results revealed that the SBFO extract effectively increased the glucose uptake from 12.23 ± 1.09 to 14.90 ± 1.48 mmol/L in insulin resistance (IR) HepG2 cells, lowered blood glucose (the reductions rates of blood glucose in groups treated with SBFO extract at 200 and 300 mg/kg·day were 10.47% and 13.79%, respectively) and improved insulin indices from −6.11 ± 0.10 to −5.45 ± 0.31 after 4 weeks treatment with SBFO extract at 300 mg/kg·day in T2DM SD rats. RT-PCR and Western blotting analyses suggested that the SBFO extract could promote the expression of phosphatidylinositol-3-kinase (PI3K) and glycogen synthesis (GS) while inhibiting the expression of glycogen synthesis kinase-3β (GSK-3β). Thus, the SBFO extract played a positive role in alleviating T2DM through the PI3K/Akt signaling pathway in HepG2 cells, and diabetic rats and could be used for the future development of functional food and dietary supplements. KEYWORDS: SBFO extract, POA, T2DM, insulin resistance, PI3K/Akt signaling pathway

■

food production.11 Applications of POA in the production of industrial chemicals and biodiesel have also been reported,11 and it has been found to regulate various physiological processes, such as blood glucose metabolism,12 metabolic syndrome,13 and the inflammatory response.14 Previous research has shown that POA can enhance Akt activation and increase plasma membrane GLUT1 and GLUT4 protein contents through AMPK or MAPK signaling pathways in skeletal muscle and adipocytes, in addition to improving glucose homeostasis and IR.15−17 Furthermore, POA can reduce hepatic steatosis by inhibiting the expression of sterol regulatory element binding protein-1 (SREBP1)17 and increase the amount of lipase adipose triglyceride lipase (ATGL) through the activation of nuclear receptor peroxisome proliferator activated receptor α (PPAR α).15 Reports have been confirmed that human subjects with high palmitoleate at baseline had a higher chance of showing an increase in insulin sensitivity than subjects with low levels.18,19 Sea buckthorn (Hippophae rhamnoides L.) is a widely cultivated herbaceous plant in China, with a high content of POA in its fruit oil. Sea buckthorn has long been used in traditional medicine20,21 for the treatment of sputum, cough, skin diseases, and dyspepsia.12,13 Previous reports indicated that the aqueous extract of seabuckthorn seed residues has hypoglycemic,

INTRODUCTION Type 2 diabetes mellitus (T2DM), characterized by elevated blood glucose secondary to insulin resistance (IR) and β-cell dysfunction with associated insulin deficiency,1 is a metabolic and endocrine disorder that is currently in the midst of a worldwide epidemic. At present, T2DM accounts for approximately 90% of diabetes cases,2 and its incidence has grown faster than expected,3 especially in youth.4 Furthermore, T2DM is a risk factor for many chronic complications, such as cardiovascular disease and kidney failure,3 and causes severe health and economic problems. Although commercial chemosynthetic T2DM medicines exhibit good antidiabetic activity, they also have some limitations and negative side effects which impair the health of patients.5 For instance, commercially available T2DM medicine rosiglitazone may lead to the cardiovascular adverse events,6 metformin may cause indigestion,7 and most medications available failed to correct the underlying causes of insulin resistance. Natural nutraceuticals were a preferable treatment method which has been accepted by consumers and appeared to be generally safe.8 There has been some investigations on the antidiabetic natural nutraceuticals, like chenpi extract and Dchiro-inositol which can alleviate IR, but the cost or efficacy needs to improve.9,10 Thus, developing new natural nutraceuticals targeting the origin of insulin resistance is preferable for the improvement of T2DM treatment. Palmitoleic acid (POA) a monounsaturated fatty acid, displays unusual characteristics such as a low melting point (0.5−1 °C) and good oxidative stability, which are beneficial for its use in © 2017 American Chemical Society

Received: Revised: Accepted: Published: 1328

October 20, 2016 January 25, 2017 January 30, 2017 January 30, 2017 DOI: 10.1021/acs.jafc.6b04682 J. Agric. Food Chem. 2017, 65, 1328−1336

Article

Journal of Agricultural and Food Chemistry hypotriglyceridemic, and antioxidant effects in streptozotocininduced diabetic rats, and some other reports indicated the positive effects of POA on glucose homeostasis and insulin resistance.18,19 However, there have been no specific and systematical investigations addressing the function of sea buckthorn fruit oil (SBFO) extract in the treatment of T2DM. Considering that the known effects on diabetes are because of POA and taking account that SBFO extract is rich in POA, the objective of this work was to study the function of SBFO extract in the treatment of T2DM. Therefore, in this study, in vitro and in vivo models involving HepG2 cells and SD rats were established to evaluate the effects of the SBFO extract on investigated IR through the PI3K/Akt signaling pathway, systematically.

■

Table 1. Gas Chromatography (GC) Analysis of the Fatty Acid Composition of the Sea Buckthorn Fruit Oil (SBFO) Extract

MATERIALS AND METHODS

Chemicals. The SBFO used in this study was provided by Ordos Conseco Ecological Development Co, Ltd. (Ordos, China). HepG2 cells was obtained from Tianjin University of Science and Technology (Tianjin, China). STZ was purchased from Sigma Chemical Co. (St. Louis, MO, USA). Antibodies PI3Kp85, PI3Kp110, Akt, phospho-Akt, GSK-3β, and GS were obtained from Cell Signaling Technology Inc. (Danvers, MA, USA). Secondary antibodies were purchased from ZSGB-BIO Technology Co., Ltd. (Beijing, China). The other laboratory chemicals were of analytical grade. Trizol, RIPA, AST, and ALT kits were purchased from Solarbio Science and Technology Co., Ltd. (Beijing, China). Antibodies were obtained from Cell Signaling Technology Inc. (Danvers, MA, USA). Secondary antibodies were purchased from ZSGB-BIO Technology Co., Ltd. (Beijing, China). The other laboratory chemicals were of analytical grade. Sample Preparation and Characterization. The SBFO used in this study was extracted as previously reported by us (unpublished work). The obtained SBFO extract was analyzed via GC, and the fatty acid composition and structure are shown in Table 1. The main components of unprocessed SBFO were POA and palmitic acid, with contents of approximately 35% and 32%, respectively. Oleic acid, vaccenic acid, and linoleic acid (each 5−10%) and trace amounts of other fatty acids (nutmeg acid, stearic acid, linolenic acid, and peanut acid, each at approximately 1% or less) were also found. After the extraction process, POA concentration was increased to 81%, which turned the extract into a dark brown, oily liquid with a low melting point and good oxidative stability. Cell Culture. HepG2 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 4.5 mM glucose, 10% fetal bovine serum (FBS), and 1% mixed antibiotics under standard cell culture conditions (humidified atmosphere, 5% CO2 and 37 °C). Cells were seeded into 96-well plates at a concentration of 1 × 105 cells/mL. When the cells reached confluence, the medium of group N (nomal control group) was replaced with DMEM, while group C and SBFO extract treated groups (group S1, S2, S3, and S4) were replaced with DMEM mixed with insulin at 10−6 mM for 36 h. Then, the medium of group N and C was replaced by DMEM, while the SBFO extract treated groups were subsequently replaced with DMEM containing different concentrations (50, 100, 200, and 400 μM designated S1, S2, S3, and S4, respectively) of the SBFO extract for another 24 h. The cytotoxic or deleterious effects on cell viability was measured in an MTT assay. Finally, the medium was replaced with DMEM without phenol red for another 24 h, and glucose uptake was measured using a glucose assay kit (Nanjingjiancheng, Nanjing, China). At the same time, the cells were collected and washed with PBS for future use to analyze the activation of the PI3K/Akt signaling pathway.22 Animals and Treatments. Four-week old male SD rats (200 ± 20 g) were obtained from the animal house of the Beijing University Science Center (Beijing, China). All rats were kept in specific-pathogenfree animal rooms and raised in a controlled environment at 23 ± 2 °C with a humidity of 55 ± 10%, under a 12 h light/dark cycle, with unrestricted access to food and water. The animal protocols were approved by the Animal Care and Use Committee, and all of the related

Values are the mean ± SD, and each group contained at least 3 repetitions. bNot detected. The concentration was lower than the detection limit of the applied GC method (5 μg/mL). a

facilities and experimental procedures were executed according to the Technical Standards for the Testing & Assessment of Health Food (2003).9 The rats were acclimatized to the animal room for 1 week and then divided into several groups. The normal group (N) was fed a normal chow diet throughout the study, whereas the other groups were fed a high-fat diet. After 4 weeks of feeding, the high-fat diet rats were injected intraperitoneally with STZ dissolved in buffer solution (citrate buffer at pH 4.2−4.5) at a dose of 30 mg/kg. After 3 days, the rats whose blood glucose levels exceeded 11.1 mmol/L were considered to be T2DM rats and were used in subsequent experiments. These T2DM rats were randomly divided into 6 groups. The low-dosage group (L) was treated with SBFO extract at a dose of 50 mg/kg body weight daily via oral gavage; the intermediate-dosage group (I) was treated with POA at a dose of 100 mg/kg daily; the high-dosage group (H) was treated with POA at a dose of 150 mg/kg daily; the negative control group (NC) was treated with oleic acid at a dose of 150 mg/kg daily; the positive control group (PC) was treated with rosiglitazone at a dose of 0.36 mg/kg daily (calculated according to the manufacturer’s instructions); and the 1329

DOI: 10.1021/acs.jafc.6b04682 J. Agric. Food Chem. 2017, 65, 1328−1336

Article

Journal of Agricultural and Food Chemistry

samples. Statistical significance is denoted as *P < 0.05 and **P < 0.01 (SPSS version 20.0, Statistical Package for the Social Sciences Software, SPSS Inc., Chicago, IL, USA).

control group (C) received only distilled water. To determine the effect of the SBFO extract on glucose metabolism in rats, body weights and blood glucose (using a blood glucose meter and test strips) were measured weekly for 4 weeks in all groups. After an additional 4 weeks, the rats were anesthetized for venous blood collection, followed by tissue harvesting. Heparinized plasma samples were obtained through centrifugation of whole blood at 4000 rpm for 15 min at 4 °C, and the plasma was then stored at −80 °C for further biochemical tests. Tissue samples were stored in liquid nitrogen for further analysis.10 Blood Glucose (BG) Measurements, Oral Glucose Tolerance Test (OGTT), and Plasma Insulin Measurements in Rats. The blood glucose levels of the rats in all of the groups were determined weekly with a glucometer via tail bleeding after overnight fasting. OGTT was performed in overnight-fasted rats from all groups after 4 weeks of treatment with the SBFO extract. All of the rats were orally administered glucose at a dose of 2 g/kg. Blood was withdrawn from the tip of the tail at 0, 30, 60, and 120 min to measure blood glucose levels. For plasma insulin measurements, the rats were fasted overnight, after which blood samples were collected and tested with an ultrasensitive rat insulin ELISA kit (Nanjingjiangcheng). Insulin levels (INS) were detected in the rats after intraperitoneal injection of STZ and 4 weeks of treatment with the SBFO extract. The insulin sensitivity index (ISI) was calculated following the formula ISI = Ln (1/INS × BG). The homeostasis model assessment-β (HOMA-β) was calculated following the formula HOMA-β = (20 × INS)/(BG − 3.5).9 Hepatic Glycogen Measurements in Rats. Rat liver tissue homogenates from all groups were collected and tested with a liver/ muscle glycogen assay kit (Nanjingjiangcheng). Alanine Transaminase (ALT) and Aspartate Transaminase (AST) Measurements in Rats. Plasma samples collected from overnight-fasted rats from all groups were tested with the alanine aminotransferase assay kits and aspartate aminotransferase assay kits (Nanjingjiancheng). Real-Time Polymerase Chain Reaction Analysis. The effects of the SBFO extract on the PI3K/Akt signaling pathway were analyzed via real-time polymerase chain reaction. HepG2HepG2 cells and ground livers were collected in TRIzol and disrupted at room temperature. Total RNA was extracted according to the manufacturer’s instructions and resuspended in nuclease-free water. The concentration of total RNA was determined with an ultraviolet spectrophotometer, and its integrity was confirmed through visualization of rRNA bands after agarose gel electrophoresis. The total RNA was then converted to cDNA using an RT-PCR kit (TaKaRa, Dalian, China). Real-time PCR analysis was performed with premixed SYBR green reagents (TaKaRa, Dalian, China) in a real-time detector (Bio-Rad Laboratories, Hemel Hempstead, UK). Primer pairs (Beijing Dingguo Changsheng Biotechnology Co, Ltd. Beijing, China) were designed using the Primer Premier 5 program. The sequences were as follows: PI3K (sense, ACAAAGCTCTACTCTAGGCGTG; antisense, TTACCAGCATGGTCATGGGC), Akt (sense, AGAGAGCCGAGTCCTACAGAATA; antisense, CCGAGAGAGGTGGAAAAACA), GSK-3β (sense, TCGTCCATCGATGTGTGGTC; antisense, TTGTCCAGGGGTGAGCTTTG), G S (s e n s e , T T G C CA G A A T G C A C G CA G A A ; a n t i s e n s e , TGCCTGCATCATCTGTTGAC), β-actin (sense, GATCGATGCCGGTGCTAAGA; antisense, TCCTATGGGAGAACGGCAGA). Western Blotting Analysis. Protein samples were extracted from rat liver tissue with RIPA buffer and then resolved via 10% SDS−PAGE for 0.5 h at 80 V, followed by 2.5 h at 100 V. The protein samples were subsequently transferred to a nitrocellulose membrane and probed with commercially available primary antibodies against PI3Kp85 (85 kDa), PI3Kp110 (110 kDa), Akt (60 kDa), p-Akt (60 kDa), GSK-3β (46 kDa), and GS (81−85 kDa), followed by incubation with the corresponding secondary antibodies. The presence of the target proteins on the membranes was determined based on the assessment of fluorescence using the ChemiDoc XRS reagent (Bio-Rad), and the band densities were quantified. Statistics. Data are presented as the mean ± SD. One-way ANOVA was used for all statistical comparisons among groups, and the t test was used to exhibit the significance of differences between independent

■

RESULTS SBFO Extract Improved Glucose Uptake inHepG2 Cells. The doses of fatty acids were higher than the standard dose encountered in human or rat plasma, and they were confirmed to have no cytotoxic or deleterious effects on cell viability in an MTT assay (data not shown). As shown in Figure 1, glucose

Figure 1. Effects of the SBFO extract on glucose uptake in IRHepG2 cells. Glucose uptake was calculated by subtracting the glucose content of the test wells from the glucose content of the blank wells. The values are the mean ± SD, and similar results were obtained in three independent experiments.**p < 0.01 and *p < 0.05 vs group C. The normal group (N) was treated with DMEM without insulin, and others were treated with 10−6 mM insulin and divided into groups as follows: the control group (C) received DMEM only and the dosage group treated with SBFO extract at different concentrations of 50, 100, 200, and 400 μM.

uptake exhibits a dose-dependent increase in the SBFO extracttreated groups including S1, S2, S3, and S4, and glucose uptake was remarkably improved in group S4 (400 μM SBFO extracttreated group) compared with that of the control group (p < 0.01). These data suggested that the SBFO extract could improve insulin sensitivity in IRHepG2 cells. SBFO Extract Affected the PI3K/Akt Pathway in HepG2 Cells. In this study, the effects of the SBFO extract on the expression of the PI3K (Figure 2A), Akt (Figure 2B), GS (Figure 2C), and GSK-3β (Figure 2D) genes were evaluated via RTPCR. The results showed that the expression of PI3K and GS increased in all of the SBFO extract-treated groups. In contrast, the expression of GSK-3β decreased, especially in group S1, in which GSK-3β expression was significantly decreased (p < 0.05). These results showed that the SBFO extract affected the expression of genes in the PI3K/Akt pathway and indicated that the SBFO extract had a positive effect on the glucose uptake capacity of HepG2HepG2 cells. SBFO Extract Increased the Body Weight of Rats. As shown in Table 2, during the 4 weeks, the rats in groups I, H, and PC showed recovery of their body weight, but until the end of the experiment, the body weight of the T2DM rats in groups L, I, H, NC, and PC exhibited no significance compared with that of rats in group C. These results indicated that the SBFO extract showed a weak effect on increasing the body weight of T2DM rats. SBFO Extract Reduced Blood Glucose (BG) and Improved OGTT Results in Rats. Fasting blood glucose was 1330

DOI: 10.1021/acs.jafc.6b04682 J. Agric. Food Chem. 2017, 65, 1328−1336

Article

Journal of Agricultural and Food Chemistry

Figure 2. Effects of different concentrations of SBFO extract on the expression of genes in the PI3K/Akt pathway in IRHepG2 cells. RT-PCR was performed, and the results are expressed as the mean ± SD. Similar results were obtained in three independent experiments. **p < 0.01 and *p < 0.05 vs group C. The normal group (N) was treated with DMEM without insulin, and others were treated with 10−6 mM insulin and divided into groups as follows: the control group (C) received DMEM only and the dosage group treated with SBFO extract at different concentrations of 50, 100, 200, and 400 μM.

Table 2. Effect of the SBFO Extract on the Body Weight of Rats body weight (g)a group

0 week

1 week

2 weeks

3 weeks

4 weeks

N C L I H NC PC

416 ± 40 425 ± 53 424 ± 33 398 ± 49 435 ± 46 430 ± 36 471 ± 21

449 ± 34** 386 ± 61 414 ± 37 380 ± 40 407 ± 45 403 ± 47 423 ± 23

451 ± 52** 389 ± 54 401 ± 37 381 ± 50 422 ± 47 404 ± 50 439 ± 22

483 ± 58** 376 ± 52 399 ± 35 377 ± 58 415 ± 53 408 ± 57 452 ± 26

509 ± 49** 354 ± 55 388 ± 28 383 ± 44 429 ± 51 390 ± 54 465 ± 28

a Values are the mean ± SD, and each group contained 9 rats. **p < 0.01 vs group C. The normal group (N) was fed a normal chow diet during the whole study and received distilled water only; other rats were fed with a high fat diet and divided into groups as follows: the control group (C) received distilled water only, the dosage group (L, I, and H) was treated with 100, 200, 300 mg/kg SBFO extract daily by oral gavage, the negative control group (NC) was treated with oleic acid, and the positive control group (PC) was treated with rosiglitazone.

tested to determine whether the SBFO extract was efficacious in preventing hyperglycemia. As shown in Table 3, the fasting BG levels of rats in group N were significantly lower compared with those in group C (p < 0.01). In week 3, the BG levels of group H showed a significant reduction compared with that of the rats in group C. In week 4, the blood glucose levels of groups I, H, and PC showed a significant reduction compared with that of the rats in group C (reductions of 10.47%, 13.79%, and 12.37%, respectively) (p < 0.05) BG, while the BG levels of the rats in group NC (orally treated with oleic acid) showed no change compared with that of the control (p > 0.05) . Time-dependent treatment effects within groups were also analyzed. The BG levels of the rats in each SBFO extract-treated group and the PC group showed a downward trend during the 4 weeks. The level in group H showed an especially marked decrease (p < 0.05). On the basis of this data, it can be concluded that an appropriate

amount of the SBFO extract could reduce BG level in T2DM rats. For the OGTT index, BG as shown in Figure 3A, BG remained at a high level in the rats in group C over the next 60 min, then dropped to initial levels after 120 min. The BG levels of the rats in the SBFO-treated groups (groups L, I, and H) and rats in group PC showed a faster decrease. These results indicated that treatment with the SBFO extract in T2DM rats could inhibit the rise in BG levels after a glucose load. Figure 3B shows the OGTT results expressed as the overall area under the curve of glucose (AUG) over 120 min. The SBFO extract improved the OGTT results in a dose-dependent manner. SBFO Extract Enhanced Insulin Sensitivity in Rats. As shown in Table 4, the T2DM groups (groups C, L, I, H, NC, and PC) exhibited rising insulin levels after the injection of STZ compared with the rats from group N, indicating that the rats in 1331

DOI: 10.1021/acs.jafc.6b04682 J. Agric. Food Chem. 2017, 65, 1328−1336

Article

Journal of Agricultural and Food Chemistry Table 3. Effect of the SBFO Extract on Fasting BG Levels in Ratsa BG levels (mmol/L)b group

0 weeks

1 week

2 weeks

3 weeks

4 weeks

reduction rate (%)

N C L I H NC PC

5.2 ± 1.66** 17.6 ± 3.42 16.8 ± 3.07 17.2 ± 2.16 17.4 ± 1.84 16.2 ± 3.09 18.6 ± 2.48

5.5 ± 1.28** 18.6 ± 3.50 16.8 ± 2.99 18.0 ± 2.01 18.5 ± 2.98 17.2 ± 3.27 18.0 ± 2.59

4.8 ± 1.06** 20.2 ± 2.15 16.7 ± 3.06 18.9 ± 2.73 17.2 ± 2.37 18.7 ± 3.33 16.6 ± 3.92

5.2 ± 1.64** 19.8 ± 5.09 17.9 ± 4.12 16.2 ± 3.91 15.9 ± 4.33* 17.4 ± 3.39 16.6 ± 3.73

5.1 ± 1.06** 20.4 ± 4.43 17.8 ± 4.16 15.4 ± 4.23* 15.0 ± 3.86*# 17.8 ± 2.48 16.3 ± 4.31*

10.47% 13.79% 12.37%

Effect of the SBFO extract on BG levels in T2DM rats; **p < 0.01 and *p < 0.05 vs group C. Effects of treatment over time within each group; #p < 0.05 compared with week 0, which was considered to indicate a significant difference. The normal group (N) was fed a normal chow diet during the whole study and received distilled water only; other rats were fed with a high fat diet and divided into the following groups: the control group (C) received distilled water only, the dosage group (L, I, and H) was treated with 100, 200, and 300 mg/kg SBFO extract at daily by oral gavage, the negative control group (NC) was treated with oleic acid, and the positive control group (PC) was treated with rosiglitazone. bValues are the mean ± SD. a

Figure 3. OGTT was determined in all experimental rats after 4 weeks of treatment with the SBFO extract. All of the rats were orally administered glucose at a dose of 2 g/kg. BG levels were measured at 0, 30, 60, and 120 min after the administration of glucose. The area under the curve shown in panel A was calculated and is displayed in panel B. The values are the mean ± SD, and each group contained 9 rats. **p < 0.01 and *p < 0.05 vs group C.

Table 4. Effect of the SBFO Extract on Insulin Sensitivity (INS) in Ratsa group

INS after STZ injection (mIU/L)b

INS after SBFO extract treatment (mIU/L)b

ISIb

HOMA-βb

N C L I H NC PC

14.15 ± 3.24 19.64 ± 4.08 19.31 ± 3.49 20.92 ± 5.00 20.27 ± 4.37 19.78 ± 5.56 19.35 ± 5.74

14.51 ± 2.63 23.66 ± 3.61 20.66 ± 3.61 18.28 ± 3.62 16.20 ± 5.07 21.10 ± 5.80 15.50 ± 4.80

−4.29 ± 0.17** −6.11 ± 0.10 −5.90 ± 0.11* −5.62 ± 0.18** −5.45 ± 0.31** −5.98 ± 0.25 −5.61 ± 0.20**

182.06 ± 32.85** 26.35 ± 3.10 28.88 ± 3.42 30.82 ± 6.08 28.26 ± 8.82 26.79 ± 7.34 26.59 ± 5.56

a Effect of the SBFO extract on insulin sensitivity in T2DM rats; **p < 0.01 and *p < 0.05 vs group C. Effects of treatment over time within each group; #p < 0.05 compared with week 0, which was considered to indicate a significant difference. The normal group (N) was fed a normal chow diet during the whole study and received distilled water only, other rats were fed with a high fat diet and divided into groups as follows: the control group (C) received distilled water only, the dosage group (L, I, and H) was treated with 100, 200, and 300 mg/kg SBFO extract daily by oral gavage, the negative control group (NC) was treated with oleic acid, and the positive control group (PC) was treated with rosiglitazone. bValues are the mean ± SD, and each group contained 9 rats.

SBFO Extract Promoted the Synthesis of Hepatic Glycogen in Rats. Hepatic glycogen levels in liver tissue homogenates from the different groups were tested, and the results are shown in Table 5. The glycogen levels of the rats from group I, H, and PC showed a significant increase compared with that of group C (p < 0.05), whereas there was no difference in the glycogen level compared with that of group NC (p > 0.05). These results indicated that the SBFO extract could promote the synthesis of glycogen. SBFO Extract Reduced Plasma AST and ALT in Rats. The ALT and AST indices were tested in the plasma of the rats from all experimental groups. The data in Table 6 show that the SBFO extract reduced ALT and AST levels significantly in the rats from

the T2DM groups had developed IR. Time-dependent treatment effects within each group were also investigated. At the end of 4 weeks of treatment, the insulin levels in rats in all of the SBFO extract-treated groups showed a downward trend. On the basis of the detected BG and insulin levels, we calculated the ISI and HOMA-β indices. As shown in Table 4, the ISI index significantly decreased (p < 0.05) in groups L, I, H, and PC compared with that in group C. However, the HOMA-β level only showed weak increasing tendency in groups I, H, and PC. These results indicated that the SBFO extract could promote insulin sensitivity and alleviate T2DM but cannot obviously promote islet B cells secreting insulin. 1332

DOI: 10.1021/acs.jafc.6b04682 J. Agric. Food Chem. 2017, 65, 1328−1336

Article

Journal of Agricultural and Food Chemistry

In summary, SBFO extract treatment significantly enhanced the expression of the main genes and proteins in the PI3K/Akt pathway. It was also demonstrated that the SBFO extract had a positive effect on ameliorating IR through the PI3K/Akt pathway in rats.

Table 5. Effect of the SBFO Extract on Glycogen Levels in Ratsa group

hepatic glycogen (mg/g)b

N C L I H NC PC

10.72 ± 1.23* 6.63 ± 1.21 6.69 ± 1.40 8.10 ± 1.60* 8.78 ± 1.98* 6.68 ± 1.90 8.96 ± 2.36*

■

DISCUSSION T2DM is a worldwide epidemic associated with hyperglycemia and hyperlipidemia, caused by an imbalance in the insulin sensitivity of the liver and endocrine system.23 Traditional commercial T2DM medicines generate negative effects, along with their antidiabetic activities, resulting in impaired health of the patients. For instance, rosiglitazone may lead to adverse cardiovascular events,6 and metformin may cause indigestion.7 Thus, developing nutraceuticals containing natural compounds with low side effect profiles is necessary. Recently, POA has attracted attention due to its positive effects on metabolic diseases. Evidence accumulated over the years has shown that POA could improve glucose uptake by affecting insulin responsivity, enhance Akt activation, increase the expression of glucose transporter type 4 (GLUT4), and effect the phosphorylation of adenosine 5′-monophosphate (AMP)-activated protein kinase (AMPK) and mitogen-activated protein kinase (MAPK).12,15,17,24 Our GC analysis revealed that the main component of SBFO was POA, which has known positive effects on hyperglycemia. The POA content can be enriched to an even higher level through our extraction process. Therefore, our SBFO extract is suitable for use in developing a T2DM nutraceutical. To evaluate the curative effect of the SBFO extract on T2DM, in vitro and in vivo T2DM models were explored in parallel. Insulin-treated HepG2 cells were used as an in vitro model because the cells treated in this way exhibit low expression of IRS1 and some of its downstream genes, in addition to decreased glucose uptake.25 SD rats were selected as our in vivo model because they can easily develop pathological features resembling T2DM and are more sensitive to STZ and the SBFO extract.26 The physiological measurements conducted in the in vitro experiments showed that the standard dose encountered in human or rat plasma were confirmed to have no cytotoxic or deleterious effects on cell viability, and glucose uptake in HepG2 cells treated with the SBFO extract was increased, possibly because the SBFO extract enhances the glucose metabolism of liver cells and reduces IR. The physiological measurements performed in our in vivo model included the assessment of body weight, BG levels, OGTT, insulin levels, hepatic glycogen levels, and AST and ALT levels in the rats. The body weight of the SD rats showed recovery tendency, and BG and OGTT showed a dose-dependent reduction tendency in the SBFO extract-treated groups, indicating that the SBFO extract ameliorated the T2DMinduced symptoms, regulated glucose metabolism, and weakly enhanced the body weight. Regarding insulin levels, during the initial establishment of the T2DM rat model, the insulin levels of the rats in the STZ-injected groups increased, which demonstrated that the established model was successful and that IR was occurring. After 4 weeks of treatment, insulin levels were measured again and were found to have decreased in the SBFO extract-treated groups compared with that of the control group. This result indicated that SBFO extract treatment could alleviate IR in rats. The ISI and HOMA-β indices were calculated according to BG and insulin levels, to measure the efficiency of the body in taking advantage of insulin and the degree of health of pancreatic β-cells, respectively. The data showed that the ISI

Effect of the SBFO extract on glycogen levels in T2DM rats; *p < 0.05 vs group C. The normal group (N) was fed a normal chow diet during the whole study and received distilled water only; other rats were fed with a high fat diet and divided into groups as follows: the control group (C) received distilled water only, the dosage group (L, I, and H) was treated with 100, 200, and 300 mg/kg SBFO extract daily by oral gavage, the negative control group (NC) was treated with oleic acid, and the positive control group (PC) was treated with rosiglitazone. bValues are the mean ± SD, and each group contained 9 rats. a

Table 6. Effect of the SBFO Extract on AST and ALT in Ratsa group

AST (U/L)b

ALT (U/L)b

N C L I H NC PC

59.86 ± 13.55** 121.43 ± 23.00 107.94 ± 21.47 97.28 ± 12.56* 92.38 ± 14.17* 123.17 ± 14.57 97.09 ± 18.33*

36.51 ± 8.50 95.77 ± 17.55 90.87 ± 14.91 78.00 ± 21.93 66.89 ± 34.62* 91.43 ± 23.07 60.32 ± 17.51**

Effect of the SBFO extract on AST and ALT in T2DM rats; **p < 0.01 and *p < 0.05 vs group C. The normal group (N) was fed a normal chow diet during the whole study and received distilled water only; other rats were fed with a high fat diet and divided into groups as follows: the control group (C) received distilled water only, the dosage group (L, I, and H) was treated with 100, 200, and 300 mg/kg SBFO extract daily by oral gavage, the negative control group (NC) was treated with oleic acid, and the positive control group (PC) was treated with rosiglitazone. bValues are the mean ± SD, and each group contained 9 rats. a

group I, H, and PC compared with those of the rats from group C (p < 0.05). These results indicated that the SBFO extract could protect hepatic tissue from cellular damage caused by hyperglycemia. SBFO Extract Ameliorated IR through the PI3K/Akt Pathway in Rats. In this investigation, the effects of the SBFO extract on PI3K, Akt, GSK-3β, and GS were evaluated at the gene expression level via RT-PCR (Figure 4). The results were consistent with the findings in HepG2 cells obtained in this study: the expression of PI3K and GS RNA was promoted, while the expression of GSK-3β was decreased in groups L, I, H, and PC (p < 0.05). The effects of the SBFO extract on the expression of the main proteins in the PI3K/Akt pathway were investigated through Western blotting (Figure 5). The results indicated that the SBFO extract increased the expression of PI3K (consisting of a catalytic subunit (p110) and a regulatory subunit (p85)) and GS but reduced the expression of GSK3β. Groups I, H, and PC in particular showed significant differences compared with group C (p < 0.05). We also investigated the effect of the SBFO extract on Akt activity (Figure 5C and D) and found that treatment with the SBFO extract increased phosphorylated Akt levels. 1333

DOI: 10.1021/acs.jafc.6b04682 J. Agric. Food Chem. 2017, 65, 1328−1336

Article

Journal of Agricultural and Food Chemistry

Figure 4. Effects of different concentrations of SBFO extract on the expression of genes in the PI3K/Akt pathway in T2DM rat livers. RT-PCR was performed, and the results are expressed as the mean ± SD. Similar results were obtained in three independent experiments. **p < 0.01 and *p < 0.05 vs group C. The normal group (N) was fed a normal chow diet during the whole study and received distilled water only, and other rats were fed with a high fat diet and divided into groups as follows: the control group (C) received distilled water only, the dosage group (L, I, and H) was treated with 100, 200, and 300 mg/kg SBFO extract daily by oral gavage, the negative control group (NC) was treated with oleic acid, and the positive control group (PC) was treated with rosiglitazone.

and HOMA-β indices of the rats in the SBFO-treated groups were improved compared with that of the control group. Thus, SBFO extract treatment could enhance insulin sensitivity and alleviate IR, resulting in accelerated glucose metabolism. Furthermore, the analyses of hepatic glycogen levels and the degree of liver injury (via AST and ALT detection) showed improvements in all SBFO extract-treated groups. These results demonstrated the positive effects of the SBFO extract on relieving hyperglycemia and liver injury in T2DM rats. Next, we investigated the molecular mechanism underlying the effects of the SBFO extract on T2DM. Previous studies have demonstrated that the IR observed in T2DM is most likely attributable to a defect in the insulin receptor/IRS-1/PI3K/Akt cascade.27 In this pathway, Ser/Thr phosphorylation of IRS-1 could inhibit insulin-stimulated tyrosine phosphorylation of IRS1 and has the ability to bind and activate PI3K.28 There were two subunits for PI3K, their important effects were that PI3K-p85 protein would give a negative feedback on insulin sensitivity in return and PI3K-p110 affect the activity of downstream molecules to regulate the continuous conduction of signal. Akt is the major downstream target of PI3K, therefore the activation of Akt leads to inactivation of a specific isoform of GSK3β, which in turn enhances the expression of GS and (potentially) regulates glucose transport activity.9,29,30 The results of RT-PCR and Western blotting analyses obtained in our study showed that the SBFO extract increased the expression of PI3K and GS, decreased the expression of GSK-3β, and activated the phosphorylation of Akt, indicating that both up- and downstream genes of the PI3K/Akt pathway were activated. The activated upstream gene PI3K could promote insulin sensitivity through the feedback on IRS-1, and the activated downstream genes GS and GSK-3β (a GS inhibition protein) regulate glucose metabolism through affecting glucose transport and the synthesis

of glycogen. In coclusion, the results of RT-PCR and Western blotting analyses complied with the action mechanisms described in the previous literature. Besides, the results of RT-PCR and Western blotting analyses were confirmed by the physiological measurements conducted in the HepG2 cells and rat model. In summary, the SBFO extract had a positive effect on glucose metabolism through the PI3K/Akt signaling pathway and could alleviate IR. It is worth discussing the results obtained for the PC group, treated with rosiglitazone, in our in vivo experiments. In these experiments, it was found that the T2DM outcomes of the rats in the SBFO extract-treated groups presented similar tendencies to those of the rats in the PC group, suggesting that the appropriate dosage of the SBFO extract might have ameliorative effects similar to those of rosiglitazone. In addition, the SBFO extract is a natural product with fewer side effects11 compared with artificially synthesized drugs and can be applied to develop nutraceuticals for relieving T2DM symptoms. Furthermore, group NC (treated with oleic acid) was investigated to determine whether oleic acid modulated T2DM symptoms, and the results showed that oleic acid had no impact on T2DM. Thus, it can be inferred that the main component of the SBFO extract, POA, plays the leading role in alleviating T2DM. In conclusion, the metabolic parameters determined in HepG2 cells and rats model of T2DM, including glucose homeostasis, insulin sensitivity, and liver injury, were improved by treatment with the SBFO extract tested in this study. The SBFO extract showed weak effects on the recovery of body weight of the rats and insulin secreting of islet B cells. The results provide evidence that the SBFO extract may be effective in alleviating T2DM through the PI3K/Akt pathway, as confirmed by the results of PT−PCR and Western blotting. The mechanism of action of the SBFO extract was similar to that of rosiglitazone. 1334

DOI: 10.1021/acs.jafc.6b04682 J. Agric. Food Chem. 2017, 65, 1328−1336

Article

Journal of Agricultural and Food Chemistry

Figure 5. Effects of different concentrations of the SBFO extract on key proteins in the PI3K/Akt pathway in T2DM rats determined via Western blot analysis. Photos are representative images. The values are the mean ± SD from densitometry analysis, and similar results were obtained in three independent experiments. **p < 0.01 and *p < 0.05 vs group C. The normal group (N) was fed a normal chow diet during the whole study and received distilled water only, other rats were fed with a high fat diet and were divided into groups as follows: the control group (C) received distilled water only, the dosage group (L, I, and H) was treated with 100, 200, and 300 mg/kg SBFO extract daily by oral gavage, the negative control group (NC) was treated with oleic acid, and the positive control group (PC) was treated with rosiglitazone.

■

The present study offers valuable information for understanding the curative effects and mechanism of action of the SBFO extract in ameliorating T2DM and provides key data for the future development of functional food and dietary supplements, once sufficient further research on SBFO has been performed.

■

AUTHOR INFORMATION

Corresponding Author

*Tel: +86 022 6091 2431. Fax: +86 022 6091 2431. E-mail: [email protected]. ORCID

ASSOCIATED CONTENT

Zesheng Zhang: 0000-0002-0173-9355

S Supporting Information *

Funding

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.6b04682. The gel images of different concentrations of the SBFO extract on key proteins in the PI3K/Akt pathway in T2DM rats determined via Western blot analysis (PDF)

This research was supported by the National ScienceTechnology Pillar Program (2012BAD33B05) and the Program for Changjiang Scholars and Innovative Research Teams at the University of the Ministry of Education of the People’s Republic of China (Grant IRT1166). 1335

DOI: 10.1021/acs.jafc.6b04682 J. Agric. Food Chem. 2017, 65, 1328−1336

Article

Journal of Agricultural and Food Chemistry Notes

(18) Bajaj, M.; Suraamornkul, S.; Romanelli, A.; Cline, G. W.; Mandarino, L. J.; Shulman, G. I.; DeFronzo, R. A. Effect of a sustained reduction in plasma free fatty acid concentration on intramuscular longchain fatty acyl-CoAs and insulin action in type 2 diabetic patients. Diabetes 2005, 54, 3148−3153. (19) Stefan, N.; Kantartzis, K.; Celebi, N.; Staiger, H.; Machann, J.; Schick, F.; Cegan, A.; Elcnerova, M.; Schleicher, E.; Fritsche, A.; Haring, H. U. Circulating Palmitoleate Strongly and Independently Predicts Insulin Sensitivity in Humans. Diabetes Care 2010, 33, 405−407. (20) Dhyani, D.; Maikhuri, R. K.; Misra, S.; Rao, K. S. Endorsing the declining indigenous ethnobotanical knowledge system of Seabuckthorn in Central Himalaya, India. J. Ethnopharmacol. 2010, 127, 329− 334. (21) Suryakumar, G.; Gupta, A. Medicinal and therapeutic potential of Sea buckthorn (Hippophae rhamnoides L.). J. Ethnopharmacol. 2011, 138, 268−278. (22) Gao, F.; Jian, L.; Zafar, M. I.; Du, W.; Cai, Q.; Shafqat, R. A.; Lu, F. 4-Hydroxyisoleucine improves insulin resistance in HepG2 cells by decreasing TNF-alpha and regulating the expression of insulin signal transduction proteins. Mol. Med. Rep. 2015, 12, 6555−6560. (23) Karasawa, H.; Nagata-Goto, S.; Takaishi, K.; Kumagae, Y. A novel model of type 2 diabetes mellitus based on obesity induced by high-fat diet in BDF1 mice. Metab., Clin. Exp. 2009, 58, 296−303. (24) Dimopoulos, N.; Watson, M.; Sakamoto, K.; Hundal, H. S. Differential effects of palmitate and palmitoleate on insulin action and glucose utilization in rat L6 skeletal muscle cells. Biochem. J. 2006, 399, 473−481. (25) Wang, Q. H.; Somwar, R.; Bilan, P. J.; Liu, Z.; Jin, J.; Woodgett, J. R.; Klip, A. Protein kinase B Akt participates in GLUT4 translocation by insulin in L6 myoblasts. Mol. Cell. Biol. 1999, 19, 4008−4018. (26) Bavenholm, P. N.; Pigon, J.; Ostenson, C. G.; Efendic, S. Insulin sensitivity of suppression of endogenous glucose production is the single most important determinant of glucose tolerance. Diabetes 2001, 50, 1449−1454. (27) Broca, C.; Breil, V.; Cruciani-Guglielmacci, C.; Manteghetti, M.; Rouault, C.; Derouet, M.; Rizkalla, S.; Pau, B.; Petit, P.; Ribes, G.; Ktorza, A.; Gross, R.; Reach, G.; Taouis, M. Insulinotropic agent ID1101 (4-hydroxyisoleucine) activates insulin signaling in rat. Am. J. Physiol. 2004, 287, E463−E471. (28) Dai, B.; Wu, Q.; Zeng, C.; Zhang, J.; Cao, L.; Xiao, Z.; Yang, M. The effect of Liuwei Dihuang decoction on PI3K/Akt signaling pathway in liver of type 2 diabetes mellitus (T2DM) rats with insulin resistance. J. Ethnopharmacol. 2016, 192, 382−389. (29) Liu, Y. L.; Dong, M.; Yang, Z. Y.; Pan, S. Y. Anti-diabetic effect of citrus pectin in diabetic rats and potential mechanism via PI3K/Akt signaling pathway. Int. J. Biol. Macromol. 2016, 89, 484−488. (30) Ludka, F. K.; Constantino, L. C.; Dal-Cim, T.; Binder, L. B.; Zomkowski, A.; Rodrigues, A. L. S.; Tasca, C. I. Involvement of PI3K/ Akt/GSK-3beta and mTOR in the antidepressant-like effect of atorvastatin in mice. J. Psychiatr. Res. 2016, 82, 50−7.

The authors declare no competing financial interest.

■

REFERENCES

(1) Sharma, A. K.; Bharti, S.; Goyal, S.; Arora, S.; Nepal, S.; Kishore, K.; Joshi, S.; Kumari, S.; Arya, D. S. Upregulation of PPAR gamma by Aegle marmelos Ameliorates Insulin Resistance and beta-cell Dysfunction in High Fat Diet Fed-Streptozotocin Induced Type 2 Diabetic Rats. Phytother. Res. 2011, 25, 1457−1465. (2) Zhang, B. B.; Moller, D. E. New approaches in the treatment of type 2 diabetes. Curr. Opin. Chem. Biol. 2000, 4, 461−467. (3) Wu, J.; Shi, S.; Wang, H.; Wang, S. Mechanisms underlying the effect of polysaccharides in the treatment of type 2 diabetes: A review. Carbohydr. Polym. 2016, 144, 474−494. (4) Kelsey, M. M.; Geffner, M. E.; Guandalini, C.; Pyle, L.; Tamborlane, W. V.; Zeitler, P. S.; White, N. H. Treatment Options for Type 2 Diabetes in, A.; Youth; Study, G., Presentation and effectiveness of early treatment of type 2 diabetes in youth: lessons from the TODAY study. Pediatric diabetes 2016, 17, 212−21. (5) Howlett, H. C. S.; Bailey, C. J. A risk-benefit assessment of metformin in type 2 diabetes mellitus. Drug Saf. 1999, 20, 489−503. (6) Paredes, S.; Matta-Coelho, C.; Monteiro, A. M.; Bras, A.; Marques, O.; Alves, M.; Ribeiro, L. Cardiovascular safety of type 2 diabetes medications: Review of existing literature and clinical implications. Hormones-International Journal of Endocrinology and Metabolism 2016, 15, 170−185. (7) Ashoush, S.; El-Said, M.; Fathi, H.; Abdelnaby, M. Identification of metformin poor responders, requiring supplemental insulin, during randomization of metformin versus insulin for the control of gestational diabetes mellitus. J. Obstet Gynaecol Re 2016, 42, 640−647. (8) Yeh, G. Y.; Eisenberg, D. M.; Kaptchuk, T. J.; Phillips, R. S. Systematic review of herbs and dietary supplements for glycemic control in diabetes. Diabetes Care 2003, 26, 1277−1294. (9) Gao, Y.; Zhang, M.; Wu, T.; Xu, M.; Cai, H.; Zhang, Z. Effects of DPinitol on Insulin Resistance through the PI3K/Akt Signaling Pathway in Type 2 Diabetes Mellitus Rats. J. Agric. Food Chem. 2015, 63, 6019− 6026. (10) Guo, J.; Tao, H.; Cao, Y.; Ho, C.-T.; Jin, S.; Huang, Q. Prevention of Obesity and Type 2 Diabetes with Aged Citrus Peel (Chenpi) Extract. J. Agric. Food Chem. 2016, 64, 2053−2061. (11) Wu, Y.; Li, R.; Hildebrand, D. F. Biosynthesis and metabolic engineering of palmitoleate production, an important contributor to human health and sustainable industry. Prog. Lipid Res. 2012, 51, 340− 349. (12) Talbot, N. A.; Wheeler-Jones, C. P.; Cleasby, M. E. Palmitoleic acid prevents palmitic acid-induced macrophage activation and consequent p38 MAPK-mediated-skeletal muscle insulin resistance. Mol. Cell. Endocrinol. 2014, 393, 129−142. (13) Cao, H.; Gerhold, K.; Mayers, J. R.; Wiest, M. M.; Watkins, S. M.; Hotamisligil, G. S. Identification of a lipokine, a lipid hormone linking adipose tissue to systemic metabolism. Cell 2008, 134, 933−44. (14) Zong, G.; Ye, X.; Sun, L.; Li, H.; Yu, Z.; Hu, F. B.; Sun, Q.; Lin, X. Associations of erythrocyte palmitoleic acid with adipokines, inflammatory markers, and the metabolic syndrome in middle-aged and older Chinese. Am. J. Clin. Nutr. 2012, 96, 970−976. (15) Bolsoni-Lopes, A.; Festuccia, W. T.; Chimin, P.; Farias, T. S. M.; Torres-Leal, F. L.; Cruz, M. M.; Andrade, P. B.; Hirabara, S. M.; Lima, F. B.; Alonso-Vale, M. I. C. Palmitoleic acid (n-7) increases white adipocytes GLUT4 content and glucose uptake in association with AMPK activation. Lipids Health Dis. 2014, 13, 199. (16) Samokhvalov, V.; Bilan, P. J.; Schertzer, J. D.; Antonescu, C. N.; Klip, A. Palmitate- and lipopolysaccharide-activated macrophages evoke contrasting insulin responses in muscle cells. Am. J. Physiol. 2009, 296, E37−E46. (17) Yang, Z.-H.; Miyahara, H.; Hatanaka, A. Chronic administration of palmitoleic acid reduces insulin resistance and hepatic lipid accumulation in KK-A(y) Mice with genetic type 2 diabetes. Lipids Health Dis. 2011, 10, 120. 1336

DOI: 10.1021/acs.jafc.6b04682 J. Agric. Food Chem. 2017, 65, 1328−1336