Self-Assembled Polypeptide Nanogels with ... - ACS Publications

Subscriber access provided by Grand Valley State | University

Article

Self-assembled Polypeptide Nanogels with Enzymatically Transformable Surface as an siRNA Delivery Platform. Tomoki Nishimura, Akina Yamada, Kaori Umezaki, Shin-ichi Sawada, Sada-atsu Mukai, Yoshihiro Sasaki, and Kazunari Akiyoshi Biomacromolecules, Just Accepted Manuscript • DOI: 10.1021/acs.biomac.7b00937 • Publication Date (Web): 23 Oct 2017 Downloaded from http://pubs.acs.org on October 24, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biomacromolecules is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Self-assembled Polypeptide Nanogels with Enzymatically Transformable Surface as an siRNA Delivery Platform. Tomoki Nishimura1,2 , Akina Yamada1, Kaori Umezaki2, Shin-ichi Sawada1,2, Sada-atsu Mukai1,2, Yoshihiro Sasaki1, Kazunari Akiyoshi1,2*

1. Department of Polymer Chemistry, Graduate School of Engineering, Kyoto University, Katsura, Nishikyo-ku, Kyoto 615-8510, Japan. 2. ERATO Bio-nanotransporter Project, Japan Science and Technology Agency (JST), Kyoto University, Katsura, Nishikyo-ku, Kyoto 615-8530, Japan.

KEYWORDS Nanogels; siRNA delivery; polyethylene glycol dilemma; tandem enzymatic polymerization; enzymatic deshielding

ACS Paragon Plus Environment

1

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT

Nanometer-size gel particles, or nanogels, have potential for delivering therapeutic macromolecules. A cationic surface promotes cellular internalization of nanogels but undesired electrostatic interactions, such as with blood components, cause instability and toxicities. Polyethylene glycol coating has been used to shield charges, but this decreases delivery efficiency. Technical difficulties in synthesis and controlling molecular weights make it unfeasible to, instead, coat with biodegradable polymers. Our proposed solution is cationized nanogels enzymatically functionalized with branched polysaccharide chains, forming a shell to shield charges and increase stability. Biodegradation of the polysaccharides by an endogenous enzyme would then expose the cationic charges, allowing cellular internalization and cargo delivery. We tested this concept, preparing maltopentaose functionalized cholesteryl poly-llysine nanogel and using tandem enzymatic polymerization, with glycogen phosphorylase and glycogen branching enzyme, to add branched amylose moieties, forming a CbAmyPL nanogel. We characterized CbAmyPL nanogels and investigated their suitability as siRNA carriers in murine renal carcinoma (Renca) cells. The nanogels had neutral zeta potential values that became positive after degradation by α-amylase. Foster energy resonance transfer demonstrated that the nanogels formed stable complexes with siRNA, even in the presence of bovine serum albumin and after α-amylase exposure. The nanogels, with or without α-amylase, were not cytotoxic. Complexes of CbAmyPL with siRNA against vascular endothelial growth factor (VEGF), when incubated alone with Renca cells decreased VEGF mRNA levels by only 20%. With α-amylase added, however, VEGF mRNA knockdown by the siRNA/nanogels complexes was 50%. Our findings strongly supported the hypothesis that enzyme-responsive nanogels are promising as a therapeutic siRNA delivery platform.


2

Page 2 of 43

Page 3 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

INTRODUCTION Nanometer-sized gel particles, so called nanogels, have become established as tools for use in biomedical materials, such as drug delivery carriers.1-6 There are two categories of nanogels, made with either chemically or physically crosslinked polymers.7, 8 In 1993, we first reported physically crosslinked or self-assembled nanogels, composed of the natural polysaccharide pullulan modified with cholesterol.9 The synthetic design of these self-assembled nanogels involved substitution of small amounts of hydrophobic molecules onto hydrophilic polymers. Utilizing this strategy, we also other research groups developed a wide variety of self-assembled nanogels with either polysaccharide10-14 or polypeptide15 backbones. In such self-assembled nanogels, a hydrophobic group forms several associated domains16, or physically crosslinked points, facilitating entrapment of hydrophobic drugs and proteins. Using this unique property, we applied these nanogels as protein delivery carriers for vaccines and cytokines.17-19 Nanogels show great potential as drug delivery carriers for not only proteins but also nucleic acids such as plasmid DNA20, antisense DNA21, 22, small interference RNA (siRNA)23 and CpG DNA24. These gene delivery nanogels are amphiphilic polymers substituted with cationic groups, so they can electrostatically form complexes with therapeutically useful nucleic acids. Other gene delivery carriers, including cationic micelles and cationic liposomes, were also designed mainly based on electrostatic interactions. Unfortunately, although they act as efficient gene carriers in vitro, their cationic character allows them to form complexes with blood components, such as albumin and erythrocytes, in vivo. This can lead to the formation of aggregates that obstruct the pulmonary vasculature, resulting in severe toxicities.25 Moreover, these carriers are immediately eliminated by the mononuclear phagocytic system (MPS), leading to short half-live in vivo.26, 27, 28 Therefore, gene delivery carriers with cationic charges have unavoidable toxicities


3

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 43

and are unsuitable for systemic administration. These properties have, thus, limited their clinical applications. To address the challenges associated with cationic charge in potential carriers, investigators developed poly(ethylene glycol) (PEG)-coated nanoparticles.29 Such PEG modification, or PEGylation, can shield the cationic surface of nanoparticles, decreasing protein absorption and recognition by the MPS.30 However, PEGylation also can decrease the transfection or knockdown efficiency in vitro and in vivo. This was attributed to decreased interactions with cell membranes, leading to low cellular uptake. This serious shortcoming is known as the "PEG dilemma".31, 32 To overcome the PEG dilemma, cleavable PEG modified nanoparticles were developed. For example, linkers between PEG and carrier can be cleaved by pH33, 34, redox changes35, 36, and proteolysis37, 38. Another approach would be to use gene carriers shielded with biodegradable polymers such as poly (hydroxyethyl-l-asparagine)39, dextran40, hydroxyethyl starch43,

44

41

, hyaluronic acid42 or

. Because PEGs are not degraded in living systems, PEG-coated

nanoparticles can accumulate in the liver and spleen, an undesirable property. Therefore, systems using biodegradable polymers would be promising alternatives to PEGylation. However despite their potentially superior biocompatibility, compared with PEG-coated nanoparticles, few reports described gene delivery systems shielded with biodegradable polymers as compared with the number of the reports on PEG-coated nanoparticles. Possible reasons include difficulties in introducing biodegradable polymers, which are usually high molecular weight molecules, into gene delivery materials as well as in controlling polymer molecular weights.


4

Page 5 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

In this study, we used enzymatic polymerization to prepare cationic nanogels functionalized with biodegradable polymers for use as siRNA delivery carriers. Our strategy utilized two enzymatic reactions, synthesis of amylose, catalyzed by glycogen phosphorylase (GP), and amylose branching, catalyzed by glycogen branching enzyme (GBE). GP catalyzes addition of a glucose unit from glucose monophosphate to the non-reducing end of an amylose primer such as maltopentaose. Utilizing this method to synthesize amylose, we and others prepared a wide variety of amylose hybrids.45 More important, α(1,4)-glucan including linear (amylose) and branched saccharide (amylopectin and glycogen) can also be degraded by endogenous enzymes such as α-amylase.46 One drawback of amylose, however, is its low colloidal stability because of intermolecular double helix formation.47, 48 The intermolecular double helixes act as crosslinking points leading to the formation of aggregates.49, 50 We previously reported that maltopentaoseconjugated cholesteryl poly-l-lysine acted as a macro-primer for a phosphorylase.51 Although this approach facilely introduced amylose chains onto nanogels and shielded their cationic charges, the resulting amylose-coated dual layered nanogels formed precipitates. Accordingly, we reasoned that, because steric hindrance should hinder branched polysaccharides from forming double helices, nanogels functionalized with branched polysaccharides might be more stable than those made with amylose chains. Thus, tandem enzymatic polymerization, with GP and GBE, enabled introduction of bulky branching polysaccharides.52, 53 We prepared cationic charged nanogels using cholesterol-modified poly-l-lysine.15 The surface of the nanogels was then covered with a biodegradable branched amylose shell, introduced by tandem GP and GBE catalyzed polymerization. We predicted that this approach would shield the cationic charges on the nanogels and that, subsequently, α-amylase induced hydrolysis of the branched amylose would achieve deshielding (Scheme 1). This would restore


5

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

the positive charges of the nanogels, facilitating their cellular uptake and, therefore, enhancing their gene knockdown effects.


6

Page 6 of 43

Page 7 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

EXPERIMENTAL SECTION Materials.

Poly-l-lysine hydrogen bromide (PLL, Mw=1.1

× 104 g/mol), Sodium

cyanoborohydrate, rhodamine B isothiocyanate, pyrene, rabbit muscle phosphorylase b, and adenosine monophosphate were obtained from Sigma-Aldrich. Triethylamine, maltopentaose, and glucose monophoshphate were obtained from Wako Pure Chemical Industries. Cetylpyridinium chloride was obtained from tokyo chemical industry. TI blue staining solution was obtained from Nisshin EM. Glycogen branching enzyme was obtained by Prozomix. Phosphate buffered saline (PBS) solution, Roswell Park Memorial Institute medium (RPMI 1640), Streptomycin (10 mg/mL), penicillin (10000 U/mL), Opti-MEM, 0.25 % trypsin−EDTA, and fetal bovine serum (FBS) were obtained from Gibco. SYBR Green Ⅰ Nucleic Acid Gel Stain was obtained from TAKARA. ReverTraAce was obtained from TOYOBO. Universal Probe Library #12 and Light Cycler 480 Probes Master were obtained from Roche. 18S rRNA Probe (FAM-atccattggagggcaagtctggtgc-BHQ), VEGFA Fw (gcagcttgagttaaacgaacg), VEFGA Rv (ggttcccgaaaccctgag), 18S rRNA Fw (atgagtccactttaaatcctttaacga), and 18S rRNA Rv (ctttaatatacgctattggagctggaa) were obtained from macrogen AllStars Neg. Maxwell RSC simply RNA Cells was obtained from Promega.

Synthesis. All organic solvents were purchased from wake pure industries, and were used as received. Nuclear magnetic resonance spectra were run using a Bruker Avance III 400 MHz spectrometer or a JEOL JNM AL 400 to acquire 1H-NMR spectra. Chemical shifts (δ) are expressed in parts per million and are reported relative to trimethylsilane (TMS) or 3(trimethylsilyl)propionic-2,2,3,3-d4 acid, sodium salt (TSP) as an internal standard in 1H-NMR spectra.


7

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Synthesis of maltopentaose functionalized cholesteryl poly-l-lysine(CMaPL). Poly-l-lysine hydrogen bromide (PLL, Mw(MALS)=1.1×104, Mw/Mn=1.3) was dried under reduced pressure at 70 ºC for 3 days. A solution of cholesteryl N-(6-isocynatohexyl) carbamate (400 mg, 0.721 × 103

mol)9 in dry pyridine (1 mL) was added to a solution of PLL (2.0 g, 8.9 × 10-5 mol) in dry

dimethyl sulfide (250 mL) and triethylamine (2.5 mL) under an Ar atmosphere. The solution was stirred at room temperature for 28 hours under an Ar atmosphere. The reaction solution was dialyzed with a dialysis tube (Spectra por 7 MWCO 1000) against 0.01 M HCl solution (5 L) for 3 days. The resulting solution was lyophilized to give cholesteryl poly-l-lysine (CPL) as a white powder (1.56 g). A mixture of cholesteryl poly-l-lysine (1.44 g, 5.34 × 10-5 mol), maltopentaose (1.82 g, 2.20 mmol), and NaBH3CN (4.60 g, 73.2 mmol) in borate buffer (0.1 M, pH=8.5) was stirred under an Ar atmosphere at 40 ºC for 4 days. The solution was dialyzed against 0.01 M HCl solution for 3 days and was lyophilized to give maltopentaose functionalized cholesteryl poly-l-lysine as a white powder (2.74 g). 1H NMR (dmso-d6/D2O=9/1): 0.7 (30H, cholesterol, 18-H3), 2.8−2.9 (200H, lysine ε-H2), 4.2−4.4 (100H, lysine, α-H1), 4.9 (34H, glucose), 5.1 (46H, glucose).

Synthesis of rhodamine functionalized CMaPL. To a dry DMSO (100 mL) solution of PLLHBr (1.88 g, 0.177 mmol) and N, N-diisopropylethylamine (1.4 mL) was added a dry DMSO (40 mL) solution of rhodamine B isothiocyanate (96.3 mg, 0.201 mmol). The resulting solution was stirred at room temperature for 24 hours under an Ar atmosphere. Unreacted rhodamine B isothiocyanate was removed by dialysis against DMSO for 1 day and distilled water (5 L) for 3 days. The solution was lyophilized to yield rhodamine functionalized PLL (denoted as PLL-Rh) as pink powder (0.7 g). Functionalization of cholesteryl group and maltopentaose group into


8

Page 8 of 43

Page 9 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

PLL-Rh was performed by the method as described above. The degree of rhodamine modification was determined to be 1.1 rhodamine groups per 100 lysine residue by using rhodamine B calibration curve. Self-assembly of CMaPL in aqueous solution. PBS (GIBCO, pH=7.4) was added to CMaPL at 1.0 mg/ml. The solution was stirred overnight to dissolve in PBS buffer. The solution was sonicated with a BRANSON SONIFITER MODE 1450D for 6 min (40 W), and was centrifuged at 15,000 g for 20 minutes at 25 ºC. The supernatant was filtered with 0.45 µm filter (PVDF, MILLEX-GV millipore). Characterization of the nanogel. Dynamic light scattering (DLS) and ζ-potential. DLS and ζ-potential measurements were carried out with a Zetasizer Nano ZS instrument (Malvern Instruments, Malvern, U.K.) operating at a wavelength of 632.8 nm and a 173° detection angle. Transmittance electron microscopy (TEM). Five µL of above nanogel solutions were placed on a copper grid coated with an elastic carbon film (NP-C15/STEM Cu150P Oken shoji, Japan). The excess sample solution was removed by a filter paper. Five µL of TI blue solution (2 times diluted solution) as the staining agent was added and removed again. The sample was dried in a desiccator. The grid was placed in a HT-7700 (Hitachi, Tokyo, Japan) electron microscope operated at 100 kV. Synchrotron small angle x-ray scattering (SAXS). SAXS measurements were performed at BL40B2 of SPring-8, Japan. A 30 cm × 30 cm imaging plate (Rigaku R-AXIS VII) detector was placed at 2.1 m away from the sample. The wavelength (λ) of the incident beam was 1.0 Å. The


9

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 43

set-ups provided a q range of 0.06–3.5 nm−1, where q is the magnitude of the scattering vector defined by q = 4πsinθ/λ with the scattering angle of 2θ. The X-ray transmittance of the sample was measured with ion chambers located in front of and behind the sample. The CMaPL solution (1 mg/ml) or PBS buffer was poured into a quartz capillary (Diameter: 1 mm, Hilgenberg GmbH.) SAXS from sample solutions and solvent was measured at an exposure time of 300 sec. The resulting 2D SAXS images were converted to one dimentional I(q) versus q profiles by circular averaging with the software package FIT2D. The corresponding background intensity of the capillary filled with PBS buffer was subsequently subtracted. The radius of gyration (Rg) was determined by using the Guinier expression (1); = 0exp − /3 (1) , where I(0) is the forward scattering intensity. Size exclusion chromatography equipped with multi-angle light scattering (SEC-MALS). SEC-MALS was performed on a chromatography system using a refractive index detector (Optilab T-rEX, Wyatt technology) connected to multi-angle laser light scattering (MALS) detector (DAWN HELEOS II, Wyatt Technology). G6000PWXL-CP (TSKgel Tosoh) was used as the column for SEC-MALS measurements. Nanogel solutions (2.0 mg/mL, 0.05 M NaNO3) were eluted with 0.05 M NaNO3 solution with a flow rate of 0.50 mL/min at 25 °C. The dn/dc value of CMaPL is 0.153. The molecular weight (Mw) was determined using ASTRA software based on Zimm’s equation. The density (Φ) of the nanogel is calculated from the following equation (2):

= / × (2)


10

Page 11 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

, where NA, Mw, and Rh are Avogadro’s number, the molecular weight, and the hydrodynamic radius, respectively. Fluorescence quenching technique for determining number of hydrophobic domain and cholesteryl

domain.

The

fluorescence

spectra

were

recorded

on

a

fluorescence

spectrophotometer (FP-8500, JASCO Corporation, Tokyo, Japan). The aggregation number of an associating cholesterol domain was estimated by using the steady state fluorescence quenching technique according to previously described procedure.54 In brief, Steady state quenching data in a micro heterogeneous system such as an aqueous micellar solution fit the quenching kinetics (3): ! " = #$%/#%

(3)

, where I and I0 are the fluorescence intensity in the presence or absence of a quencher, [Q] is the bulk concentration of the quencher, and [M] is the concentration of the hydrophobic domain. The plot of ln(I0/I) against the quencher concentration gives a straight line, the slope of which corresponds to [M], and thus the aggregation number, Nchol, can be given by Equation (4). &'( = #)ℎ+,-./-0+,%/#%

(4)

A stock solution (25 µL) of pyrene (1 × 10-4 M) in ethanol was added to a vial. Ethanol was evaporated by flushing nitrogen to form a thin film at the bottom of the vial. To the thin film was added nanogel solutions (2.5 mL), and the resulting mixture was stirred for overnight at room temperature. The final concentration of pyrene in the vial was 1 × 10-6 M. Four µL of cetylpyridinium chloride (CPC) solution (5 × 10-4 M) was added just before measurement.


11

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 43

Pyrene was excited at 339 nm and measured at 386 nm. The slit width was set at 5 nm for the excitation and 1 nm for the emission. The measurement temperature was kept constant at 25 ºC. Enzymatic polymerization. To CMaPL (0.5 mM as the concentration of maltopentaose unit), glucose-1-phosphate (50 mM), and adenosine monophosphate (5 mM) in Bis tris buffer (pH = 6.0, 0.1 M), rabbit muscle phosphorylase b (0.65 µM, 3.1 units/mL) was added. In the case of synthesis of branched polysaccharide functionalized nanogels, glycogen branching enzyme (5 U/mL) was also added. Then the solution was incubated at 40 °C during the polymerization. The polymerization was monitored by an inorganic phosphate assay as described below. The polymerization was quenched by heating at 100 °C for 5 minutes. The coagulated protein was removed by filtration (0.45 µm PVDF filter), and the resulting solution was purified by dialysis (MWCO 1000) against distilled water for 3 days. Finally, the solution was lyophilized. Estimation of the degree of polymerization and the degree of branching. The reaction solution (30 µL) was taken from the system at each reaction time. This was added to 1470 µL of water and the solution was heated at 100 ºC for 5 minutes. To 0.20 mL of the solution, 0.80 mL of molybdate reagent (15 mM ammonium molybdate, 100 mM zinc acetate, pH was adjusted to 5.0 with 2 M HCl solution), and 0.2 mL of sodium ascorbic acid solution (10 wt %, pH = 5.0) were added. The mixture was incubated at 30 ºC for 15 minutes. The absorption of these solutions was measured with a JASCO V-570 spectrometer set to scan the 600−900 nm wavelength range. Samples were analyzed in a 10 mm quartz cuvette. The degree of branching (D.B.) of CbAmyPL was calculated from the following equation (5): 1. 3. % = 5 × 100/7 + 9 (5)


12

Page 13 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

, where a, b, and c are the amount of anomeric protons without non-reducing end, non-reducing end of anomeric protons and α(1,46) protons, respectively. Cell culture. Renca cells (kindly gifted from Prof. O. Mazda, Kyoto prefectural university of Medicine) were cultured in Roswell Park Memorial Institute medium (RPMI 1640) with 10 % fetal bovine serum (FBS) and 1 % antibiotic-antimycotic. Cells were incubated at 37 ºC in 5 % CO2. Cytotoxicity. Renca cells were plated into a 96 well plate at 2 × 104 cells/well and cultured for 24 hours at 37 ºC in 5 % CO2. The different concentrations of the polymer solutions were added to the medium. For the evaluation of effect on the presence of α-amylase, α-amylase (200 U/L) was added to each wells. The concentration of α-amylase is an average value in serum.55 After 24 hours incubation, the medium was removed and replaced with the fresh medium. Ten µL of the cell counting kit-8 (Dojindo Laboratories, Japan) reagent was then added to the medium and incubated for 2 hours. The UV absorbance at 450 nm was recorded with a plate reader (CORONA, SH-1000). Untreated cells were used as the 100 % cell viability control. The results were expressed as mean and standard deviation obtained from six samples. Preparation of the siRNA/nanogel complexes. The siRNA species used were siRNA targeting murine VEGF (MSS278684, Invitrogen (Carlsbad, CA, USA).); nonsense siRNA (MISSION siRNA Universal Negative Control, Sigma-Aldrich, St. Louis, MO, USA); and Allstars Neg. siRNA AF488 (Qiagen, Hilden, Germany). To form siRNA/nanogel complexes, each siRNA (1.0 µM, 15 µg/mL) and each nanogel ([cation] = 400 nM) was mixed gently and incubated for 30 minutes at room temperature.


13

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 43

Cellular uptake of the nanogels into Renca cells. Confocal laser scanning microscopy observation: Renca cells were seed in a 4 well glass-bottom dish (Matsunami, JAPAN) at 1 × 104 cells/dish and cultured for 24 hours at 37 °C in 5 % CO2. The medium containing CPLrhodamine, CMaPL-rhodamine, CbAmyPL-rhodamine, and CbAmyPL-rhodamine in the presence of α-amylase (200 U/L) was then added to the cells. The final concentration of polymers is 1 µg/ml. After incubation for 4 hours at 37 °C in 5% CO2, the medium was removed and the fresh medium was replaced. The cells were washed with the medium three times with PBS and were visualized by a CLSM (Carl Zeiss LSM 780) at a magnification of 40 × with excitation by a DPSS laser (561 nm) for rhodamine B. Flow cytometry: Renca cells were plated in 6-well plates (2 × 105 cells/well) the day before adding Alexa Fluor 488-siRNA-loaded nanogels (800 pmol/mL Alexa Fluor 488-siRNA), prepared as described above. After 4 hours incubation, the cells were washed twice with PBS, trypsinized and diluted with 7 mL cell culture medium. Following centrifugation, the cell pellet was resuspended in flow buffer and placed on ice until the analysis. The cells were analyzed using a Beckman Coulter Cytomics FC500 flow cytometer. Generally, a minimum of 5 × 103 cells were analyzed in each measurement. Agarose gel electrophoresis. siRNA/nanogel complexes were prepared in RNase free water at different C/P ratios of 0−8 ([siRNA]= 1 µM). The complex solutions were loaded on 2 % (w/v) agarose gels (40 mM Tris-acetate, 1 mM EDTA). Electrophoresis was performed for 30 minutes at 100 V, and siRNA were visualized by staining the gels with Sybr green in TAE solution (40 mM Tris-acetate, 1 mM EDTA) for 1 hour at room temperature. Electrophoresis profiles were observed with an ImageQuant LAS-4000 (GE healthcare).


14

Page 15 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Forster energy resonance transfer (FRET) assay. Alexa Fluor 488-siRNA and rhodamine modified CbAmyPL nanogel solution was mixed and incubated for 30 minutes at room temperature. Before measuring fluorescence spectra, α-amylase (200 U/L) was added to the siRNA/nanogel solution. Five micro litter of the sample solution were collected at various time intervals and fluorescence emission spectra were measured with a fluorescent spectrometer (FP8500, JASCO) equipped with a one-drop measurement unit (SAF-851, JASCO). Exciting wavelength was 495 nm and recording the emission spectrum in the range 500−650 nm. The scan speed and the slit widths were 100 nm/minute and 5.0 nm, respectively. Alexa Fluor 488/CbAmyPL-rhodamine nanogel before adding α-amylase and in the presence of chondroitin sulfate (0.1 mg/ml) was used as 100 % complexed control and complete dissociated control, respectively. In the case of evaluation of stability of the complexes in the presence of RNase A or BSA, RNase (15 mU/ml) and BSA (40 mg/ml) was mixed. siRNA transfection in vitro and RNA isolation. Renca cells, cultured in RPMI1640 medium supplemented with 100 U/mL penicillin, 100 �g/mL streptomycin, and 10 % FBS, were seeded into 12-well tissue culture plates (5 × 104 cells per well) at 37 ºC in 5 % CO2 / 95 % humidified air. After 24 hours, siRNA/nanogel complexes in Opti-MEM were added to the cells and incubation was continued for 4 hours. After 24 hours, total RNA was collected by Maxwell RSC simply RNA Cells according to the manufacturer’s instructions. Quantitative real-time PCR. For measurement of VEGF RNA expression, q-PCR was performed using LightCycler 480 Probe master (Roche). For the detection of VEGF mRNA, cDNA was synthesized from 500 ng of total RNA using the reverse reaction kit (ReverTra Ace qPCR RTMaster Mix (Toyobo, Japan)) with the manufacturer’s instruction. A LightCycler 480


15

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Real-Time PCR System (Roche) was used for quantitative mRNA detection. The relative expression levels of mRNA were normalized to the expression of 18S ribosomal RNA. The expression of the gene was quantified by measuring cycle threshold (Ct) values and normalized using 2−∆∆Ct Ct method relative to 18S ribosomal RNA.


16

Page 16 of 43

Page 17 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

RESULTS AND DISCUSSION Synthesis and self-assembly of maltopentaose-functionalized cholesteryl polypeptides. We first synthesized maltopentaose functionalized cholesteryl poly-l-lysine (denoted as CMaPL) as previously described.51 The synthetic scheme is outlined in Scheme 2. Briefly, cholesteryl N-(6isocyanatohexyl) carbamate was reacted with poly-l-lysine (Mw:1.1 × 104 g/mol) in the presence of triethylamine to yield cholesteryl poly-l-lysine (CPL, Figure S1), followed by reductive amination of cholesteryl poly-l-lysine with maltopentaose (Figure S2). The degrees of cholesteryl group and maltopentaose substitution on poly-l-lysine are shown in Table 1. We first examined the self-assembly behavior of CMaPL in PBS buffer. A TEM image showed positively stained spherical objects with an average size of 30 nm (Figure 1A), in good agreement with DLS measurements (Figure 1B). The synchrotron small angle x-ray scattering (SAXS) profile showed a slope of zero in the low q region, indicating the presence of isolated scattering objects (Figure 1C). From the slope of the Guinier plot (Figure 1C inset), the radius of gyration (Rg) of these particles was determined to be 7.4 nm. The ratio of Rg/Rh (ρ factor) reflects the structure of aggregates (e.g. hard sphere, coil and rod give ρ values of 0.77, 0.82 and 1.73, respectively). The ρ factor of CMaPL was close to 0.5, which was smaller than that of cholesteryl pullulan (CHP) nanogel (0.8).9 This indicates that CMaPL has a more compact structure compared with CHP nanogel. This may be because of high degree of substitution of cholesteryl group, causing polymer compact, compared with CHP. Additionally, CMaPL showed no detectable size changes for up to 10 days in PBS (Figure S3). To obtain further structural information about the CMaPL particles, we conducted SECMALS measurements (Table 1). The apparent molecular weight of CMaPL particles in aqueous


17

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 43

solution was 2.1 × 105 g/mol (Figure S4). Based on the polymer molecular weights and hydrodynamic radii, the association number of CMaPL aggregates was 6.4. The average polymer density (Φ) of CMaPL, calculated from the experimental RH and Mw values, was 0.02 g/ml. This indicated that the CMaPL nanoparticles were composed of approximately 0.2 wt % polymer and 99.8 wt % water. The aggregation number of cholesterol domains (Ndomain) was further investigated using fluorescence quenching (Table 1 and Figure S5). The self-assembled CMaPL contained approximately 3.6 isolated hydrophobic nanodomains, indicating that it formed a physically crosslinked nanogel in aqueous solution (Figure 1D).

Enzymatic synthesis of linear- and branched-polysaccharide functionalized polypeptide nanogels. Having confirmed their self-assembled structure, we next prepared linear and branched polysaccharide functionalized polypeptides from CMaPL nanogels, through a combination of GP and GPE catalyzed reactions, as shown in Figure 2A. GP catalyzes addition of a glucose unit from glucose monophosphate to the non-reducing end of a maltooligosaccharide56, while GBE catalyzes cleavage of the saccharide chains and transfers them from α(1,4) to α(1,6) positions. Accordingly, the tandem enzymatic reaction using GP and GBE should produce branched polysaccharide chains. The reaction mixture contained GP (2 unit/ml) and GBE (2 unit/ml) in the presence of CMaPL (0.5 mM, based on maltopentaose unit equivalents) and glucose monophosphate (7.5 mM) at 40 °C. The reaction was quenched by heating at 100 °C for 5 min. This treatment did not affect on the size distribution of CMaPL and the resulting branched polysaccharide functionalized nanogel (Figure S6). The resulting solution was filtered, purified by dialysis and lyophilized.


18

Page 19 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 2B shows time−conversion plots for CMaPL prepared with either GP or the combination of GP and GBE, with reactions monitored by an inorganic phosphate assay. The degree of polymerization (D.P.) increased with increasing reaction time, indicating that both enzymatic polymerizations were successful. Interestingly, the initial reaction velocity of the tandem reaction was 2.6-fold faster than that of the GP catalyzed polymerization. A potential explanation would be an increase in apparent primer (i.e., malto-oligosaccharide) concentration on the nanogel surface, which would enhance substrate binding, in the tandem reaction. Compared with conventional chemical modification of nanoparticles with biodegradable polymers, one of the main advantages of enzymatic polymerization is controlled functionalization to attain the desired polysaccharide molecular weight. In general, naturally occurring biodegradable polymers are high molecular weight molecules. Thus the polymers must be hydrolyzed to their optimal molecular weights. This procedure is usually cumbersome and difficult to control. On the other hand, enzymatic polymerization by phosphorylases enables preparation of the desired molecular weight amylose polymers by adjusting glucose monophosphate/primer ratios. The molecular weights of biodegradable polymers can affect the kinetics of their enzymatic hydrolysis. Our system might be, therefore, more reproducible and make it easier to optimize polysaccharide molecular weights for subsequent enzyme-catalyzed degradation. We used 1H-NMR spectroscopy to demonstrate formation of branching polysaccharides. Figure 2C shows a comparison between the 1H-NMR spectra of nanogels prepared using the tandem enzymatic and GP catalyzed reactions, in DMSO-d6/D2O (9/1). After the tandem enzymatic reaction, a new peak appeared at 4.7 ppm (peak c), corresponding to the anomeric protons derived from the glycoside connected at the α(1,6) position. The degree of branching


19

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 43

(D.B.) of CbAmyPL was calculated as 5.5 % from the NMR measurements. These results clearly indicated that the tandem enzymatic reaction produced branched polysaccharides. We denote the branched polysaccharide functionalized nanogels as CbAmyPL. The TEM image of CbAmyPL showed spherical objects with an average diameter of 50 nm (Figure S7). The hydrodynamic diameter of CbAmyPL (62 nm) nanogels was slightly larger than that of CMaPL (32 nm), while their ζ-potential was significantly lower, to a neutral value (+2 mV), consistent with the conclusion that branched polysaccharide chains covered the cationic surface of the nanogel. The difference in the size between CbAmyPL and CMaPL might be due to the change in aggregation number. Of note, the colloidal stability of CbAmyPL in phosphate buffered saline (PBS) was much greater than that of CAmyPL, which is a linear amylose-coated nanogel. As shown in Figure 2D, a CbAmyPL nanogel solution remained clear even after 1 wk incubation, while a CAmyPL solution became turbid. This difference can be attributed to the molecular structures of the polysaccharide moieties. The amylose chains of CAmyPL can form intermolecular double helices, forming large aggregates. In contrast, the branched polysaccharide chains of CbAmyPL could not form double helices because of steric hindrance, potentially enhancing colloidal stability of the nanogels. Due to the low colloidal stability of CAmyPL in aqueous solution, we conducted further biological evaluation only for CbAmyPL.

Cytotoxicity of the nanogels, complex formation with siRNA and complex stability. Because low cytotoxicity is an essential property for drug carriers, we next used the WST-8 assay to determine cytotoxicity of our nanogel, at concentrations from 1 to 100 µg/ml, in Renca cells


20

Page 21 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

(Figure 3A). Cell viability drastically decreased with increasing concentrations of CPL and CMaPL, whereas viability was not significantly changed in cells exposed to CbAmyPL nanogel below the concentration of 50 µg/ml. At 100 µg/ml of CbAmyPL, cell viability slightly decreased. The neutral charge surface, caused by coating with a branched polysaccharide layer, is a potential explanation for this low cytotoxicity. It should be noted that, although CbAmyPL nanogels have neutral ζ potential values, they can form complexes with siRNA. The efficiency of CbAmyPL nanogel binding to siRNA was evaluated at different C/P ratios (number of cationic groups in the polymer/number of phosphate groups in the siRNA), using agarose gel electrophoresis, with results shown in Figure 3B. The band intensity of free siRNA gradually decreased with increasing C/P ratio and disappeared at C/P ratios greater than 2. This indicated that almost all siRNA formed the complexes with CbAmyPL nanogels above a C/P ratio of 2. The hydrodynamic diameter and ζ-potential of CbAmyPL/siRNA complexes at C/P=8 were determined as 60 ± 2 nm and +3 ± 0 mV, respectively (Table S1). The ability to avoid destabilization and/or nonspecific interactions with blood components are prerequisites for nucleic acid delivery carriers. Thus, we investigated complex stability in the presence of RNase A or bovine serum albumin (BSA), using Forster energy resonance transfer (FRET). Upon addition of Alexa fluor 488 labeled siRNA to a solution of rhodamine labeled CbAmyPL nanogels, we observed that Alexa fluor 488 fluorescence was markedly decreased and that of rhodamine was increased, because of FRET between the two indicator dyes (Figure 3C). The ratio of the fluorescence intensity at 520 nm (Alexa fluor 488) and at 577 nm (rhodamine B) was subsequently used as an index of complexation. In the presence of RNase A, the siRNA/CbAmyPL complex retained an equivalent fluorescence ratio (complexation ratio),


21

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 43

even after incubation for 1440 min (Figures 3C and D). This indicated that siRNA remained stably encapsulated in the CbAmyPL nanogels. Moreover, CbAmyPL formed stable complexes with siRNA, even in the presence of BSA (Figure S8).

Enzymatic degradation of the branched polysaccharide shells of CbAmyPL nanogels. After showing that CbAmyPL nanogels were not cytotoxic and formed stable complexes with siRNA, we examined biodegradation of the branched polysaccharide shells by α-amylase. We hypothesized that α-amylase would hydrolyze the surface branched polysaccharides, changing the ζ-potential from neutral to positive. To test this hypothesis, the ζ-potentials and hydrodynamic diameters of CbAmyPL (1 mg/ml), in the presence of α-amylase (200 U/l), were measured at various time intervals. As shown in Figure 4A, the hydrodynamic radius immediately decreased to approximately 30 nm after α-amylase addition. Additionally, the ζpotential increased to a slightly positive value, indicating that surface polysaccharide had been hydrolyzed and the poly-l-lysine core exposed. The amylase concentrations used in this study were comparable to those in serum (110–300 U/l)55, indicating that the branched polysaccharide shells of our nanogels could be degraded by serum α-amylase. We then investigated stability of Alexa 488-siRNA/rhodamine-CbAmyPL nanogel complexes in the presence of α-amylase by FRET (Figure 4B). FRET ratios were almost constant for 24 h, suggesting that hydrolysis of branched polysaccharides did not cause dissociation of siRNA/CbAmyPL complexes.


22

Page 23 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Cytotoxicity is a potential concern for enzymatically-degraded nanogels. Because the charge of the nanogel surface becomes weakly cationic after degradation, the nanogels may become more cytotoxic. Thus, we evaluated cytotoxicity of CbAmyPL nanogels in the presence of αamylase. Contrary to our expectations, enzymatically degraded nanogels showed no significant cytotoxicity to Renca cells. (Figure 4C) Knockdown potential of VEGF siRNA/CbAmyPL nanogel complexes. After demonstrating that CbAmyPL nanogels formed complexes with siRNA and were enzymatic degraded, we evaluated the knockdown effects of a CbAmyPL nanogel based siRNA delivery system. VEGF mRNA levels were evaluated by real-time PCR analysis and were normalized to those in cells incubated with the corresponding nonsense siRNA complexes. Renca cells were treated with siRNA/CPL, siRNA/CMaPL, siRNA/CbAmyPL or siRNA/CbAmyPL in the presence of αamylase. As shown in Figure 5A, VEGF mRNA levels were only slightly decreased, to approximately 80 %, in cells incubated with siRNA/CbAmyPL complexes. In contrast, levels of VEGF mRNA in cells incubated with siRNA/CbAmyPL complexes and α-amylase were significantly decreased (to approximately 50 % of control mRNA levels), almost comparable to those achieved with siRNA/CPL or siRNA/CMaPL complexes. This enhancement of the RNAi effect by α-amylase can be explained by differences in surface properties of the complexes. CbAmyPL, having a ζ-potential value of approximately 0, would be only minimally internalized into cells because of its low affinity for the cell membrane. In contrast, enzymatically degraded CbAmyPL had positive ζ-potential values (Figure 5A). This would enhance its cellular internalization, increasing its gene silencing effects. In fact, cellular internalization of siRNA/CbAmyPL complexes in the presence of α-amylase was, to some extent, greater than that of siRNA/CbAmyPL complexes, as observed by CLSM (Figure S9, lower left and right).


23

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 43

Moreover, cellular fluorescence intensity of Alexa 488 siRNA/CbAmyPL, administered with αamylase, was higher than that observed for the labeled complex without α-amylase (Figure 5b). Although the cellular fluorescence intensity of Alexa 488 siRNA/CbAmyPL was somewhat higher than that of Alexa 488 siRNA/CPL and Alexa 488 siRNA/CMaPL, the knockdown effect was lower with compared with that of Alexa 488 siRNA/CPL and Alexa 488 siRNA/CMaPL. This difference might be due to the stabilities of siRNA/nanogel complexes. Partially hydrolyzed polysaccharide shell might still be present and reduce the exchange reaction between siRNA and proteins inside living cells. The siRNA/CbAmyPL complexes therefore showed lower knockdown efficiency. Together, these results strongly supported our hypothesis that enzymatically degradable nanogels would facilitate cellular internalization and enhance RNAi effects.

CONCLUSIONS In conclusion, we designed nanogels with modifiable surface charges, based on their coating with branched polysaccharide functionalized cholesteryl poly-l-lysine. The nanogels were prepared from maltopentaose modified cholesteryl poly-l-lysine using tandem enzymatic polymerization, combining a phosphorylase with a branching enzyme. The branched polysaccharide shielded the surface positive charges of the CMaPL nanogels. The resulting nanogels, therefore, exhibited low cytotoxicity for Renca cells. The branched polysaccharide functionalized nanogels formed stable complexes with siRNA, even in the presence of blood components, because the branched polysaccharide layer blocked accessibility. The ζ-potential value of the nanogel was switched from neutral to positive by α-amylase-catalyzed hydrolysis of the branched polysaccharide, facilitating the cellular internalization and knockdown effects of


24

Page 25 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

VEGF siRNA/CbAmyPL nanogel complexes. We believe that our system is potentially promising for systemic gene delivery therapy. Future research on the applicability of our approach, therefore, should include evaluating these novel gene carriers in vivo.


25

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 43

------------------------------------------------- Two Columns ------------------------------------------------Branched polysaccharide layer

Neutral surface

Hydrolyzed sugar residue Cationic surface

siRNA Complexation

α-Amylase Enzymatic degradation

Branched polysaccharide bearing Polypeptide nanogel

Poor cell internalization & Gene knockdown

Enhanced cell internalization & Gene knockdown

Scheme 1. Schematic illustration of enzyme-responsive polypeptide nanogels for siRNA delivery.


26

Page 27 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

------------------------------------------------- Two Columns -------------------------------------------------

Scheme 2. Synthetic scheme for maltopentaose functionalized cholesteryl poly-l-lysine


27

Biomacromolecules

------------------------------------------------- Two Columns -------------------------------------------------

50 nm

3

2 0 z a v e r a g e :3 2 .0 n m P D I:0 .2 6

0 C 1

5.5

1 5

1 0

6.0 Ln(I( q))

B

I( q )( a .u .)

A

In te n s ity ( % )

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 43

2

5.0 4.5

1 0

4.0 1 2 3 4 5 6 2

2

-2

×10 q (nm )

1

1 0

5 0

1 0

0 0 .1

1 1 0 1 0 0 1 0 0 0 D ia m e te r( n m )

0 .1

1 1 q (nm )

D Maltopentaose

Self-assembly Cholesterol PLL

CMaPL CMaPL nanogel Figure 1. (A) TEM image and (B) size distribution obtained from DLS measurements of self-

assembled CMaPL (1 mg/ml) in PBS. (C) SAXS profile of self-assembled CMaPL (1 mg/ml) in PBS. Inset: Guinier plot ln(I(q)) vs. q2 for the CMaPL solution. (D) Schematic illustration of self-assembled polypeptide nanogels.


28

Page 29 of 43

------------------------------------------------- Two Columns -------------------------------------------------

Branched amylose layer

A

B D e g r e e o fp o ly m e r iz a tio n

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

GP GBE

CbAmyPL Amylose layer GP

CMaPL

2 0 1 5 1 0 5 G P G P + G B E

0

0 5 1 01 52 02 53 0 T im e ( h o u r )

C

b

(

a

b

(

CAmyPL a c

)

D

n

a

a

)

a

m

CbAmyPL

b c

CAmyPL

5.5 5 .5

5.0 5 .0

4.5 .5 ppm 4

CbAmyPL CAmyPL

4.0 4 .0

Figure 2. (A) Schematic illustration of enzymatic polymerizations. (B) Time-course showing the number of glucose molecules incorporated into CMaPL. (C) 1H-NMR spectra of CbAmyPL and CAmyPL in DMSO-d6/D2O (9/1). (D) Photograph of CbAmyPL and CAmyPL solution at 1 wk after enzymatic polymerization.


29

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

------------------------------------------------- Two Columns -------------------------------------------------

Figure 3. (A) Viability of Renca cells incubated with CPL, CMaPL and CbAmyPL. (B) Agarose gel electrophoresis of siRNA/CbAmyPL complexes at different C/P ratios. (C) FRET assay results for Alexa488-siRNA/rhodamine-CbAmyPL complexes. (D) Changes in complexation ratios of Alexa488-siRNA/rhodamine-CbAmyPL complexes in the presence of RNase A (15 mU/ml), evaluated by FRET.


30

Page 30 of 43

Page 31 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

------------------------------------------------- Two Columns -------------------------------------------------

Figure 4. (A) Effects of α-amylase on the hydrodynamic diameter and ζ-potential of CbAmyPL. (B) Changes in complexation ratios in the presence of α-amylase (200 U/l) with time. (C) Effects of CbAmyPL on cell viability in the presence of α-amylase.


31

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

------------------------------------------------- One Column -------------------------------------------------

Figure 5. (A) Gene silencing effects of siRNA/CPL, siRNA/CMaPL, siRNA/CbAmyPL and siRNA/CbAmyPL plus α-amylase. (B) Average cellular fluorescence intensities of Alexa488siRNA in Renca cells, evaluated by FACS.


32

Page 32 of 43

Page 33 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Table 1. Physical parameters of CPL and CMaPL in aqueous solution Sample

D.S. of

D.S. of

M wb

Association

Hydrodynamic

ζ-

Φc

cholesterola

Maltopentaosea

(g/mol)

number

diameter

potential

(g/ml)

(nm)

(mV)

NChold

Ndomaine

CPL

10

0

n.d.

n.d.

46±2

38±3

n.d.

n.d.

n.d.

CMaPL

10

29

2.1×105

6.4

32±2

29±2

0.02

9.3±0.8

3.6±0.3

a

number of substituted moieties per 100 lysine units;b weight average molecular weight

of the nanogels;c the average density of the nanogels;d the aggregation number of cholesteryl group in one hydrophobic domain;e the average number of hydrophobic cholesteryl domains; n.d., not determined


33

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ASSOCIATED CONTENT Supporting Information. The Supporting Information is available free of charge on the ACS Publications website at XXX. 1

H-NMR of spectra of CPL and CMaPL. SEC-MALS chromatogram of CMaPL. The stability of

CMaPL in PBS. The ratio of fluorescence intensity I (presence of a quencher) to I0 (absence of a quencher) of pyrene fluorescence. The size distribution of CMaPL and CbAmyPL before and after heat treatment. TEM image of CbAmyPL. FRET assay and agarose gel electrophoresis of siRNA/CbAmyPL in the presence of BSA. CLSM images of Renca cells treated with CPL, CMaPL, CbAmyPL, and CbAmyPL in the presence of α-amylase. Physical parameters of CbAmyPL and siRNA/CbAmyPL the complexes.

AUTHOR INFORMATION Corresponding Author * Corresponding author: Kazunari Akiyoshi, E-mail: [email protected]

Author Contributions The manuscript was written with contributions from all authors. All authors approved the final version of the manuscript.


34

Page 34 of 43

Page 35 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

ACKNOWLEDGMENTS This work was supported by the Exploratory Research for Advanced Technology program of the Japan Science and Technology Agency (JST-ERATO) and JSPS Grant-in-Aid Scientific Research (S) (Grant No. 16H06313). The SAXS experiments were conducted at the BL40B2 of SPring-8 (Proposal No. 2017A1241).


35

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

REFERENCES 1.

Hamidi, M.; Azadi, A.; Rafiei, P., Hydrogel nanoparticles in drug delivery. Adv. Drug

Deliv. Rev. 2008, 60, 1638-1649. 2.

Kabanov, A. V.; Vinogradov, S. V., Nanogels as Pharmaceutical Carriers: Finite

Networks of Infinite Capabilities. Angew. Chem. Int. Ed. 2009, 48, 5418-5429. 3.

Raemdonck, K.; Demeester, J.; De Smedt, S., Advanced nanogel engineering for drug

delivery. Soft Matter 2009, 5, 707-715. 4.

Li, Y.; Maciel, D.; Rodrigues, J.; Shi, X.; Tomás, H., Biodegradable Polymer Nanogels

for Drug/Nucleic Acid Delivery. Chem. Rev. 2015, 115, 8564-8608. 5.

Sierra-Martin, B.; Fernandez-Barbero, A., Multifunctional hybrid nanogels for

theranostic applications. Soft Matter 2015, 11, 8205-8216. 6.

Molina, M.; Asadian-Birjand, M.; Balach, J.; Bergueiro, J.; Miceli, E.; Calderon, M.,

Stimuli-responsive nanogel composites and their application in nanomedicine. Chem. Soc. Rev. 2015, 44, 6161-6186. 7.

Sasaki, Y.; Akiyoshi, K., Nanogel engineering for new nanobiomaterials: from

chaperoning engineering to biomedical applications. Chem. Rec. 2010, 10, 366-376. 8.

Chacko, R. T.; Ventura, J.; Zhuang, J.; Thayumanavan, S., Polymer nanogels: A versatile

nanoscopic drug delivery platform. Adv. Drug Deliv. Rev. 2012, 64, 836-851. 9.

Akiyoshi, K.; Deguchi, S.; Moriguchi, N.; Yamaguchi, S.; Sunamoto, J., Self-aggregates

of hydrophobized polysaccharides in water. Formation and characteristics of nanoparticles. Macromolecules 1993, 26, 3062-3068. 10.

Lee, K. Y.; Kwon, I. C.; Kim, Y. H.; Jo, W. H.; Jeong, S. Y., Preparation of chitosan self-

aggregates as a gene delivery system. J. Control. Release 1998, 51, 213-220.


36

Page 36 of 43

Page 37 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

11.

Nagahama, K.; Mori, Y.; Ohya, Y.; Ouchi, T., Biodegradable Nanogel Formation of

Polylactide-Grafted Dextran Copolymer in Dilute Aqueous Solution and Enhancement of Its Stability by Stereocomplexation. Biomacromolecules 2007, 8, 2135-2141. 12.

Akiyama, E.; Morimoto, N.; Kujawa, P.; Ozawa, Y.; Winnik, F. M.; Akiyoshi, K., Self-

Assembled Nanogels of Cholesteryl-Modified Polysaccharides: Effect of the Polysaccharide Structure on Their Association Characteristics in the Dilute and Semidilute Regimes. Biomacromolecules 2007, 8, 2366-2373. 13.

Takahashi, H.; Sawada, S.-i.; Akiyoshi, K., Amphiphilic Polysaccharide Nanoballs: A

New Building Block for Nanogel Biomedical Engineering and Artificial Chaperones. ACS Nano 2011, 5, 337-345. 14.

Nakai, T.; Hirakura, T.; Sakurai, Y.; Shimoboji, T.; Ishigai, M.; Akiyoshi, K., Injectable

Hydrogel for Sustained Protein Release by Salt-Induced Association of Hyaluronic Acid Nanogel. Macromol. Biosci. 2012, 12, 475-483. 15.

Akiyoshi, K.; Ueminami, A.; Kurumada, S.; Nomura, Y., Self-Association of

Cholesteryl-Bearing Poly(l-lysine) in Water and Control of Its Secondary Structure by Host− Guest Interaction with Cyclodextrin. Macromolecules 2000, 33, 6752-6756. 16.

Sekine, Y.; Endo, H.; Iwase, H.; Takeda, S.; Mukai, S.-a.; Fukazawa, H.; Littrell, K. C.;

Sasaki, Y.; Akiyoshi, K., Nanoscopic Structural Investigation of Physically Cross-Linked Nanogels Formed from Self-Associating Polymers. J. Phys. Chem. B 2016, 120, 11996-12002. 17.

Nochi, T.; Yuki, Y.; Takahashi, H.; Sawada, S.-i.; Mejima, M.; Kohda, T.; Harada, N.;

Kong, I. G.; Sato, A.; Kataoka, N.; Tokuhara, D.; Kurokawa, S.; Takahashi, Y.; Tsukada, H.; Kozaki, S.; Akiyoshi, K.; Kiyono, H., Nanogel antigenic protein-delivery system for adjuvantfree intranasal vaccines. Nat Mater 2010, 9, 572-578.


37

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

18.

Muraoka, D.; Harada, N.; Hayashi, T.; Tahara, Y.; Momose, F.; Sawada, S.-i.; Mukai, S.-

a.; Akiyoshi, K.; Shiku, H., Nanogel-Based Immunologically Stealth Vaccine Targets Macrophages in the Medulla of Lymph Node and Induces Potent Antitumor Immunity. ACS Nano 2014, 8, 9209-9218. 19.

Tahara, Y.; Akiyoshi, K., Current advances in self-assembled nanogel delivery systems

for immunotherapy. Adv. Drug Deliv. Rev. 2015, 95, 65-76. 20.

Toita, S.; Morimoto, N.; Akiyoshi, K., Functional Cycloamylose as a Polysaccharide-

Based Biomaterial: Application in a Gene Delivery System. Biomacromolecules 2010, 11, 397401. 21.

Vinogradov, S.; Batrakova, E.; Kabanov, A., Poly(ethylene glycol)–polyethyleneimine

NanoGel™ particles: novel drug delivery systems for antisense oligonucleotides. Colloids and Surfaces B: Biointerfaces 1999, 16, 291-304. 22.

Vinogradov, S. V.; Batrakova, E. V.; Kabanov, A. V., Nanogels for Oligonucleotide

Delivery to the Brain. Bioconjugate. Chem. 2004, 15, 50-60. 23.

Toita, S.; Soma, Y.; Morimoto, N.; Akiyoshi, K., Cycloamylose-based Biomaterial:

Nanogel of Cholesterol-bearing Cationic Cycloamylose for siRNA Delivery. Chem. Lett. 2009, 38, 1114-1115. 24.

Tahara, Y.; Yasuoka, J.; Sawada, S.; Sasaki, Y.; Akiyoshi, K., Effective CpG DNA

delivery using amphiphilic cycloamylose nanogels. Biomater. Sci. 2015, 3, 256-264. 25.

Kedmi, R.; Ben-Arie, N.; Peer, D., The systemic toxicity of positively charged lipid

nanoparticles and the role of Toll-like receptor 4 in immune activation. Biomaterials 2010, 31, 6867-6875.


38

Page 38 of 43

Page 39 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

26.

Audouy, S. A. L.; de Leij, L. F. M. H.; Hoekstra, D.; Molema, G., In Vivo Characteristics

of Cationic Liposomes as Delivery Vectors for Gene Therapy. Pharm. Res. 2002, 19, 1599-1605. 27.

Hildebrandt, I. J.; Iyer, M.; Wagner, E.; Gambhir, S. S., Optical imaging of transferrin

targeted PEI/DNA complexes in living subjects. Gene Ther. 2003, 10, 758-764. 28.

Abu Lila, A. S.; Ishida, T.; Kiwada, H., Targeting Anticancer Drugs to Tumor

Vasculature Using Cationic Liposomes. Pharm. Res. 2010, 27, 1171-1183. 29.

Li, S.-D.; Huang, L., Stealth nanoparticles: High density but sheddable PEG is a key for

tumor targeting. J. Control. Release 2010, 145, 178-181. 30.

Tam, P.; Monck, M.; Lee, D.; Ludkovski, O.; Leng, E. C.; Clow, K.; Stark, H.; Scherrer,

P.; Graham, R. W.; Cullis, P. R., Stabilized plasmid-lipid particles for systemic gene therapy. Gene Ther 2000, 7, 1867-74. 31.

Hatakeyama, H.; Akita, H.; Harashima, H., A multifunctional envelope type nano device

(MEND) for gene delivery to tumours based on the EPR effect: A strategy for overcoming the PEG dilemma. Adv. Drug Deliv. Rev. 2011, 63, 152-160. 32.

Zhang, Y.; Satterlee, A.; Huang, L., In Vivo Gene Delivery by Nonviral Vectors:

Overcoming Hurdles? Mole. Ther. 2012, 20, 1298-1304. 33.

Choi, J. S.; MacKay, J. A.; Szoka, F. C., Low-pH-Sensitive PEG-Stabilized Plasmid−

Lipid Nanoparticles: Preparation and Characterization. Bioconjugate. Chem. 2003, 14, 420-429. 34.

Hama, S.; Itakura, S.; Nakai, M.; Nakayama, K.; Morimoto, S.; Suzuki, S.; Kogure, K.,

Overcoming the polyethylene glycol dilemma via pathological environment-sensitive change of the surface property of nanoparticles for cellular entry. J. Control. Release 2015, 206, 67-74.


39

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

35.

Kuai, R.; Yuan, W.; Qin, Y.; Chen, H.; Tang, J.; Yuan, M.; Zhang, Z.; He, Q., Efficient

delivery of payload into tumor cells in a controlled manner by TAT and thiolytic cleavable PEG co-modified liposomes. Mol. pharm. 2010, 7, 1816-1826. 36.

Ping, Y.; Hu, Q.; Tang, G.; Li, J., FGFR-targeted gene delivery mediated by

supramolecular assembly between β-cyclodextrin-crosslinked PEI and redox-sensitive PEG. Biomaterials 2013, 34, 6482-6494. 37.

Hatakeyama, H.; Akita, H.; Ito, E.; Hayashi, Y.; Oishi, M.; Nagasaki, Y.; Danev, R.;

Nagayama, K.; Kaji, N.; Kikuchi, H.; Baba, Y.; Harashima, H., Systemic delivery of siRNA to tumors using a lipid nanoparticle containing a tumor-specific cleavable PEG-lipid. Biomaterials 2011, 32, 4306-4316. 38.

Li, J.; Ge, Z.; Liu, S., PEG-sheddable polyplex micelles as smart gene carriers based on

MMP-cleavable peptide-linked block copolymers. Chem. Commun. 2013, 49, 6974-6976. 39.

Romberg, B.; Oussoren, C.; Snel, C. J.; Carstens, M. G.; Hennink, W. E.; Storm, G.,

Pharmacokinetics of poly(hydroxyethyl-l-asparagine)-coated liposomes is superior over that of PEG-coated liposomes at low lipid dose and upon repeated administration. Biochim. Biophys. Acta. 2007, 1768, 737-743. 40.

Duncan, R.; Gilbert, H. R. P.; Carbajo, R. J.; Vicent, M. J., Polymer Masked−Unmasked

Protein Therapy. 1. Bioresponsive Dextrin−Trypsin and −Melanocyte Stimulating Hormone Conjugates Designed for α-Amylase Activation. Biomacromolecules 2008, 9, 1146-1154. 41.

Hardwicke, J.; Ferguson, E. L.; Moseley, R.; Stephens, P.; Thomas, D. W.; Duncan, R.,

Dextrin–rhEGF conjugates as bioresponsive nanomedicines for wound repair. J. Control. Release 2008, 130, 275-283.


40

Page 40 of 43

Page 41 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

42.

Zhang, W.; Cheng, Q.; Guo, S.; Lin, D.; Huang, P.; Liu, J.; Wei, T.; Deng, L.; Liang, Z.;

Liang, X.-J.; Dong, A., Gene transfection efficacy and biocompatibility of polycation/DNA complexes coated with enzyme degradable PEGylated hyaluronic acid. Biomaterials 2013, 34, 6495-6503. 43.

Noga, M.; Edinger, D.; Rödl, W.; Wagner, E.; Winter, G.; Besheer, A., Controlled

shielding and deshielding of gene delivery polyplexes using hydroxyethyl starch (HES) and alpha-amylase. J. Control. Release 2012, 159, 92-103. 44.

Noga, M.; Edinger, D.; Kläger, R.; Wegner, S. V.; Spatz, J. P.; Wagner, E.; Winter, G.;

Besheer, A., The effect of molar mass and degree of hydroxyethylation on the controlled shielding and deshielding of hydroxyethyl starch-coated polyplexes. Biomaterials 2013, 34, 2530-2538. 45.

Nishimura, T.; Akiyoshi, K., Amylose engineering: phosphorylase-catalyzed

polymerization of functional saccharide primers for glycobiomaterials. Wiley Interdiscip. Rev. Nanomed. Nanobiotechnol. 2017, 9, e1423. 46.

Park, J. T.; Rollings, J. E., Effects of substrate branching characteristics on kinetics of

enzymatic depolymerizaion of mixed linear and branched polysaccharides: I. Amylose/amylopectin α-amylolysis. Biotechnology and Bioengineering 1994, 44, 792-800. 47.

Hinrichs, W.; BÜTtner, G.; Steifa, M.; Betzel, C. H.; Zabel, V.; PfannemÜLler, B.;

Saenger, W., An Amylose Antiparallel Double Helix at Atomic Resolution. Science 1987, 238, 205. 48.

Gidley, M. J., Molecular mechanisms underlying amylose aggregation and gelation.

Macromolecules 1989, 22, 351-358.


41

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

49.

Nishimura, T.; Mukai, S.-a.; Sawada, S.-i.; Akiyoshi, K., Glyco Star Polymers as Helical

Multivalent Host and Biofunctional Nano-Platform. ACS Macro Letters 2015, 4, 367-371. 50.

Takata, Y.; Yamamoto, K.; Kadokawa, J.-i., Preparation of pH-Responsive Amphoteric

Glycogen Hydrogels by α-Glucan Phosphorylase-Catalyzed Successive Enzymatic Reactions. Macromol. Chem. Phys. 2015, 216, 1415-1420. 51.

Morimoto, N.; Yamazaki, M.; Tamada, J.; Akiyoshi, K., Polysaccharide-Hair Cationic

Polypeptide Nanogels: Self-Assembly and Enzymatic Polymerization of Amylose PrimerModified Cholesteryl Poly(l-lysine). Langmuir 2013, 29, 7509-7514. 52.

van der Vlist, J.; Palomo Reixach, M.; van der Maarel, M.; Dijkhuizen, L.; Schouten, A.

J.; Loos, K., Synthesis of Branched Polyglucans by the Tandem Action of Potato Phosphorylase and Deinococcus geothermalis Glycogen Branching Enzyme. Macromol. Rapid Commun. 2008, 29, 1293-1297. 53.

Ciric, J.; Loos, K., Synthesis of branched polysaccharides with tunable degree of

branching. Carbohydr. Polym. 2013, 93, 31-37. 54.

Tahara, Y.; Sakiyama, M.; Takeda, S.; Nishimura, T.; Mukai, S.-a.; Sawada, S.-i.; Sasaki,

Y.; Akiyoshi, K., Self-Assembled Nanogels of Cholesterol-Bearing Hydroxypropyl Cellulose: A Thermoresponsive Building Block for Nanogel Tectonic Materials. Langmuir 2016, 32, 1228312289. 55.

Yadav, D.; Agarwal, N.; Pitchumoni, C. S., A critical evaluation of laboratory tests in

acute pancreatitis. Am J Gastroenterol 2002, 97, 1309-1318. 56.

Kadokawa, J.-i., Precision Polysaccharide Synthesis Catalyzed by Enzymes. Chem. Rev.

2011, 111, 4308-4345.


42

Page 42 of 43

Page 43 of 43

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

For TOC use only α-amylase Enzym at ic degr adat ion

Poor cell int er nalizat ion & Gene k nockdown

Enhanced cell int er nalizat ion & Gene knockdown

Self-assembled Polypeptide Nanogels with Enzymatically Transformable Surface as an siRNA Delivery Platform. Tomoki Nishimura, Akina Yamada, Kaori Umezaki, Shin-ichi Sawada, Sada-atsu Mukai, Yoshihiro Sasaki, Kazunari Akiyoshi*


43

Self-Assembled Polypeptide Nanogels with ... - ACS Publications

Recommend Documents