Silencing PRDX3 Inhibits Growth and Promotes ... - ACS Publications

Subscriber access provided by ACADEMIA SINICA

Article

Silencing PRDX3 inhibits growth and promotes invasion and extracellular matrix degradation in hepatocellular carcinoma cells Zhilei Liu, Yadong Hu, Haisha Liang, Zhongyuan Sun, Shan Feng, and Haiteng Deng J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/acs.jproteome.5b01125 • Publication Date (Web): 16 Mar 2016 Downloaded from http://pubs.acs.org on March 17, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Proteome Research is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

Silencing PRDX3 inhibits growth and promotes invasion and extracellular matrix degradation in hepatocellular carcinoma cells

Zhilei Liu1, Yadong Hu1, Haisha Liang1, Zhongyuan Sun2, Shan Feng1, Haiteng Deng1,2*

1. MOE Key Laboratory of Bioinformatics, School of Life Sciences, Tsinghua University, Beijing, China 2. Center of Biomedical Analysis, Tsinghua University, Beijing, China

* To whom correspondence should be addressed: Haiteng Deng, School of Life Sciences, Tsinghua University, Beijing, 100084 China, Tel: 8610-62790498; Fax: 8610-62797154; E_mail: [email protected]

1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract PRDX3 is a mitochondrial peroxide reductase that regulates cellular redox state. It has been reported that PRDX3 is overexpressed in liver cancer, but how PRDX3 is involved in hepatocellular carcinoma (HCC) tumorigenesis and progression has not been well characterized. In the present study, we established two stable cell lines by overexpressing or knocking down PRDX3 in HepG2 cells. We found that PRDX3 silencing decreased the growth rate of HepG2 cells and increased mtDNA oxidation. Quantitative proteomics identified 475 differentially expressed proteins between the PRDX3 knockdown and the control cells. These proteins were involved in antioxidant activity, angiogenesis, cell adhesion, cell growth, ATP synthesis, nucleic acid binding, redox and chaperones. PRDX3 knockdown led to down-regulation of ATP synthases and the decreased cellular ATP level contributing to slow down of cell growth. Furthermore, silencing PRDX3 enhanced invasive properties of HepG2 cells via TIMP-1 down-regulation and the increased ECM degradation. Taken together, our results indicate that PRDX3 promotes HCC growth and mediates cell migration and invasiveness and is a potential therapeutic target for HCC treatment.

Key word: PRDX3; proteomics; invasion; cell growth; ATP synthase; TIMP1;

2


Page 2 of 38

Page 3 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Hepatocellular carcinoma (HCC) is one of the most common malignant tumors and the third leading cause of cancer-related mortality with aggressive tumor behavior and poor prognosis1, along with one million deaths annually worldwide 2. The pathogenesis of HCC is a complex process involving inflammation, angiogenesis and metabolic disorders. Frequent recurrence and tumor cell metastasis are the major barriers that affect the prognosis of HCC patients3, 4. Recently, several HCC -associated proteins have been reported, such as the sex determining region Y-box 12 (Sox12)5, glucose-regulated protein 78 (GRP78)6, peroxiredoxin II7, β-catenin8, tumor progression locus 2 (TPL2)9, and prospero-related homeobox 1 (PROX1)10. These proteins participate in HCC tumorigenesis. Extensive studies also identified that PRDX3 was up-regulated in HCC11-15. PRDX3 is a member of peroxiredoxins that play an important role in redox regulation and to protect cells from oxidative damage16,

17

. Peroxiredoxins (PRDXs) act as

double-edged swords in tumorigenesis. They have both supportive and preventive functions in tumor formation18. PRDXs are also referred to as protective antioxidant enzymes and as molecular chaperones19. Moreover, they participate in regulating cell signaling and other cellular processes including cell proliferation, apoptosis, carcinogenesis and metastasis20,

21

. Peroxiredoxin I inhibits tumorigenesis through

regulating PTEN/AKT activity22. PRDX3 is mainly located in the mitochondrion which regulates physiological levels of hydrogen peroxide (H2O2), leading to decreased cell growth while protecting cells from the apoptosis-inducing effects of high H2O2 levels23. It is regulated by c-Myc to maintain normal mitochondrial 3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

function16. Additionally, PRDX3 was found to be elevated in breast cancers24,

Page 4 of 38

25

,

malignant mesothelioma26, cervical cancer27, prostate cancer28, lung cancer29, ovarian cancer30 and endometrial cancer31. These observations indicate that PRDX3 is involved in tumorigenesis and progression. In the present study, we established the stable cell lines, in which PRDX3 was overexpressed or knocked down. The effects of PRDX3 on HepG2 proliferation and invasiveness were assessed. We also utilized a tandem mass tag (TMT) labeling strategy32 to identify the differentially expressed proteins between PRDX3 knockdown cells and the control cells. We found that PRDX3 silencing changed mitochondrial proteostasis, leading to down-regulation of ATP synthases and slowdown of tumor cell growth. In addition, we showed that silencing of PRDX3 expression enhanced invasive properties in HepG2 cells via degradation of extracellular matrix.

Materials and Methods

Chemicals and Reagents

RPMI-1640 medium, Dulbecco’s modified Eagle medium (DMEM), phosphate buffered saline (PBS), penicillin/streptomycin were purchased from Wisent (Montreal, Canada), fetal bovine serum (FBS) was purchased from CellMax. Mass spectrum grade acetonitrile was purchased from Thermo (Waltham, MA). Dithiothreitol (DTT) was purchased from Merck (Whitehouse Station, NJ). Sequencing grade trypsin was purchased from Promega (Fitchburg, WI). Iodoacetamide (IAA) was 4


Page 5 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


purchased from Sigma (St Louis, MO). Protease Inhibitor was purchased from Selleck (Houston, TX). qPCR SYBR Green Master was purchased from Vazyme (#Q131-03). Anti-β-actin antibody was purchased from Abmart (Shanghai, China). Anti-PRDX3 antibody was purchased from Abcam (Cambridge, USA). Anti-rabbit secondary antibody was purchased from Cell Signaling Technology (Boston, MA). Cell counting kit-8 was purchased from Dojindo (Kumamoto, Japan). The Total RNA Isolation System and Reverse Transcription kit were purchased from TIANGEN (Beijing, China). Hydrogen peroxide was purchased from Aladdin (Shanghai, China). Animal Mitochondrial DNAout Kit purchased from TIANDZ (Beijing, China). DNA Degradase Plus™ was purchased from Zymo Research (Los Angeles, USA). The 8-OHdG ELISA kit was purchased from HonSun Biological (Shanghai, China). Cell culture

Human liver HepG2 and embryonic kidney 293T cell lines were obtained from the cell bank of the Chinese Academy of Sciences (Shanghai, China). Cells were grown in 1640 and DMEM medium supplemented with 10% FBS and 1% penicillin/streptomycin at 37 °C in a humidified incubator with 5% CO2. Establishment of PRDX3 overexpress and knockdown HepG2 and 293T cells

Lentiviral expression vector pLVX-IRES-ZsGreen1 and pLL3.7 with GFP reporter and the package vectors were obtained by courtesy of Dr. Jun Xu (Tongji University, Shanghai, China). The human PRDX3 cDNA was synthesized from the total RNA of 293T cell line. The PRDX3 coding region with flag tag sequence was cloned into the vector to create the pLVX-PRDX3-IRES-ZsGreen1 vector. 5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Production of lentiviral particles of recombinant PRDX3 was carried out based on the protocol published by Tiscornia33. Briefly, we co-transfected pLVX-PRDX3-IRES-ZsGreen1 or pLVX-IRES-ZsGreen1, respectively, with packing vectors into HepG2 cells when they reached 80-90% confluence. The cell culture supernatant was then collected after 48 hours and was concentrated with PEG600034. The precipitated lentiviral particles were resuspended in PBS. Like as the overexpress cell line, three siRNA sequences were selected for silencing PRDX3, but only (sense): 5'- AAGGCGTTCCAGTATGTAGAA -3' worked well35. The PRDX3 shRNA was inserted into plasmid pLL3.7 to constructed pLL3.7-PRDX3 vector. Meanwhile a sequence of 5’-TTCTCCGAACGTGTCACGT-3’ that has no targeted gene and no significant biological activity was used as negative control36. Isolation of a monoclonal PRDX3 stable overexpress and knockdown cell lines

HepG2 cells were cultured in a twelve-well plate and lentiviral particles with 10 µg•ml-1 polybrene were added into HepG2 cells when they reached 30–40% confluence. After 72 hours, a large population of cells expressed GFP and emitted green fluorescence. Cells were then harvested and resuspended in PBS with 1.5% FBS and 1% penicillin/streptomycin. The suspended cells were injected into a flow cytometer for fluorescence-activated cell sorting. A single GFP-positive cell was seeded into one single well in a 96-well plate. The clone with intense and uniform GFP expression was selected and used in the present study. Cell Proliferation Assay with CCK-8 6


Page 6 of 38

Page 7 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cells were seeded in 96-well plates with 2000 cells/well. Cell proliferation rate was determined with the Cell Counting Kit-8 (CCK-8) according to the manufacturer’s instruction (Dojindo Laboratories, Japan). Briefly, CCK-8 reagents were added into wells after cells grew for 0, 8, 16, 24, 32, 40, 48, 72, 96 and 120 hours. Optical density (OD) was measured in 2 hours after CCK-8 addition at 450 nm with a Microplate Reader Multiscan FC (Thermo-Scientific). All the experiments were repeated three times. Susceptibility of PRDX3 overexpress and knockdown to hydrogen peroxide

In order to assess the effects of hydrogen peroxide on cell proliferation in HepG2 cells with PRDX3 overexpression and knockdown, we analyzed with the CCK-8 kit. Cells were seeded into wells in 96-well cell culture microplate and incubated for 12 hours prior to hydrogen peroxide treatment. Cells were then treated with hydrogen peroxide (500 µM) in triplicates for 24 hours. The CCK-8 reagent was added to treated cells and incubated at 37°C for 2 hours. Optical density (OD) was measured at 450 nm with a Microplate Reader Multiscan FC (Thermo-Scientific). Cell viability was represented as the percentage of viable cells compared to untreated cells. All the experiments were repeated three times. Detection of cellular reactive oxygen species (ROS)

The ROS in PRDX3 overexpression and knockdown cells was detected using CellROX® Deep Red Reagents (Invitrogen, Grand Island, NY) following manufacturer's instructions. Briefly, cells were stained with 5 mΜ CellROX® Deep Red Reagent by adding the probe to the complete medium and incubating the cells at 7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

37°C for 30 minutes. The cells were then washed with PBS and analyzed on a BD FACSAriaII Flow Cytometer (Becton Dickinson, NJ). All the experiments were repeated three times.

Isolation of the mitochondria enriched fraction from cells

The isolation of mitochondria from cells was done with Mitochondria Isolation Kit purchased from Beyotime (Shanghai, China). Briefly, cells were harvested and resuspended in homogenization buffer. Then, cells were homogenized with a glass homogenizer. Cell breakage was checked under the microscope and the homogenate was poured into a conical centrifuge tube when the percentage of cell breakage was about 60%. The homogenate was centrifuged at 1000 g for 10 min to remove unbroken cells, nuclei, large debris. The supernatant was further centrifuged at 10,000 g for 10 min to isolate the mitochondrial enriched fraction.

Isolation of mtDNA from mitochondria

The mitochondrial enriched fraction was isolated as above; total mitochondrial for use in experiments involving in vitro damage was isolated from PRDX3 overexpression and knockdown HepG2 cell lines. Benzonase and DNase A (1U/µL) was incubated with the fraction for 2 hours at 37 °C to eliminate the nucleus DNA completely. After this treatment, 0.5M EDTA (pH 8.0) can be used to quench the reaction. Choosing one or two gene from nucleus and mitochondrial to detect the nucleus DNA elimination.

The isolation of mtDNA from mitochondria was carried out with Column 8


Page 8 of 38

Page 9 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Animal Mitochondrial DNAout Kit purchased from TIANDZ (CAT#: 120501-15, Beijing, China). An enriched mtDNA was obtained by this extraction procedure. The isolated mtDNA (2 µg) was digested with 10 Units of DNA Degradase Plus™ (CAT#E2020, Zymo Research, USA) in 25 µl reaction volume at 37 °C for 2 hours that was a nuclease mix to efficiently degrade DNA into individual nucleoside components. To analyze oxidation products of mtDNA, 8-hydroxydeoxyguanosine (8-OHdG) from digested mtDNA was measured by Enzyme-Linked Immunosorbent Assay (ELISA) with the 8-OHdG ELISA kit (CAT#QS40331, Shanghai, China). The levels of 8-OHdG were determined in samples from untreated and 250 µM H2O2-treated PRDX3 overexpression and knockdown cells based on absorbance measurement at 450 nm using a Microplate Reader Multiscan FC (Thermo-Scientific). All the experiments were repeated five times. Sample Preparation and Quantitative Proteomic Analysis About 5x106 cells were lysed using 8 M urea, and the whole cell extracts were centrifuged at 14,000 g for 20 minutes at 4 °C. Protein concentrations were determined with the BCA method. Equal amount of proteins from PRDX3-KN and PRDX3-NCi cells (100µg) were reduced with 5mM dithiothreitol and alkylated with 13mM iodoacetamide. In solution digestion was then carried out with sequencing grade trypsin at 37 °C overnight. Extracts were then centrifuged in aspeedvac to dry completely. And then tryptic peptides suspended with 100µl of 100mM triethyl ammonium bicarbonate (TEAB). Then 20µl of TMTsixplex labeling reagents were 9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

added into the solution and the reaction was incubated for 1 hour at room temperature. Peptides from PRDX3-NCi cells were labeled by TMT6-127 and peptides from PRDX3-KN cells were labeled by TMT6-129. Then 5% hydroxylamine (pH 9-10) was used to quench the reaction for 15 min. Sep-Pak C18 Vac cartridges (Waters, Milford, MA) were used for desalting.

The two samples were mixed and fractionated with an Ultimate 3000 System (Thermo-Fisher Scientific, Waltham, MA) by using a Xbridge C18 RP column (5µm,150 Å, 250 mm × 4.6 mm i.d., (Waters, Milford, MA)). Mobile phase A consisted of 2% acetonitrile (pH 10.0) and B consisted of 2% acetonitrile (pH 10.0). The solvent gradient was set as follows: 5%-8% B, 5 min; 8%-18% B, 25 min; 18%-32% B, 32 min; 32%-95% B, 2 min; 95% B, 6 min; 95%-5% B, 5 min. The peptides were monitored at 214 nm and collected every 90 seconds. The collected elutes were combined to generate 12 fractions. For LC-MS/MS analysis, the TMT-labeled peptides were separated by a 120 min gradient elution at a flow rate 0.25 µl/min with a nano-HPLC system (Proxeon, Denmark) which was directly interfaced with a Thermo Scientific Q Exactive mass spectrometer. The analytical column was a fused silica capillary column (75µm ID, 150 mm length; Upchurch, Oak Harbor, WA) packed with C-18 resin (300 Å, 5 µm, Varian, Lexington, MA). Mobile phase A consisted of 0.1% formic acid, and mobile phase B consisted of 100% acetonitrile and 0.1% formic acid. The Q Exactive mass spectrometer was operated in the data-dependent acquisition mode using Xcalibur 2.1.2 software and there was a full-scan mass 10


Page 10 of 38

Page 11 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


spectrum in the Orbitrap (300−1800 m/z, 75,000 resolution) followed by 20 data-dependent MS/MS scans at 32% normalized collision energy (HCD). The mass window for precursor ion selection was 2.0 m/z, the threshold for triggering MS/MS experiemnts was 8.0×103, and the dynamic exclusion time was 20 s The MS/MS spectra from each LC-MS/MS run were searched against the uniprot human database (version 20150110, 89105 sequences) using an in-house Sequest HT Algorithm in Proteome Discoverer software (PD, version 1.4). The search criteria were the followings: full tryptic specificity was required; one missed cleavage was

allowed;

the

oxidation

(M)

was

set

as

the

variable

modification;

carbamidomethylation (C) and TMTsixplex (K and N-terminal) were set as the fixed modifications; precursor ion mass tolerance was set at 20 ppm for all MS and 20 mmu for all MSMS spectra. The peptide false discovery rate (FDR) was estimated using percolator function provided by PD and the cutoff score was accepted 1% based on the decoy database. Relative protein quantification was performed using PD software according to the intensity of the TMT reporter ions. Quantitation was carried out only for proteins with two or more unique peptide matches. Peptides only assigned to a given protein group were considered as unique. Protein ratios were calculated as the median of all peptide hits belonging to a protein. Quantitative precision was expressed as protein ratio variability. The proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD002102. Proteomic analysis was carried out in three biological replicates. 11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

GO and STRING network analysis Via the PANTHER bioinformatics platform (http://www.pantherdb.org/), Gene Ontology (GO) was carried out to cluster significantly differentially expressed proteins according to their biological processes, molecular function and cellular compartment. The protein-protein interaction analysis for differentially expressed proteins was performed using STRING (http://string-db.org/)37.

Western Blot Analysis

Briefly, 30 µg proteins were separated by 12% 1D SDS-PAGE gel and electrotransferred into nitrocellulose membrane (Bio-Rad). The membrane was incubated for 1 hour at room temperature in 5% skim milk. And then the membrane was incubated overnight at 4 °C with primary antibody, polyclonal rabbit anti-PRDX3 (dilution 1:1000, abcam), polyclonal rabbit anti-TIMP1 (dilution 1:3000, Origen), polyclonal rabbit anti-TIMP2 (dilution 1:3000, abcam). Anti-mouse or anti-rabbit secondary antibodies labeled with HRP were incubated with the membrane at room temperature for 1 hour. The blots were developed using ECL reagents (Engreen, China). β-actin was used as an internal control. All the experiments were repeated three times.

Quantitative real-time PCR (qPCR)

PRDX3 overexpression and knockdown cells were cultured in 100 mm culture dishes. Total RNA was extracted with the Total RNA Isolation System. cDNA was synthesized from 3 µg total RNA with the Reverse Transcription kit. All qPCR 12


Page 12 of 38

Page 13 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was performed with the Roche LightCycler® 480II Detection System with SYBR green incorporation according to the manufacturer's instructions and actin was used as an internal control. All the experiments were repeated three times. The primers were acquired from the literature and Primer Bank (http://pga.mgh.harvard.edu/primerbank/) and listed in Table S1.

ATP measurement by LC–MS/MS Briefly, 3x106 cells were seeded into a 10mm dish and allowed to grow for 24 hours. Then the cells were washed twice with 3 ml PBS to aspirate the cell culture medium. 1 ml 80% pre-chilled methanol (-80 °C) were added in the dish and incubate at -80 °C for 2 hours. And then harvest cells lysate into a tube by scrapping them in 80% methanol. Centrifuge the tube at 14,000 g for 10 minutes at 4 °C. The metabolite-containing supernatant was transferred to a new tube and immediately frozen in liquid nitrogen for 10 minutes. The extracted metabolites were evaporated in a speedvac to generate a dry metabolite pellet.

For LC-MS/MS analysis, metabolites were separated by a 20 minute gradient elution at a flow rate 250 l/min with a Thermo Scientific Dionex Ultimate 3000 UPLC system joint with a Thermo TSQ mass spectrometer. Mobile phase A consisted of 100% H2O and 5 mM ammonium formate and mobile phase B consisted of 95% acetonitrile, 5% H2O and 5 mM ammonium formate. The TSQ mass spectrometer was operated in a data-dependent acquisition mode with mass range 70-1000 m/z using the Xcalibur

13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

2.1.2 software. The full scan and fragment spectra were collected with resolution of 70,000 and 17,500 respectively. All the experiments were repeated three times.

Wound Healing Assays and Tumor Cell Matrigel Invasion For wound healing assay, the 5x105 cells in 6 mm well was carefully wounded by sterile pipette and washed with PBS for three times to remove the debris. The wounded cells was cultured in 1640 containing 1% BSA for 24, 48, 60, 72 hours and photographed by microscope (×100). The status of wound closure was evaluated by inverted microscope. Matrigel invasion and wound healing assays were repeated in 3 independent experiments. The invasion capacity of PRDX3-KN and NCi cells was assessed by using a Corning’s Transwell invasion chamber. Cells (5x104 /well) were re-suspended with 100 µl of serum-free medium with 0.1% BSA and seeded into the transfer top chamber with 60 µl Matrigel pre-coated (cat#356234, BD), the bottom chamber was filled with 600 µl normal 1640 culture medium. After incubation for 24 hours, the numbers of invaded cells were observed and the numbers of penetrated cells were counted by CCK-8 assay. All the experiments were repeated three times.

Gelatin Zymography

Cells were grown in 1640 serum-free medium at 37°C for 24 hours. The supernatant was collected by centrifuging at 2000 rpm for 10 minutes. Equal amounts of protein (10-40 µg) were loaded and separated by 10% polyacrylamide gel containing 1% gelatin. The gel was pretreated by elution buffer (2.5% Triton X-100, 14


Page 14 of 38

Page 15 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


50mM Tris-HCl, 5mM CaCl2，pH7. 6) twice for 40 min at room temperature. And then stained with staining buffer for 3 hours (0.05% Coomassic Brilliant Blue R-250, 30% methanol, 10% acetic acid) and destained with three destaining steps. The MMP-2 (72KD) and MMP-9 (92 KD) activity were analyzed by gel imaging and analysis system. All the experiments were repeated three times.

Statistical Method

Statistical analysis was carried out with GraphPad Prism 5.0 software. Processing of each image from western blot and gelatin zymography was carried out by ImageJ software (http://imagej.nih.gov/ij/). Significant differences in the data were determined by Student’s t test. p values of 1.3 or

Silencing PRDX3 Inhibits Growth and Promotes ... - ACS Publications

Recommend Documents