Bioconjugate Chem. 2010, 21, 1177–1182
1177
Site Specific and Reversible Protein Immobilization Facilitated by A DNA Binding Fusion Tag Meng Zhong, Jun Fang, and Yinan Wei* Department of Chemistry, University of Kentucky, Lexington, Kentucky 40506-0055. Received December 6, 2009; Revised Manuscript Received June 15, 2010
Due to the complexity and diversity of protein structures, site-specific protein immobilization has always been challenging. On the contrary, DNA immobilization is straightforward with well established chemical methods. Single-strand DNA binding protein (SSB) binds tightly to single-stranded DNA (ssDNA). Herein, we investigated the feasibility of using SSB as a fusion tag to facilitate site-specific and reversible immobilization of target proteins. As a model system, we constructed a fusion protein by joining a superfolder green fluorescent protein (sfGFP) with SSB. The fluorescence emission and ssDNA binding affinity of the fusion protein were compared separately with those of the individual modules. Both modules fully retained their properties in the fusion construct. Next, we covalently attached ssDNA (dT37) to a supporting matrix through either amine or thiol functionalization. The attached ssDNA mediated reversible sfGFP-SSB immobilization. The immobilized protein could be released through changes of conditions including pH, concentration of divalent cations, and the presence of the complementary dA35 oligonucleotide.
INTRODUCTION Protein immobilization is an important first step for many applications including the construction of biosensors and protein microarrays, development of immunoassay methods, and employment of enzymes in biotechnology procedures (1-4). Protein immobilization methods can be categorized as nonspecific and site-specific. Nonspecific immobilization is usually achieved by physical adsorption or direct chemical reactions with amine, carboxyl, or thiol groups in the protein (5, 6). Because there are usually multiple copies of a given functional group in the target protein, it is difficult to control the extent of immobilization and orientation of the immobilized protein. In addition, chemical modification of functional groups within a protein may have negative impact on the protein’s structure and function. This effect has been demonstrated by the decrease of protein activities upon immobilization in many cases (7, 8). On the other hand, physical adsorption is facilitated by the van der Waals, electrostatic and hydrophobic interactions (9). Such interactions are weak, which usually result in protein leaching. A procedure that can produce a homogeneous, stable, and active protein layer on a specific surface is highly desirable. Many studies have investigated the use of affinity tags and fusion proteins for the purpose of site-specific and oriented protein immobilization. Proteins bind to specific affinity matrixes after being modified with the corresponding binding domains or tags. The polyhistidine tag (histag) is a popular choice and has been used in the immobilization of proteins on the metal affinity resins (9-11). However, there are limitations of the binding specificity of the metal affinity resin. For example, at least three E. coli endogenous proteins bind to the nickel nitrilotriacetic acid (Ni-NTA) resin (12). This limited selectivity could complicate the immobilization procedure. Other fusion tags have also being used to immobilize target proteins, including the * To whom correspondence should be addressed. 305 ChemistryPhysics Building, University of Kentucky, Lexington, KY 40506-0055. Telephone: (859) 257-7085. Fax: (859) 323-1069. E-mail: yinan.wei@ uky.edu.
glutathione S-transferase, maltose binding protein, chitin binding protein, streptag and metal binding peptide (13-15). Compared to protein, oligonucleotides have simpler structure and chemical composition, which make them easier to modify in order to facilitate specific immobilization. Creation of DNA microarrays is an established and commercialized technique. The usage of DNA arrays to direct the assembly of proteins has attracted many research interests. In most of these studies, a ssDNA was first connected to the target protein, and then the DNA-protein conjugate was attached to a matrix modified with the complementary strand of that ssDNA (15-19). The DNAprotein conjugates have been obtained through direct covalent attachment (20-25), a biotin-streptavidin bridge (26), or the expressed protein ligation (27). RNA-protein fusions have also been constructed for site specific protein immobilization (28, 29). The formation of the DNA/RNA-protein conjugate requires chemical modification, which may have a negative impact on the protein activity. In a more recent study, protein capture by a DNA functionalized matrix was accomplished through the coiled-coil association of an engineered pair of heterodimeric leucine zippers. One helix of the zipper was chemically linked to the DNA, and the other helix was expressed as a fusion tag to the protein (30). To eliminate the need of chemical modification of the target protein, we investigated the incorporation of a DNA binding protein as the fusion tag to direct the immobilization of the protein of interest. Recently Gang and co-workers had shown that surface-bound DNA could serve as anchoring sites to immobilize DNA binding proteins (31). Herein, we describe the construction of a fusion protein containing an N-terminus superfolder green fluorescent protein (sfGFP) and a C-terminus single-strand DNA binding protein (SSB). In this work, sfGFP was used as a reporter group to facilitate convenient characterization of protein immobilization, while SSB facilitated high affinity binding toward single-stranded DNA. The fusion protein sfGFP-SSB retained the properties from both domains, being fluorescent and binding to single stranded DNA. Next, we demonstrated that SSB could be used as a fusion tag to facilitate fast and convenient protein immobilization through the coupling
10.1021/bc9005392 2010 American Chemical Society Published on Web 06/28/2010
1178 Bioconjugate Chem., Vol. 21, No. 7, 2010
Figure 1. (A) The construct of the fusion protein, which contains a N-terminus histag, followed by sfGFP, and a C-terminus SSB. (B) SDSPAGE analysis of purified sfGFP (lane 1), SSB (lane 2), and the sfGFPSSB fusion protein (lane 3). Positions of the molecular weight markers are indicated by arrows. (C) Size exclusion chromatography analysis of the fusion protein (black trace). The gray trace is the molecular weight standard. From left to right, the peaks correspond to 670, 158, 44, and 17 kDa, respectively.
with a ssDNA modified surface. The bound protein could be eluted from the matrix without suffering from denaturation, and the DNA-modified surface could be regenerated.
EXPERIMENTAL PROCEDURES Cloning, Protein Expression, and Purification. The SSB gene was amplified by polymerase chain reaction (PCR) using the E. coli genomic DNA as the template and primers 5′GTACGGATCCATGGCCAGCAGAGGCGTAAACAAGGT3′ (forward) and 5′-GTACCTCGAGTCAGAACGGAATGTCATCATCAAAG-3′ (reverse). The PCR product was digested using BamHI and XhoI, gel purified, and inserted into a similarly digested pET28a vector to generate plasmid pET28a-SSB. The sfGFP plasmid was obtained from Theranostech Inc. (Albuquerque, NM, USA). Gene encoding sfGFP was excised from the plasmid using restriction enzymes NdeI and BamHI, and cloned into similarly digested pET28a or pET28a-SSB to generate pET28a-sfGFP and pET28a-sfGFP-SSB (Figure 1). All protein constructs contain a histag at the N-terminus of the proteins. The sequences of all cloned constructs were confirmed by DNA sequencing (Retrogen, CA, USA). Plasmids pET28a-sfGFP-SSB, pET28a-sfGFP, and pET28aSSB were used to transform E. coli strain ER2566 for protein production. The cells were grown at 37 °C in LB medium containing 100 µg/mL kanamycin to an OD600 nm of 0.6, and then induced with 1 mM isopropyl-D-thiogalactopyranoside (IPTG). Three hours after induction, the cells were harvested by centrifugation at 7000 rpm for 10 min. The cell pellets were resuspended in a binding buffer (100 mM Tris-HCl, 0.5 M NaCl, and 10% glycerol, pH 8.1) and lysed by sonication on ice for 10 min with 10 s on-off intervals. The cell debris was removed by centrifugation at 12 000 rpm for 15 min. DNaseI was added to the cleared lysate to digest DNA at room temperature for 30 min. The cleared lysate was incubated with Ni-NTA resin (Qiagen, Huntsville, AL) with shaking at room temperature for 45 min before being loaded to an empty column. The resin was then washed with a buffer containing 100 mM Tris-HCl, 0.5 M NaCl, 10% glycerol, and 50 mM imidazole (pH 8.1). Finally, the protein was eluted with a buffer containing 100 mM TrisHCl buffer, 0.5 M NaCl, 10% glycerol, and 500 mM imidazole (pH 8.1). Purified sfGFP-SSB, sfGFP, and SSB were dialyzed extensively against the binding buffer to remove excess imidazole. The purified proteins were analyzed using the sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
Zhong et al.
visualized with Coomassie Blue stain. Protein concentrations were determined using the Bradford protein assay. Fluorescence Spectroscopy. Fluorescence emission spectra were collected using a Perkin-Elmer LS-55 fluorescence spectrometer (PerkinElmer, Waltham, MA) at 20 °C. Fluorescence quenching titration was used to measure the binding affinity between sfGFP-SSB and ssDNA dT37. All oligonucleotides were obtained from Integrated DNA Technology (San Diego, CA), including dT37, dA35, the 5′ amine-derivatized dT37 (H2N-dT37), and the 5′ thiol-derivatized dT37 (RSS-dT37). dT37 was titrated into the protein solution and the tryptophan fluorescence was monitored at excitation and emission wavelengths of 282 and 357 nm, respectively. To measure the fluorescence of sfGFP, the excitation wavelength was 490 nm. Protein Immobilization. H2N-dT37 was attached to the N-hydroxysuccinimidyl-Sepharose resin (NHS resin) (SigmaAldrich, St. Louis, MO). The NHS resin was first washed with 100 mM sodium phosphate buffer (pH 7.4) and then incubated with H2N-dT37 (25 µmol/L) at room temperature for 2 h. Finally, Tris-HCl buffer was added to a final concentration of 20 mM to quench the unreacted NHS groups. The modified resin was washed 3 times with 10 bed volume of 100 mM Tris-HCl buffer (pH 8.1) each time. RSS-dT37 was attached to the DVS-A activated resin (Adar Biotech LTD, Rehovot, Israel). Before DNA immobilization, the resin was washed using a sodium phosphate buffer (100 mM, pH 7.4). RSS-dT37 was first reduced to form free thiols using 10 mM tris(2-carboxyethyl)phosphine (TCEP) in a HAcNaAc buffer (100 mM, pH 5.4) and then incubated with the DVS-A resin at room temperature for 2 h in the above sodium phosphate buffer. Next, the reaction was quenched using 20 mM DTT. The DNA modified resin was washed using the same phosphate buffer. To examine site-specific protein immobilization, sfGFP-SSB or sfGFP (used as a negative control) was incubated with the DNA-modified resins for 15 min in a Tris buffer (100 mM TrisHCl, 100 mM NaCl, pH 8.1). Then, the resin was collected through centrifugation and washed 3 times with 10 bed volumes of the same Tris-HCl buffer each time. Protein bound to the resin was quantified by subtracting the amount of protein left unbound from the total amount of protein added. After protein immobilization and washing, the resins were also examined directly under a fluorescent microscope (Nikon Eclipse 55i, Nikon Instrument Inc., Elgin, IL). Reversibility of Protein Immobilization. After sfGFP-SSB was immobilized on NHS-dT37 and DVS-A-dT37 activated resins, the effect of different pHs on protein-substrate dissociation was examined. HAc-NaAc buffer was used for pHs 4, 4.5, and 5.0. Sodium phosphate buffer was used for pHs 5.5, 6, 6.5, and 7. Tris-HCl buffer was used for pHs 7.5, 8, and 8.5. Sodium-glycine buffer was used for pHs 9, 9.5, 10, and 10.5. The indicated buffer (at 100 mM) was added to sfGFPSSB modified resin and incubated at room temperature for 30 min. The protein in the supernatant was quantified to determine the effectiveness of elution.
RESULTS AND DISCUSSION Aiming at developing a reversible and site specific method for protein immobilization, we examined the prospect of immobilizing proteins through a DNA binding fusion tag. We created a fusion protein containing the protein of interest and a ssDNA binding module. To facilitate convenient detection and characterization, we have chosen sfGFP as the model target protein. sfGFP was fused with SSB at the C-terminus. Furthermore, a histag was introduced at the N-terminus of the fusion protein to facilitate convenient purification (Figure 1A). We expressed and purified the fusion protein as well as the
Site Specific and Reversible Protein Immobilization
Bioconjugate Chem., Vol. 21, No. 7, 2010 1179
Figure 2. Fluorescent emission spectra of sfGFP (open square) and sfGFP-SSB (filled triangle) measured with the excitation wavelength of 490 nm. The concentration of both proteins was 45 nM. The maximum emission wavelengths of sfGFP-SSB and sfGFP are 512 and 510 nm, respectively.
individual modules, sfGFP and SSB, in high yield. Figure 1B showed the SDS-PAGE analysis of all three proteins. The calculated molecular weights of the histagged proteins are 29.0 kDa (sfGFP), 22.5 kDa (SSB), and 48.1 kDa (sfGFP-SSB). The experimental results are consistent with the calculated molecular weights. SSB is a tetramer, which is critical for its interaction with ssDNA. We examined the quaternary structure of the fusion protein using the size exclusion chromatography (SEC) (Figure 1C). The retention time of the fusion protein was around 20.4 min, slightly shorter than the molecular weight standard of 158 kDa (20.7 min). This result suggests that the fusion protein is a tetramer. To examine the influence of fusing on the properties of each individual module, we measured the fluorescence emission, as well as the ssDNA binding affinity of the fusion protein. We first compared the fluorescent emissions of sfGFP and sfGFP-SSB. There is a small red shift of the emission peak, from 510 nm for sfGFP to 512 nm for sfGFP-SSB (Figure 2). The fluorescence intensities of the two proteins were comparable. Next, we examined the ssDNA binding affinity of sfGFPSSB. Previous studies showed that, when SSB bound to dT37, the tryptophan fluorescence of the protein decreased (32). On the basis of the percentage of fluorescent quenching, the binding affinity between SSB and dT37 could be determined. sfGFP has one tryptophan, W57. When excited at 282 nm, the intrinsic fluorescence emission of sfGFP at 357 nm was approximately 3% of the intensity of the SSB emission (Figure 3A). Furthermore, the addition of dT37 had no effect on the emission of sfGFP (Figure 3A). Finally, we titrated dT37 into samples containing either sfGFP-SSB or SSB and monitored their tryptophan fluorescence emission (Figure 3B). The fluorescence quenching curves of the two proteins superimposed well in the concentration range examined (between 10-9.5 M to 10-7 M) and matched the result from the literature for SSB (33). This result indicates that the ssDNA binding affinity of SSB was not affected in the fusion protein. Interaction between SSB and ssDNA was highly dependent on pH and cation concentrations (34-36). We expect the binding of sfGFP-SSB to dT37 to be sensitive to changes of pH and cationic concentration as well. Therefore, we characterized their interaction at different pHs (pH 8.1 and pH 10), as well as different NaCl and MgCl2 concentrations, aiming at identifying conditions that could enable reversible protein immobilization/elution. There are two major binding modes between SSB and dT37, known as (SSB)35 and (SSB)65. The subscripts refer to the length of the oligonucleotides that interact with each SSB tetramer during binding (19). In the (SSB)35 binding mode, ssDNA only interacts with two out of the four SSB subunits in a tetramer. On the other hand, in the (SSB)65 binding mode, all four subunits participate in DNA binding. The switch between
Figure 3. (A) Tryptophan fluorescence spectra of sfGFP (gray), SSB (black), and sfGFP after the addition of 100 nM dT37 (dotted black line) when excited at 282 nm. (B) Fluorescence quenching of sfGFPSSB (gray) and SSB (black) in the presence of dT37. The excitation and emission wavelengths are 282 and 357 nm, respectively. The concentrations of both proteins were 4.2 × 10-7 M.
the two binding modes is sensitive to changes in pH, temperature, and cation concentrations. For example, when the concentration of Na+ is less than 10 mM, the main binding mode is the (SSB)35 mode, and (SSB)65 mode is the main binding mode when Na+ concentration is higher than 200 mM. For MgCl2, such a switch happens at a much lower Mg2+ concentration. We examined the effect of NaCl and MgCl2 on the ssDNA binding of the fusion protein. We found that sfGFP-SSB behaved very much like the free SSB. ssDNA titration experiment using dT37 showed that fluorescence quenching reached a plateau at 60% in 1 mM NaCl, while in the presence of 2.5 mM MgCl2, 90% of the tryptophan emission was quenched (Figure 4A). These results indicate that the fusion protein also has two binding modes, similar to the two binding modes of SSB. There are two binding sites per SSB tetramer (each binding site contains two SSB subunits). A negative cooperation exists between bindings at these two sites (21). As salt concentration decreases, this negative cooperation increases. This explains why the percentage fluorescence quenching upon binding was different in the presence of 1 mM NaCl (one site binding, or (SSB)35 mode) or 2.5 mM MgCl2 (two sites binding, or (SSB)65 mode). Next, we examined a series of pH and cation concentrations and their combinations to identify a condition that minimized the interaction between sfGFP-SSB and dT37. This condition could be used potentially as the elution condition during protein immobilization experiments. We first determined the effect of pH on the tryptophan fluorescence of the fusion protein (Figure 4B). Spectra were collected at pH 6.9 with 2.5 MgCl2 (dark gray) and pH 10 with 1 mM NaCl (light gray). At the higher pH, the tryptophan fluorescence emission decreased by approximately 10%. We found that, while the fusion protein bound efficiently with dT37 over a broad range of conditions (pH 7-8, >100 mM NaCl or 2.5 mM MgCl2), the combination of high pH and low salt concentration disrupts such interaction. In the presence of 100 nM dT37, sfGFP-SSB binding had reached
1180 Bioconjugate Chem., Vol. 21, No. 7, 2010
Zhong et al.
Figure 4. (A) sfGFP-SSB and dT37 binding monitored as tryptophan fluorescence quenching in the presence of 1 mM NaCl, 25 mM Tris-HCl, pH 8.1 (triangle) or 2.5 mM MgCl2, 25 mM Tris-HCl, pH 8.1 (diamond). The concentration of sfGFP-SSB was 1.4 × 10-7 M. (B) sfGFP-SSB tryptophan fluorescence emission measured at pH 6.9 with 2.5 mM MgCl2 (dark gray) or pH 10 with 1 mM NaCl (light gray). (C) sfGFP-SSB and dT37 binding at pH 6.9 with 2.5 mM MgCl2 (square) or pH 10 with 1 mM NaCl (triangle).
saturation at pH 6.9 with 2.5 mM MgCl2 (square), while much less protein bound at pH 10 with 1 mM NaCl (triangle) (Figure 4C). To examine the binding of sfGFP-SSB with immobilized ssDNA, we first covalently attached chemically derivatized dT37 to a solid matrix. Two kinds of chemical reactions were tested: amine-derivatized ssDNA to NHS functionalized resin and thiolderivatized ssDNA to DVS-A activated resin. After the modification, the resins were washed extensively to remove the unreacted ssDNA. Next, sfGFP-SSB or sfGFP were incubated under the same experimental condition with the modified resins. We used sfGFP as a negative control to examine the effect of nonspecific interaction between the protein and the beads. After incubation, the resins were separated from excess proteins by centrifugation and washed extensively using the binding buffer. The difference in colors of the modified resins incubated with sfGFP-SSB and sfGFP indicated that nonspecific binding of sfGFP was very weak compared to the SSB facilitated specific binding (Figure 5A). Panels a and b were NHS-T37 and DVSA-T37 resins, respectively. The tube on the left in each panel contained sfGFP-SSB treated resins, while the tube on the right contained sfGFP treated resins. Next, fluorescent microscope was used to further characterize both types of resins incubated with sfGFP or sfGFP-SSB (Figure 5B). The control resins were not fluorescent, further confirming the lack of nonspecific interaction. The amount of sfGFP-SSB immobilized to the resins was determined as described in the experimental procedures. Approximately 2.6 or 1.8 mg proteins was bound in each milliliter of drained NHS-dT37 or DVS-A-dT37 resin. Reversibility of the immobilization procedure provides the possibility to recycle the functional proteins and regenerate the supporting matrix. We evaluated two approaches to elute the protein off the resins without affecting its activity: addition of the complementary dA35 oligonucleotide and change of pH/salt concentration. We first examined the reversibility of sfGFPSSB interaction with the immobilized dT37 through the addition
Figure 5. (A) Protein immobilization on NHS-dT37 (a) or DVS-AdT37 (b) resins. In each panel, the resins in the microcentrifuge tubes were incubated with sfGFP-SSB (left) or sfGFP (right) and then washed extensively. (B) Protein modified NHS-dT37 (a,b,c) and DVS-A-dT37 (d,e,f) imaged using fluorescent light (a,b,d,e) or normal white light (c,f). Resins in panels a and d were treated with sfGFP-SSB. Resins in panels b, c, e and f were treated with sfGFP.
of dA35. Binding of the two oligonucleotides generated doublestranded DNA, which did not bind to SSB. In the presence of 125 µM dA35, 82.4% of bound protein was eluted within the first 10 min of incubation (Figure 6A). In addition, the resin could be regenerated by the treatment of free dT37, which competitively bound to dA35 and removed them from the resin.
Site Specific and Reversible Protein Immobilization
Figure 6. (A) Effect of incubation time on protein elution by dA35. (B) NHS-dT37 resins modified with sfGFP-SSB (left), eluted using dA35 (middle), and then regenerated and incubated with fresh sfGFP-SSB (right).
The regenerated resins bound to sfGFP-SSB, as revealed by their color change after incubated with fresh sfGFP-SSB (Figure 6B). To identify a more convenient method to release the fusion protein from the resin, we examined the effect of pH/salt concentration on the elution of the fusion protein. We found that 68.4% of sfGFP-SSB could be eluted by the condition identified above (Na-glycine buffer, 1 mM NaCl, pH 10). To examine the reversibility of binding, the protein eluate was adjusted to pH 8.1 and mixed with fresh resins. In parallel, fresh sfGFP-SSB was added to the resin after pH mediated elution and re-equilibration. In both cases, sfGFP-SSB bound to the resins. In summary, we have demonstrated that SSB could serve as a versatile fusion tag to facilitate ssDNA-mediated protein immobilization. SSB is very stable and shows no negative impact on the overall expression level and stability of the fusion protein. The binding between SSB and ssDNA is very tight, with nanomolar affinity. Yet, such interaction can be attenuated through the change of pH/salt concentration, which could serve as a convenient method to elute the immobilized protein and regenerate the surface without denaturing the fusion protein. In comparison to other DNA- or RNA-mediated protein immobilization methods, our approach has the advantage of not requiring additional chemical modification. Thus, potential complications related to chemical modifications of the target proteins are avoided. The binding between SSB and ssDNA is not site specific. We speculate that incorporation of site specific DNA-binding proteins as fusion tags will introduce an additional level of control over the assembly of protein arrays based on DNA array templates.
LITERATURE CITED (1) Katz, E., and Willner, I. (2003) Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNAsensors, and enzyme biosensors. Electroanalysis 15, 913–47. (2) Kohn, M. (2009) Immobilization strategies for small molecule, peptide and protein microarrays. J. Pept. Sci. 15, 393–7. (3) Yamaguchi, H., Miyazaki, M., Honda, T., Briones-Nagata, M. P., Arima, K., and Maeda, H. (2009) Rapid and efficient proteolysis for proteomic analysis by protease-immobilized microreactor. Electrophoresis 30, 3257–64.
Bioconjugate Chem., Vol. 21, No. 7, 2010 1181 (4) Wu, B. Y., Hou, S. H., Huang, L., Yin, F., Zhao, Z. X., Anzai, J. I., and Chen, Q. (2008) Oriented immobilization of immunoglobulin G onto the cuvette surface of the resonant mirror biosensor through layer-by-layer assembly of multilayer films. Mater. Sci. Eng. C 28, 1065–9. (5) Tan, Y. H., Liu, M., Nolting, B., Go, J. G., Gervay-Hague, J., and Liu, G. Y. (2008) A nanoengineering approach for investigation and regulation of protein immobilization. ACS Nano 2, 2374–84. (6) Batalla, P., Fuentes, M., Mateo, C., Grazu, V., FernandezLafuente, R., and Guisan, J. M. (2008) Covalent immobilization of antibodies on finally inert support surfaces through their surface regions having the highest densities in carboxyl groups. Biomacromolecules 9, 2230–6. (7) Rao, S. V., Anderson, K. W., and Bachas, L. G. (1998) Oriented immobilization of proteins. Mikrochim. Acta 128, 127–43. (8) Cha, T. W., Guo, A., and Zhu, X. Y. (2005) Enzymatic activity on a chip: the critical role of protein immobilization. Proteomics 5, 416–9. (9) Hochuli, E., Bannwarth, W., Dobeli, H., Gentz, R., and Stuber, D. (1988) Genetic approach to facilitate purification of recombinant proteins with a novel metal chelate adsorbent. Nat. Biotechnol. 6, 1321–5. (10) Khan, F., He, M. Y., and Taussig, M. J. (2006) Doublehexahistidine tag with high-affinity binding for protein immobilization, purification and detection on Ni-nitrilotriacetic acid surfaces. Anal. Chem. 78, 3072–9. (11) Fischer, N. O., Blanchette, C. D., Chromy, B. A., Kuhn, E. A., Segelke, B. W., Corzett, M., Bench, G., Mason, P. W., and Hoeprich, P. D. (2009) Immobilization of His-tagged proteins on nickel-chelating nanolipoprotein particles. Bioconjugate Chem. 20, 460–5. (12) Hengen, P. N. (1995) Purification of His-tag fusion proteins from Escherichia coli. Trends Biochem. Sci. 20, 285–6. (13) Shao, W. H., Zhang, X. E., Liu, H., and Zhang, Z. P. (2000) Anchor-chain molecular system for orientation control in enzyme immobilization. Bioconjugate Chem. 11, 822–6. (14) Kacar, T., Zin, M. T., So, C., Wilson, B., Ma, H., GulKaraguler, N., Jen, A. K. Y., Sarikaya, M., and Tamerler, C. (2009) Directed self-immobilization of alkaline phosphatase on micro-patterned substrates via genetically fused metal-binding peptide. Biotechnol. Bioeng. 103, 696–705. (15) Rusmini, F., Zhong, Z. Y., and Jan, F. J. (2007) Protein immobilization strategies for protein biochips. Biomacromolecules 8, 1775–89. (16) Niemeyer, C. M. (2002) The developments of semisynthetic DNA-protein conjugates. Trends Biotechnol. 20, 395–401. (17) Weng, S., Gu, K., Hammond, P. W., Lohse, P., Rise, C., Wagner, R. W., Wright, M. C., and Kuimelis, R. G. (2002) Generating addressable protein microarrays with PROfusion (TM) covalent mRNA-protein fusion technology. Proteomics 2, 48–57. (18) Hendrickson, E. R., Haffield-Truby, T. M., Joerger, R. D., Majarian, W. R., and Ebersole, R. C. (1995) A sensitivity multianalyte immunoassay using covalent DNA-labeled antibodies and polymerase chain reaction. Nucleic Acids Res. 23, 522–9. (19) Schweitzer, B., Wiltshire, S., Lambert, J., O’Malley, S., Kukanskis, K., Zhu, Z., Kingsmore, S. F., Lizardi, P. M., and Ward, D. (2000) Immunoassays with rolling circle DNA amplification: A versatile platform for ultrasensitive antigen detection. Proc. Natl. Acad. Sci. U.S.A. 97, 10113–9. (20) Howorka, S., Cheley, S., and Bayley, H. (2001) Sequencespecific detection of individual DNA strands using engineered nanopores. Nat. Biotechnol. 19, 636–9. (21) Kozlov, I. A., Melnyk, P. C., Stromsborg, K. E., Chee, M. S., Barker, D. L., and Zhao, C. (2004) Efficient strategies for the conjugation of oligonucleotides to antibodies enabling highly sensitive protein detection. Biopolymers 73, 621–30. (22) Glynou, K., Ioannou, P. C., and Christopoulos, T. K. (2003) Affinity capture-facilitated preparation of aequorin-oligonucle-
1182 Bioconjugate Chem., Vol. 21, No. 7, 2010 otide conjugates for rapid hybridization assays. Bioconjugate Chem. 14, 1024–9. (23) Boozer, C., Ladd, J., Chen, S., Yu, Q., Homola, J., and Jiang, S. (2004) DNA directed protein immobilization on mixed ssDNA/oligo(ethylene glycol) self-assembled monolayers for sensitive biosensors. Anal. Chem. 76, 6967–72. (24) Boozer, C., Ladd, J., Chen, S., and Jiang, S. (2006) DNAdirected protein immobilization for simultaneous detection of multiple analytes by surface plasmon resonance biosensor. Anal. Chem. 78, 1515–9. (25) Schlapak, R., Pammer, P., Armitage, D., Zhu, R., Hinterdorfer, P., Vaupel, M., Fruhwirth, T., and Howorka, S. (2006) Glass surfaces grafted with high-density poly(ethylene glycol) as substrates for DNA oligonucleotide microarrays. Langmuir 22, 277–85. (26) Niemeyer, C. M., Boldt, L., Ceyhan, B., and Blohm, D. (1999) DNA-directed immobilization: Efficient, reversible, and siteselective surface binding of proteins by means of covalent DNAstreptavidin conjugates. Anal. Biochem. 268, 54–63. (27) Takeda, S., Tsukiji, S., and Nagamune, T. (2004) Site-specific conjugation of oligonucleotides to the C-terminus of recombinant protein by expressed protein ligation. Bioorg. Med. Chem. Lett. 14, 2407–10. (28) Roberts, R. W., and Szostaks, J. W. (1997) RNA-peptide fusions for the in vitro selection of peptides and proteins. Proc. Natl. Acad. Sci. U.S.A. 94, 12297–302. (29) Biyani, M., Husimi, Y., and Nemoto, N. (2006) Solid-phase translation and RNA-protein fusion: a novel approach for folding quality control and direct immobilization of proteins using anchored mRNA. Nucleic Acids Res. 34, e140.
Zhong et al. (30) Schweller, R. M., Constantinou, P. E., Frankel, N. W., Narayan, P., and Diehl, M. R. (2008) Design of DNA-conjugated polypeptide-based capture probes for the anchoring of proteins to DNA matrices. Bioconjugate Chem. 19, 2304–7. (31) Lee, S. K., Maye, M. M., Zhang, Y. B., Gang, O., and Van der Lelie, D. (2009) Controllable g5p-protein-directed aggregation of ssDNA-gold nanoparticles. Langmuir 25, 657– 60. (32) Meyer, R. R., and Laine, P. S. (1990) The single-stranded DNA-binding protein of Escherichia coli. Microbiol. ReV. 54, 342–80. (33) Lohman, T. M., and Bujalowski, W. (1988) Negative cooperativity within individual tetramers of Escherichia coli single strand binding protein is responsible for the transition between (SSB)35 and (SSB)56 DNA binding modes. Biochemistry 27, 2260–5. (34) Lohman, T. M., and Ferrari, M. E. (1994) Escherichia coli single stranded DNA-binding protein: Multiple DNA-binding modes and cooperativities. Annu. ReV. Biochem. 63, 52770. (35) Overman, L. B., Bujalowski, W., and Lohman, T. M. (1988) Equilibrium binding of Escherichia coli single-strand binding protein to single-stranded nucleic acids in the (SSB)65 binding mode. Cation and anion effects and polynucleotide specificity. Biochemistry 27, 456–71. (36) Raghunathan, S., Kozlov, A. G., Lohman, T. M., and Waksman, G. (2000) Structure of the DNA binding domain of E. coli SSB bound to ssDNA. Nat. Struct. Biol. 7, 648–52. BC9005392
