ARTICLE pubs.acs.org/JAFC
Soyasaponin Ab Ameliorates Colitis by Inhibiting the Binding of Lipopolysaccharide (LPS) to Toll-like Receptor (TLR)4 on Macrophages In-Ah Lee, Young-Jun Park, Eun-Ha Joh, and Dong-Hyun Kim* Department of Life and Nanopharmaceutical Sciences, College of Pharmacy, Kyung Hee University, 1, Hoegi, Dongdaemun-gu, Seoul 130-701, Republic of Korea
bS Supporting Information ABSTRACT: Many clinical studies have shown that daily intake of soybean [Glycine max (L.) Merr., Fabacease] or its foods may reduce the risk of osteoporosis, heart attack, hyperlipidemia, coronary heart disease, cardiovascular and chronic renal diseases, and cancers, including prostate, colon, and breast cancers. Of the soy constituents, soyasaponins exhibit anti-aging, antioxidant, apoptotic, and anti-inflammatory effects. However, the anti-inflammatory effect of soyasaponin Ab has not been thoroughly studied. Therefore, we investigated its anti-inflammatory effects in 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitic mice and lipopolysaccharide (LPS)-stimulated peritoneal macrophages. Soyasaponin Ab inhibited colon shortening, myeloperoxidase activity, the expression of cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS), and activation of the transcription factor nuclear factor-kB (NF-kB). Soyasaponin Ab (1, 2, 5, and 10 μM) inhibited the production of NO (IC50 = 1.6 ( 0.1 μM) and prostaglandin E2 (IC50 = 2.0 ( 0.1 ng/mL), the expression of tumor necrosis factor (TNF)-α (IC50 = 1.3 ( 0.1 ng/mL), interleukin (IL)-1β (IC50 = 1.5 ( 0.1 pg/mL), and toll-like receptor (TLR)4, and the phosphorylation of interleukin-1 receptor-associated kinase (IRAK)-1 in LPS-stimulated peritoneal macrophages. Soyasaponin Ab weakly inhibited the phosphorylation of ERK, JNK, and p38. Soyasaponin Ab significantly reduced the binding of Alexa-Fluor-594-conjugated LPS to peritoneal macrophages. Soyasaponin Ab did not affect TLR4 expression or LPS-induced NF-kB activation in TLR4 siRNA-treated peritoneal macrophages (knockdown efficiency of TLR4 > 94%). On the basis of these findings, soyasaponin Ab may ameliorate colitis by inhibiting the binding of LPS to TLR4 on macrophages. KEYWORDS: Soyasaponin Ab, colitis, TLR4, lipopolysaccharide, NF-kB
’ INTRODUCTION Inflammatory bowel disease (IBD), including ulcerative colitis and Crohn’s disease, is a chronically relapsing disorder of the intestine, and its pathogenic mechanism involves dysregulation of the intestinal immune response to intestinal environmental antigens, such as intestinal microflora.1 4 IBD occurs most frequently in the terminal ileum and colon, where many intestinal microbes reside,2,5 but does not progress significantly in germfree animals,5 indicating that intestinal microflora may play an important role in initiating and perpetuating colonic inflammation. Normal intestinal microflora consists of approximately 500 bacterial species and reaches its highest concentrations in the terminal ileum and colon.6 Intestinal microflora produces toxic compounds, such as Gram-negative bacterial endotoxins, such as, lipopolysaccharides (LPSs) that resemble those found in Escherichia coli.7 9 Most types of LPS are detected at picomolar levels by an ancient receptor of the innate immune system present on the macrophages and endothelial cells of animals.10 LPS activates the biosynthesis of diverse mediators of inflammation, such as tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6, via a toll-like receptor (TLR)4-linked transcription factor nuclear factor-kB (NF-kB) pathway in macrophages and activates the production of costimulatory molecules required for the adaptive immune response.11 TLR4, which is linked to the activation of transcription factor NF-kB via interleukin-1 receptorassociated kinases (IRAKs), serves as the main mediator of intestinal bacterial LPS signaling in intestinal bowel disease.12,13 IRAKs r 2011 American Chemical Society
are protein kinases involved in the signaling of innate immune responses from TLRs. After TLR4 recognizes pathogen-associated molecular patterns, such as LPS, all IRAK members form multimeric receptor complexes.14 In particular, phosphorylated IRAK1 activates a multimeric protein complex composed of TRAF6, TAK1, TAB1, and TAB2 and activated TAK1 phosphorylates both the inhibitor of NF-kB kinases (IKKs) and specific mitogenactivated protein kinase kinases (MKKs). IKKs phosphorylate the NF-kB inhibitor IkB-α, leading to its ubiquitination and subsequent degradation by the proteasome. This degradation of IkB-α allows NF-kB to translocate to the nucleus and bind to specific promoter sequences. On the other hands, activated MKKs phosphorylate and activate members of the JNK/p38 MAP kinase (MAPK) family.15 Furthermore, the activation of NF-kB in mucosal macrophages is accompanied by the increased production and secretion of pro-inflammatory cytokines IL-1β, TNF-α, and IL-6 by the cells but a decrease in IL-10 formation. Soybeans contain phytochemicals, including isoflavones, saponins, phytic acids, and phytosterols.16 Many clinical studies have shown that daily intake of soy foods may reduce the risk of osteoporosis,17 heart attack, hyperlipidemia,18 coronary heart disease,19 cardiovascular and chronic renal diseases,20 and Received: June 9, 2011 Revised: October 11, 2011 Accepted: November 7, 2011 Published: November 07, 2011 13165
dx.doi.org/10.1021/jf2033818 | J. Agric. Food Chem. 2011, 59, 13165–13172
Journal of Agricultural and Food Chemistry
Figure 1. Chemical structure of soyasaponin Ab.
cancers, including prostate,21 colon, and breast cancers.22 Of the soy constituents, soyasaponins exhibit aging-prevention, antioxidant, apoptotic, and anti-inflammatory effects.23,24 Particularly, we found that soyasaponin I inhibits anticolitic effects.25 However, the anti-inflammatory mechanisms of soyasaponins have not been studied thoroughly. Therefore, to clarify the anti-inflammatory mechanism of soyasaponin Ab, we isolated soyasaponin Ab from soybeans and tested its anti-inflammatory effect in LPS-induced peritoneal macrophages and 2,4,6-trinitrobenzene sulfonic acid (TNBS)induced colitic mice.
’ MATERIALS AND METHODS Materials. Dulbecco’s modified Eagle’s medium (DMEM), RPMI 1640, 1,1-diphenyl-2-picryl-hydrazyl (DPPH), penicillin streptomycin, TNBS, and LPS purified from E. coli O111:B4 were purchased from Sigma Co. (St. Louis, MO). Antibodies for cyclooxygenase (COX)-2, inducible NO synthase (iNOS), TNF-α, IL-1β, TLR4, IRAK1, p-IRAK1, IRAK4, and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies for p-IKK-β IkB-α, p65, p-p65, p38, p-p38, JNK, p-JNK, ERK, and p-ERK were purchased from Cell Signaling Technology (Beverly, MA). Enzyme-linked immunosorbent assay (ELISA) kits for cytokines and PGE2 were purchased from R&D Systems (Minneapolis, MN). Other chemicals used were of the highest grade available. Soyasoponin Ab (Figure 1) was isolated from soybeans, as previously reported by Chang et al.26 Animals. Male Institute of Cancer Research (ICR) mice (20 22 g, 4 weeks) and male C57BL/6 (18 22 g, 6 weeks) were supplied from the Orient Animal Breeding Center (Sungnam, Korea). All animals were housed in wire cages at 20 22 °C and 50 ( 10% humidity, fed standard laboratory chow (Samyang Co., Seoul, Korea), and allowed water ad libitum. All experiments were performed in accordance with the National Institutes of Health (NIH) and Kyung Hee University guidelines for Laboratory Animals Care and Use and approved by the Committee for the Care and Use of Laboratory Animals in the College of Pharmacy, Kyung Hee University, Seoul, Korea. Isolation and Culture of Peritoneal Macrophages. Male C57BL/6 mice were intraperitoneally injected with 2 mL of 4% thioglycolate solution.27 Mice were sacrificed 4 days after injection, and the peritoneal cavities were flushed with 10 mL of RPMI 1640. The peritoneal lavage fluids were centrifuged at 200g for 10 min, and the cells
ARTICLE
were resuspended with RPMI 1640 and plated. After incubation for 1 h at 37 °C, the cells were washed 3 times and non-adherent cells were removed by aspiration. Cells were cultured in 24-well plates (0.5 106 cells/well) at 37 °C in RPMI 1640 plus 10% fetal bovine serum (FBS). The attached cells were used as peritoneal macrophages. To examine the anti-inflammatory effects of soyasaponin Ab, peritoneal macrophages were incubated in the absence or presence of soyasaponin Ab with 50 ng/mL LPS. Preparation of Experimental Colitic Mice. The ICR mice were randomly divided into five groups: normal and TNBS-induced colitic groups treated with or without soyasaponin Ab or sulfasalazine. Each group consisted of 10 mice. TNBS-induced colitis was induced by the administration of 2.5% (w/v) TNBS solution (100 μL) in 50% ethanol into the colon of anesthetized mice via a thin round-tip needle equipped with a 1 mL syringe.28 The normal group was treated with just the vehicle. The needle was inserted so that the tip was 3.5 4 cm proximal to the anal verge. To distribute the agents within the entire colon and cecum, mice were held in a vertical position for 30 s after the injection. Using this procedure, >95% of the mice retained the TNBS enema. If an animal quickly excreted the TNBS ethanol solution, it was excluded from the remainder of the study. Soyasaponin Ab (10 and 20 mg/kg) or sulfasalazine (50 mg/kg) dissolved in 2% Tween 80 were orally administered once a day for 5 days, beginning 3 days before TNBS administration. The mice were sacrificed on the third day after TNBS administration. The colon was quickly removed, opened longitudinally, and gently cleared of stool by phosphate-buffered saline (PBS). Macroscopic assessment of the disease grade was scored according to a previously reported scoring system (0, no ulcer and no inflammation; 1, ulceration and local hyperemia; 2, ulceration without hyperemia; 3, ulceration and inflammation at one site only; 4, two or more sites of ulceration and inflammation; 5, ulceration extending more than 2 cm.29 Then, the entire colon tissue was used for immunoblot and enzyme-linked immunosorbent assay (ELISA) analysis. For the histological exam, the middle part of the colon was fixed in 10% buffered formalin solution, cut into 7 μm sections, stained with hematoxylin eosin, and assessed under light microscopy. Immunostaining for Myeloperoxidase. Immunolocalization of neutrophils was analyzed using a three-step staining procedure consisting of sequential incubation with first and second antibodies and a streptavidin biotin complex with horseradish peroxidase (HRP). Inflammatory cell profiles in the colonic tissues were investigated using anti-neutrophil [myeloperoxidase (MPO), CD66b, and neutrophil elastase] antibodies. The serial sections were subjected to this procedure. HRP activity was visualized with 3-amino-9-ethylcarbazole. Colon Tissue Preparation. Colon tissues were excised, perfused with ice-cold perfusion solution containing 0.15 M KCl and 2 mM ethylenediaminetetraacetic acid (EDTA) (pH 7.4), and homogenized in 50 mM Tris-HCl buffer (pH 7.4). The homogenates were centrifuged at 10000g at 4 °C for 30 min. The supernatant was used for the estimation of the antioxidant defense system. For immunoblot analysis and ELISA, colon tissues were carefully homogenized in 1 mL of ice-cold RIPA lysis buffer containing 1% protease inhibitor cocktail and 1% phosphatase inhibitor cocktail.
Assay of Myeloperoxidase Activity in Colonic Mucosa. Colons isolated from the mice were homogenized in a solution containing 0.5% hexadecyl trimethyl ammonium bromide dissolved in 10 mM potassium phosphate buffer (pH 7.0) and then centrifuged for 30 min at 20000g at 4 °C. A 50 μL aliquot of the supernatant was added to the reaction mixture consisting of 1.6 mM tetramethyl benzidine and 0.1 mM H2O2 and incubated at 37 °C. After that, the absorbance was measured at 650 nm. The myeloperoxidase activity was defined as the quantity of enzyme degrading 1 μmol/mL peroxide at 37 °C and expressed in units per milligram of protein.30 The protein content was assayed by Bradford’s method.31 Determination of Nitric Oxide and Cytokines. Nitrite was measured in culture media using Griess reagent.32 The culture 13166
dx.doi.org/10.1021/jf2033818 |J. Agric. Food Chem. 2011, 59, 13165–13172
Journal of Agricultural and Food Chemistry
ARTICLE
Figure 2. Effects of soyasaponin Ab on (A) colon length, (B) macroscopic score, (C) colonic myeloperoxidase activity, (D) pro-inflammatory and antiinflammatory cytokines, and (E) histology in TNBS-induced colitic mice. TNBS was intrarectally administered in control, soyasaponin Ab (10 and 20 mg/kg), and sulfasalazine (50 mg/kg) groups. (D) These cytokines [(a) TNF-α, (b) IL-1β, (c) IL-6, and (d) IL-10] were assay by ELISA. (E) For histological exams, (a) colon tissues were stained with hematoxylin eosin and (b) inflammatory cell profiles were investigated using anti-neutrophil (MPO, CD66b, and neutrophil elastase) antibodies. All values are the mean ( SD (n = 10). (#) Significantly different versus the normal group (p < 0.05). (/) Significantly different versus the control group (p < 0.05). medium (100 μL) was combined with 100 μL of Griess reagent [mixture of an equal volume of 1% sulfanilamide in 5% H3PO4 and 0.1% N-(1-naphthyl)ethylenediamine dihydrochloride in H2O] in a 96-well plate, and then the absorbance was measured spectrophotometrically at 550 nm. The nitrite concentration was determined using sodium nitrite as a standard. PGE2 and pro-inflammatory cytokines, TNF-α, IL-1β, IL-6, and IL-10, were assessed by ELISA according to the instructions of the manufacturer. Immunoblot Analysis. The supernatant extracts prepared from colon and peritoneal macrophages were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) and transferred onto polyvinylidene difluoride membranes (PVDF). The membranes were blocked with 5% nonfat dried-milk proteins in phosphatebuffered saline with Tween 20 (PBST) and probed with COX-2, iNOS, TNF-α, IL-1β, TLR4, IRAK1, p-IRAK1, p-IKK-β, p-ERK, ERK, p-JNK, JNK, p-p38, p38, IkB-α, p65, p-p65, or β-actin antibody. After washing with PBST, proteins were detected with HRP-conjugated secondary antibodies for 1 h. Bands were visualized with enhanced chemiluminescence (ECL) reagent.33 Immunofluorescent Confocal Microscopy. For the p65 and TLR4 assays, peritoneal macrophages were stimulated with LPS
(100 ng/mL) in the presence or absence of soysaponin Ab for 60 min. The cells were then fixed with 4% formaldehyde and permeabilized with 0.2% Triton X-100. The cells were stained with goat polyclonal anti-p65 and anti-TLR4 antibodies for 2 h at 4 °C and then incubated with secondary antibodies conjugated with Alexa 488 and propidium iodide (10 μg/mL, Calbiochem Co., San Diego, CA) for 1 h. Images were observed by confocal microscopy. Flow Cytometry. Mouse peritoneal macrophages were incubated with or without Alexa-Fluor-488-conjugated LPS (10 μg/mL) for 30 min. The cells were then fixed in PBS containing 4% paraformaldehyde and 3% sucrose for 20 min. The cells were stained with rabbit polyclonal anti-TLR4 antibody for 2 h at 4 °C and then incubated with secondary antibodies conjugated with TRITC for 1 h and then analyzed by flow cytometry.
Transient Transfection of Small RNA Interference (siRNA). Cells were seeded at 3 105 cells/well in 24-well plates and allowed to rest for 1 day prior to the transfection. TLR4 small interfering RNA (siRNA) oligonucleotide corresponding to the sequence GCAUAGAGGUUCCUAA, GAGUUCAGGUUAACAUAUA, GGAAUUGUAUCGCCUUCUU, and UGACGAACCUAGUAGUACAUGU was purchased 13167
dx.doi.org/10.1021/jf2033818 |J. Agric. Food Chem. 2011, 59, 13165–13172
Journal of Agricultural and Food Chemistry
Figure 3. Effect of soyasaponin Ab on TLR4-linked NF-kB activation and COX-2 and iNOS expressions in TNBS-induced colitic mice. TNBS was intrarectally administered in control, soyasaponin Ab (10 and 20 mg/kg), and sulfasalazine (50 mg/kg) groups. The normal group was treated with vehicle alone. The mice were sacrificed; colon epithelial cells were collected; and the TLR-4, IRAK, p-IRAK, IKK-β, iNOS, and COX-2 expression and the NF-kB activation were measured by immunoblot analysis. All values are the mean ( SD (n = 10). (#) Significantly different versus the normal group (p < 0.05). (/) Significantly different versus the control group (p < 0.05). from Dharmacon (Chicago, IL). Cells were transfected with 100 nM siRNA for TLR4 using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the instructions of the manufacturer. At 48 h after transfections, cells were treated with or without soyasaponin Ab (10 μM) and/or LPS (100 ng/mL). Statistical Analysis. Data are presented as the means ( standard deviation (SD) of at least three replicates. Analysis of variation (ANOVA) was used for comparisons between multiple groups (SPSS for Windows 8.0, SPSS, Inc., Chicago, IL). Student’s t test was used for the statistical analysis of the difference noted. p values of 0.05 or less were considered statistically significant.
’ RESULTS AND DISCUSSION Inhibitory Effect of Soyasaponin Ab in TNBS-Induced Colitis. We tested the ability of soyasaponin Ab to inhibit
TNBS-induced colitis in mice. Intrarectal injection of TNBS caused inflammation, manifested by shortened, thickened, and erythematous colons in mice. Treatment with soyasaponin Ab in TNBS-treated mice inhibited body weight reduction, colon shortening, macroscopic score, and myeloperoxidase activity (panels A C of Figure 2). We also measured the inhibitory effect of soyasaponin Ab on the expressions of pro-inflammatory cytokines, TNF-α, IL-1β, IL-6, and IL-10, in the colons of TNBSinduced colitic mice (Figure 2D). TNBS increased the expression of TNF-α, IL-1β, and IL-6 by 3.6-, 4.2-, and 4.6-fold, respectively, but inhibited IL-10 expression by 75.3%. Treatment with soyasaponin Ab in TNBS-treated mice inhibited the expression of these pro-inflammatory cytokines, although β-actin expression was not affected. Soyasaponin Ab at 20 mg/kg inhibited the expression of these cytokines by 38% for IL-1β (p < 0.05), 64% for TNF-α (p < 0.05), and 48% for IL-6 (p < 0.05) but increased IL-10 expression by 77% (p < 0.05). The inhibitory effects of soyasaponin Ab were more potent than
ARTICLE
Figure 4. Effect of soyasaponin Ab on inflammatory mediators in LPSstimulated mouse peritoneal macrophages. After 16 h of incubation with LPS in the absence or presence of soyasaponin Ab (1, 2, 5, and 10 μM), (A) IL-1β, (B) TNF-α, (C) PGE2, and (D) nitrite in the culture medium were measured using ELISA kits (for PGE2, TNF-α, and IL-1β) and Griess reagents (for nitrite). All data are expressed as mean ( SD (n = 3 in a single experiment). (#) Significantly different versus the normal group (p < 0.05). (/) Significantly different versus the control group (p < 0.05).
those of sulfasalazine. Histologic examination of TNBS-treated mouse colons showed increased neutrophils, massive bowel edema, dense infiltration of the superficial layers of the mucosa, and epithelial cell disruption by large ulcerations (panels a and b of Figure 2E). Soyasaponin Ab ameliorated these changes. We measured the effect of soyasaponin Ab on the expression of TLR4, IRAK1, COX-2, and iNOS and the phosphorylation of IRAK1, IKKβ, and p65 in TNBS-induced colitic mice (Figure 3). Soyasaponin Ab also inhibited the expression of TLR4, COX-2, and iNOS and the phosphorylation of IRAK1, IKK-β and p65, although it reversed IRAK-1 expression. Effect of Soyasaponin Ab on Inflammatory Markers in LPS-Stimulated Peritoneal Macrophages. To investigate the anti-inflammatory effect of soyasaponin Ab in vitro, peritoneal macrophages were stimulated with LPS in the presence or absence of soyasaponin Ab. Treatment with LPS alone significantly increased the expression of the pro-inflammatory cytokines, IL-1β and TNF-α, in peritoneal macrophages based on ELISA and immunoblot analysis. Soyasaponin Ab significantly reduced LPS-stimulated IL-1β and TNF-α expression (panels A and B of Figure 4). Soyasaponin Ab also inhibited the production of PGE2 and NO (panels C and D of Figure 4). To determine whether soyasaponin Ab has cytotoxic effects, we used the crystal violet method27 to assess cell viability. No cytotoxic effect of soyasaponin Ab was observed under these experimental conditions (see the Supporting Information). We next investigated the effect of soyasaponin Ab on the degradation and phosphorylation of IkB-α in LPS-induced peritoneal macrophages. The cells were stimulated with LPS in the presence or absence of soyasaponin Ab. Treatment with LPS resulted in the phosphorylation and degradation of IkB-α. Cotreatment with soyasaponin Ab and LPS inhibited this degradation and phosphorylation of IkB-α (Figure 5A). Soyasaponin Ab thus suppressed NF-kB activation in lipopolysaccharide-stimulated peritoneal macrophages by blocking IkBα degradation. We used confocal microscopy to examine whether soyasaponin Ab could inhibit the nuclear translocation of NF-kB in LPS-stimulated peritoneal macrophages (Figure 5B). LPS decreased cytosolic 13168
dx.doi.org/10.1021/jf2033818 |J. Agric. Food Chem. 2011, 59, 13165–13172
Journal of Agricultural and Food Chemistry
ARTICLE
Figure 6. Effect of sayasaponin Ab on MAPK activation in LPSstimulated peritoneal macrophages. Peritoneal macrophages were treated with 50 ng/mL LPS in the absence or presence of soyasaponin Ab (10 μM). Phosphorylation of ERK, JNK, and p38 was assessed at 0, 15, 30, 60, and 90 min after the addition of LPS to the culture. MAPK activation was analyzed by immunoblotting.
Figure 5. Effect of soyasaponin Ab on IkB-α degradation and NF-kB activation in LPS-stimulated peritoneal macrophages. Peritoneal macrophages were treated with 50 ng/mL LPS in the absence or presence of soyasaponin Ab (10 μM). Degradation and phosphorylation of IkB-α were assessed at 0, 30, 60, and 120 min after the addition of LPS to the cultures. (A) β-Actin was used as a control. (B) NF-kB nuclear translocation was detected by confocal analysis using an antibody for the p65 subunit. (C) Soyasaponin Ab prevented NF-kB nuclear translocation in LPS-stimulated macrophages. NF-kB activation was determined by immunoblot analysis, with cytosolic and nuclear fractions prepared from peritoneal macrophages.
c-Rel, p65, and p50 levels but increased their translocation into the nucleus. Co-treatment with soyasaponin Ab and LPS significantly increased their cytosolic levels and decreased their nuclear levels based on immunoblot analysis. We also investigated the effect of soyasaponin Ab on c-fos and c-jun levels in the cytosolic and nuclear fractions of LPS-stimulated peritoneal macrophages. LPS caused a significant increase in the nuclear content of c-jun and c-fos. However, treatment with soyasaponin Ab inhibited LPS-induced nuclear translocation of c-jun and c-fos finely (Figure 5C). Next, we investigated whether soyasaponin Ab could inhibit the inflammatory response mediated by the MAPK pathway. LPS increased the phosphorylation of ERK1/2, JNK1/2, and p38 MAPK in peritoneal macrophages.
Soyasaponin Ab weakly inhibited the activation of ERK, JNK, and p38 (Figure 6). Inhibitory Effect of Soyasaponin Ab on the Interaction between LPS and TLR4. Using flow cytometry and confocal microscopy analyses, we examined whether soyasaponin Ab could inhibit the interaction between LPS and TLR4 in peritoneal macrophages. Treatment with LPS in the presence of soyasaponin Ab inhibited the binding of LPS to the macrophages compared to the treatment with LPS alone (Figure 7A). When macrophages were treated with Alexa-Fluor-594-conjugated LPS alone, LPS fluorescence was observed outside of the cell membrane by confocal microscope analysis (Figure 7B). Soyasaponin Ab significantly reduced the binding of Alexa-Fluor-594-conjugated LPS to peritoneal macrophages. However, soyasaponin Ab did not affect the fluorescence intensity of TLR-4. Effect of Soyasaponin Ab in TLR4 siRNA-Treated Peritoneal Macrophages. To further confirm whether soyasaponin Ab inhibits the binding of LPS to TLR4 in peritoneal macrophages, peritoneal macrophages were transiently transfected with TLR4 siRNA for 48 h and then protein expression of TLR4 was detected. The knockdown efficiency of TLR4 was >94%, as determined by immunoblot analysis (Figure 8). When the transfected peritoneal macrophages were treated with soyasaponin Ab (10 μM) prior to stimulation with LPS (100 ng/mL) for 4 h, soyasaponin Ab did not significantly inhibit TLR4 expression and LPS-induced NF-kB activation in TLR4 siRNA-treated peritoneal macrophages, as compared to macrophages without TLR4 siRNA. Summary of This Research. There is increasing interest in finding alternative treatments for IBD using herbal medicines/ functional foods and their components because the current medicinal therapies for IBD have toxicities and side effects.33,34 However, the anti-inflammatory mechanisms of such herbal medicines/functional foods have not been clearly proven. Therefore, we searched for new therapies for IBD in the constituents of herbal medicines/functional foods and evaluated the mechanism of action. Soybean, which contains isoflavones and soyasaponins as its main constituents, exhibits anticolitic effects. Of its secondary metabolites, soyasaponin I exerts an anti-inflammatory effect by regulating the activation of the NF-kB pathway in TNBS-induced colitic mice.32 In the present study, we also found that soyasaponin Ab inhibited TNBS-induced colitis in mice. Soyasaponin Ab potently inhibited the expression of pro-inflammatory cytokines TNF-α and IL-1β and their transcription factor NF-kB in the colons of mice treated with TNBS. Furthermore, 13169
dx.doi.org/10.1021/jf2033818 |J. Agric. Food Chem. 2011, 59, 13165–13172
Journal of Agricultural and Food Chemistry
ARTICLE
Figure 8. Effect of soyasaponin Ab on TLR4 expression and NF-kB activation in peritoneal macrophages transfected with or without TLR4 siRNA. Peritoneal macrophage cells were treated with negative-control siRNA or TLR4 siRNA for 24 h and then stimulated in LPS (100 ng/mL) in the absence or presence of soyasaponin Ab (5 and 10 μM) for 4 h. β-Actin was used as an internal control. TLR4, p65, and pp65 proteins were analyzed by immunoblotting.
Figure 7. Inhibitory effect of soyasaponin Ab on the binding of LPS to TLR4 in peritoneal macrophages. (A) Peritoneal macrophages isolated from mice were incubated with Alexa-Fluor-488-conjugated LPS for 30 min in the absence or presence of soyasaponin Ab (5 and 10 μM), and the cells were stained with rabbit polyclonal anti-TLR4 antibody for 2 h at 4 °C, then incubated with secondary antibodies conjugated with TRITC for 1 h, and then analyzed by flow cytometry. (B) The macrophages were stimulated with Alexa-Fluor-594-conjugated LPS (100 ng/mL) for 30 min in the presence or absence of of soyasaponin Ab (5 and 10 μM). The binding of Alexa-Fluor-594-conjugated LPS to TLR4 was detected by confocal microscopy using an Alexa-Fluor-488conjugated secondary antibody for the TLR4.
soyasaponin Ab also potently inhibited the expression of TNF-α, IL-1β, COX-2, and iNOS in LPS-stimulated peritoneal macrophages. However, soyasaponin Ab barely inhibited the expression of pro-inflammatory cytokines, IL-1β and TNF-α, in peptidoglycan (TLR2 stimulator)-stimulated peritoneal macrophages (data not shown). Soyasaponin Ab inhibited LPS-induced IKK-β phosphorylation and IkB-α degradation. However, it increased cytosolic c-Rel, p65, and p50 levels, which were reduced by LPS. Furthermore, soyasaponin Ab inhibited the phosphorylation of the p65 subunit of NF-kB and its translocation into the nucleus. Soyasaponin Ab also inhibited the activation of ERK, JNK, and p38.
Furthermore, soyasaponin Ab did not inhibit LPS-induced nuclear translocation of c-jun and c-fos in LPS-stimulated peritoneal macrophages. These results suggest that soyasaponin Ab may regulate the activation of NF-kB by regulating upstream signaling. Furthermore, soyasaponin Ab inhibited the binding of LPS to TLR4 on peritoneal macrophages. Meanwhile, peritoneal macrophages transfected with TLR4 siRNA exhibited downregulated expression of TLR4 as well as attenuated LPS-induced NF-kB activation, as previously reported.35 However, soyasaponin Ab could not reverse NF-kB activation in TLR4 siRNA-transfected peritoneal macrophages stimulated with LPS. These results suggest that soyasaponin Ab may inhibit NF-kB and AP-1 activation by regulating the binding of LPS to TLR4 on macrophages. TLR4 is activated in various inflammatory diseases, including IBD.13 The binding of LPS to TLR4 activates IRAK-1, which is involved in host defense mechanisms, either in the identification of pathogens or as a receptor for pro-inflammatory cytokines.36 Various inflammatory diseases involve the overexpression of pro-inflammatory cytokines, such as TNF-α and IL-1β.37 Soyasaponin Ab inhibited IRAK-1 and IKK-β phosphorylations as well as NF-kB activation in LPS-stimulated peritoneal macrophages. On the basis of these findings, soyasaponin Ab may ameliorate colitis by inhibiting the binding of LPS to TLR4 on macrophages.
’ ASSOCIATED CONTENT
bS
Supporting Information. Effect of soyasaponin Ab on the TNF-α expression in blood, intestine tissue, and liver of mice intraperitoneally injected with LPS (Figure S1) and cytotoxicity of soyasaponin Ab (2, 5, 10, and 20 μM) in the presence LPS (50 ng/mL), with cells incubated for 20 h and then cell viability measured by crystal violet staining (Figure S2). This material is available free of charge via the Internet at http://pubs.acs.org.
’ AUTHOR INFORMATION Corresponding Author
*Telephone: +82-2-961-0374. Fax: +82-2-957-5030. E-mail: dhkim@ khu.ac.kr. 13170
dx.doi.org/10.1021/jf2033818 |J. Agric. Food Chem. 2011, 59, 13165–13172
Journal of Agricultural and Food Chemistry Funding Sources
This study was supported by a grant from the World Class University Program through the National Research Foundation of Korea funded by the Ministry of Education, Science, and Technology (R33-2008-000-10018-0).
’ ABBREVIATIONS USED TLR, toll-like receptor; LPS, lipopolysaccharide; IL, interleukin; TNF, tumor necrosis factor; NF-kB, nuclear factor-kB; DMEM, Dulbecco’s modified Eagle’s medium; IRAK, interleukin-1 receptorassociated kinase; PAGE, polyacrylamide gel electrophoresis; COX2, cyclooxygenase-2; ECL, enhanced chemiluminescence; iNOS, inducible nitric oxide synthase. ’ REFERENCES (1) Shanahan, F. Crohn’s disease. Lancet 2002, 359, 62–69. (2) Binder, V. Epidemiology of IBD during the twentieth century: An integrated view. Best Pract. Res., Clin. Gastroenterol. 2004, 52, 463–479. (3) Benno, P.; Leijonmarck, C. E.; Monsen, U.; Uribe, A.; Midtvedt, T. Functional alterations of the microflora in patients with ulcerative colitis. Scand. J. Gastroenterol. 1993, 28, 839–844. (4) Berrebi, D.; Maudinas, R.; Hugot, J. P.; Chamaillard, M.; Chareyre, F.; De Lagausie, P.; Yang, C.; Desreumaux, P.; Giovannini, M.; Cezard, J. P.; Zouali, H.; Emilie, D.; Peuchmaur, M. Card15 gene overexpression in mononuclear and epithelial cells of the inflamed Crohn’s disease colon. Gut 2003, 52, 840–846. (5) Chandran, P.; Satthaporn, S.; Robins, A.; Eremin, O. Inflammatory bowel disease: Dysfunction of GALT and gut bacterial flora (II). Surgeon 2003, 1, 125–136. (6) Lee, I. A.; Kim, D. H. Klebsiella pneumoniae increases the risk of inflammation and colitis in a murine model of intestinal bowel disease. Scand. J. Gastroenterol. 2011, 46, 684–693. (7) Gvozdenovic, L.; Pasternak, J.; Milovanovic, S.; Ivanov, D.; Milic, S. Streptococcal toxic shock syndrome. Med. Pregl. 2010, 63, 550–553. (8) Ilg, K.; Endt, K.; Misselwitz, B.; Stecher, B.; Aebi, M.; Hardt, W. D. O-Antigen-negative Salmonella enterica serovar Typhimurium is attenuated in intestinal colonization but elicits colitis in streptomycintreated mice. Infect. Immun. 2009, 77, 2568–2575. (9) Andou, A.; Hisamatsu, T.; Okamoto, S.; Chinen, H.; Kamada, N.; Kobayashi, T.; Hashimoto, M.; Okutsu, T.; Shimbo, K.; Takeda, T.; Matsumoto, H.; Sato, A.; Ohtsu, H.; Suzuki, M.; Hibi, T. Dietary histidine ameliorates murine colitis by inhibition of proinflammatory cytokine production from macrophages. Gastroenterology 2009, 136, 564–574. (10) Aderem, A.; Ulevitch, R. J. Toll-like receptors in the induction of the innate immune response. Nature 2000, 406, 782–787. (11) Medzhitov, R.; Janeway, C., Jr. Innate immunity. N. Engl. J. Med. 2000, 343, 338–344. (12) Ingalls, R. R.; Heine, H.; Lien, E.; Yoshimura, A.; Golenbock, D. Lipopolysaccharide recognition, CD14, and lipopolysaccharide receptors. Infect. Dis. Clin. North Am. 1999, 13, 341–353. (13) Cario, E.; Podolsky, D. K. Differential alteration in intestinal epithelial cell expression of toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease. Infect. Immun. 2000, 68, 7010–1017. (14) O’Neill, L. A.; Dinarello, C. A. The IL-1 receptor/toll-like receptor superfamily: Crucial receptors for inflammation and host defense. Immunol. Today 2000, 21, 206–209. (15) Janssens, S.; Beyaert, R. Functional diversity and regulation of different interleukin-1 receptor-associated kinase (IRAK) family members. Mol. Cell 2003, 11, 293–302. (16) Shiraiwa, M.; Harada, K.; Okubo, K. Composition and structure of “group B saponin” in soybean seed. Agric. Biol. Chem. 1991, 55, 911–917.
ARTICLE
(17) Arjmandi, B. H.; Getlinger, M. J.; Goya, N. V.; Alekel, L.; Hasler, C. M.; Juma, S.; Drum, M. L.; Hollis, B. W.; Kukreja, S. C. Role of soy protein with normal or reduced isoflavone content in reversing bone loss induced by ovarian hormone deficiency in rats. Am. J. Clin. Nutr. 1998, 68, 1358S–1363S. (18) Zha, L. Y.; Mao, L. M.; Lu, X. C.; Deng, H.; Ye, J. F.; Chu, X. W.; Sun, S. X.; Luo, H. J. Anti-inflammatory effect of soyasaponins through suppressing nitric oxide production in LPS-stimulated RAW 264.7 cells by attenuation of NF-kB-mediated nitric oxide synthase expression. Bioorg. Med. Chem. Lett. 2011, 21, 2415–2418. (19) Lucas, E. A.; Lightfoo, S. A.; Hammond, L. J.; Devareddy, L.; Khalil, D. A.; Daggy, B. P.; Soung do, Y.; Arjmandi, B. H. Soy isoflavones prevent ovariectomy-induced atherosclerotic lesions in Golden Syrian hamster model of postmenopausal hyperlipidemia. Menopause 2003, 10, 314–321. (20) Russo, P. Partial nephrectomy achieves local tumor control and prevents chronic kidney disease. Expert Rev. Anticancer Ther. 2006, 6, 1745–1751. (21) Zhang, W.; Popovich, D. G. Effect of soyasapogenol A and soyasapogenol B concentrated extracts on HEP-G2 cell proliferation and apoptosis. J. Agric. Food Chem. 2008, 56, 2603–2608. (22) Bajpai, A. K.; Park, J. H.; Moon, I. J.; Kang, H.; Lee, Y. H.; Doh, K. O.; Suh, S. I.; Chang, B. C.; Park, J. G. Rapid blockade of telomerase activity and tumor cell growth by the DPL lipofection of ribbon antisense to hTR. Oncogene 2005, 24, 6492–6501. (23) Westerlund, C.; Ostlund-Lindqvist, A. M.; Sainsbury, M.; Shertzer, H. G.; Sj€oquist, P. O. Characterization of novel indenoindoles. Part I. Structure activity relationships in different model systems of lipid peroxidation. Biochem. Pharmacol. 1996, 51, 1397–1402. (24) Lee, S. O.; Simons, A. L.; Murphy, P. A.; Hendrich, S. Soyasaponins lowered plasma cholesterol and increased fecal bile acids in female golden Syrian hamsters. Exp. Biol. Med. 2005, 230, 472–478. (25) Lee, I. A.; Park, Y. J.; Yeo, H. K.; Han, M. J.; Kim, D. H. Soyasaponin I attenuates TNBS-induced colitis in mice by inhibiting NF-kB pathway. J. Agric. Food Chem. 2010, 58, 10929–10934. (26) Chang, S. Y.; Han, M. J.; Han, S. J.; Kim, D. H. Metabolism of soyasaponin I by human intestinal microflora and its estrogenic and cytotoxic effects. Biomol. Ther. 2009, 17, 430–437. (27) Park, Y. J.; Liu, G.; Lorne, E. F.; Zhao, X.; Wang, J.; Tsuruta, Y.; Zmijewski, J.; Abraham, E. PAI-1 inhibits neutrophil efferocytosis. Proc. Natl. Acad. Sci. U.S.A. 2008, 105, 11784–11789. (28) Joh, E. H.; Lee, I. A.; Han, S. J.; Chae, S.; Kim, D. H. Lancemaside A ameliorates colitis by inhibiting NF-kB activation in TNBSinduced colitis mice. Int. J. Colorectal Dis. 2010, 5, 545–551. (29) Hollenbach, E.; Vieth, M.; Roessner, A.; Neumann, M.; Malfertheiner, P.; Naumann, M. Inhibition of RICK/nuclear factor-kB and p38 signaling attenuates the inflammatory response in a murine model of Crohn disease. J. Biol. Chem. 2005, 280, 14981–14988. (30) Mullane, K. M.; Kraemer, R.; Smith, B. Myeloperoxidase activity as a quantitative assessment of neutrophil infiltration into ischemic myocardium. J. Pharmacol. Methods 1985, 14, 157–167. (31) Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal. Biochem. 1976, 72, 248–254. (32) Lee, I. A.; Park, Y. J.; Yeo, H. K.; Han, M. J.; Kim, D. H. Soyasaponin I attenuates TNBS-induced colitis in mice by inhibiting NF-kB pathway. J. Agric. Food Chem. 2010, 58, 10929–10934. (33) Bai, A. P.; Ouyang, Q.; Hu, R. W. Basic research on inflammatory bowel disease in China. J. Dig. Dis. 2007, 8, 194–197. (34) Bukovska, A.; Cikos, S.; Juhas, S.; Il’kova, G.; Rehak, P.; Koppel, J. Effects of a combination of thyme and oregano essential oils on TNBS-induced colitis in mice. Mediators Inflammation 2007, 2007, No. 23296. (35) Xu, Z.; Huang, C. X.; Li, Y.; Wang, P. Z.; Ren, G. L.; Chen, C. S.; Shang, F. J.; Zhang, Y.; Liu, Q. Q.; Jia, Z. S.; Nie, Q. H.; Sun, Y. T.; Bai, X. F. Toll-like receptor 4 siRNA attenuates LPS-induced secretion of inflammatory cytokines and chemokines by macrophages. J. Infect. 2007, 55, e1–e9. 13171
dx.doi.org/10.1021/jf2033818 |J. Agric. Food Chem. 2011, 59, 13165–13172
Journal of Agricultural and Food Chemistry
ARTICLE
(36) Li, S.; Strelow, A.; Fontana, E. J.; Wesche, H. IRAK-4: A novel member of the IRAK family with the properties of an IRAK-kinase. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 5567–5572. (37) Moynagh, P. N. The NF-kB pathway. J. Cell Sci. 2005, 118, 4589–4592.
13172
dx.doi.org/10.1021/jf2033818 |J. Agric. Food Chem. 2011, 59, 13165–13172
