Split2 protein-ligation generates active IL-6-type Hyper-cytokines from

Subscriber access provided by READING UNIV

Article 2

Split protein-ligation generates active IL-6type Hyper-cytokines from inactive precursors. Jens Mark Moll, Melanie Wehmöller, Nils Christopher Frank, Lisa Homey, Paul Baran, Christoph Garbers, Larissa Lamertz, Jonathan H. Axelrod, Eithan Galun, Henning D. Mootz, and Jürgen Scheller ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.7b00208 • Publication Date (Web): 14 Nov 2017 Downloaded from http://pubs.acs.org on November 15, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Synthetic Biology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Synthetic Biology

Split2 protein-ligation generates active IL-6-type Hypercytokines from inactive precursors. Jens M. Moll1, Melanie Wehmöller1, Nils C. Frank1, Lisa Homey1, Paul Baran1, Christoph Garbers2, Larissa Lamertz1, Jonathan H. Axelrod3, Eithan Galun3, Henning D. Mootz4, Jürgen Scheller1*

1

Institute of Biochemistry and Molecular Biology II, Heinrich-Heine University, 40225 Düsseldorf, Germany. Institute of Biochemistry, Kiel University, 24118 Kiel, Germany. 3 Goldyne Savad Institute of Gene Therapy, Hadassah Medical Organization, 91120 Jerusalem, Israel. 4 Department Chemistry and Pharmacy, Institute of Biochemistry, University of Muenster, 48149 Münster, Germany. 2

KEYWORDS IL-6, IL-11, trans-signaling, split-inteins ABSTRACT: Trans-signaling of the major pro- and anti-inflammatory cytokines Interleukin (IL)-6 and IL-11 has the unique feature to virtually activate all cells of the body and is critically involved in chronic inflammation and regeneration. Hyper-IL-6 and Hyper-IL-11 are single chain designer trans-signaling cytokines, in which the cytokine and soluble receptor units are trapped in one complex via a flexible peptide linker. Albeit, Hyper-cytokines are essential tools to study trans-signaling in vitro and in vivo, the superior potency of these designer cytokines are accompanied by undesirable stress responses. To enable tailor-made generation of Hyper-cytokines, we developed inactive split-cytokine-precursors adapted for posttranslational reassembly by split-intein mediated protein trans-splicing (PTS). We identified cutting sites within IL-6 (E134/S135) and IL-11 (G116/S117) and obtained inactive splitHyper-IL-6 and split-Hyper-IL-11 cytokine precursors. After fusion with split-inteins, PTS resulted in reconstitution of active Hyper-cytokines, which were efficiently secreted from transfected cells. Our strategy comprises the development of a background-free cytokine signaling system from reversibly inactivated precursor cytokines.

INTRODUCTION IL-6 and IL-11 are major cytokines with pro- and antiinflammatory properties. Both cytokines induce signaling through binding to membrane bound α-receptors, namely the IL-6R or the IL-11R. In addition to signaling via its membrane bound receptor, IL-6 is also able to perform trans-signaling via a naturally occurring soluble form of the IL-6R (sIL-6R) generated by ectodomain shedding and alternative splicing 1-3. Both membrane bound and soluble IL-6/IL-6R complexes recruit a homodimer of glycoprotein 130 kDa (gp130) and induce subsequent activation of downstream signaling pathways Janus kinase/signal transducer and activator of transcription (Jak/STAT) 4, phosphatidylinositol 3-kinase cascade 5, and the mitogen-activated protein kinase cascade 6. Remarkably, IL-6 classic and trans-signaling are associated with different physiological responses. While classic-signaling is attributed with regenerative functions and induction of acute phase response 7, IL-6 trans-signaling is heavily associated with chronic inflammatory processes 7. Similarly to IL-6, there seems to be trans-signaling for IL-11 8. However, the consequences of IL-11 trans-signaling in vivo are currently unknown. Specific and background-free activation of IL-6 or IL11 trans-signaling can be induced by Hyper-cytokines which

are synthetic booster cytokine fusion proteins consisting of soluble cytokine α-receptors and their respective cytokine connected by a flexible linker segment 9, 10. To further distinguish between the functions of classic and trans-signaling of IL-6 and its related cytokines, in vivo models such as transgenic mice are essential. Unfortunately, to date no mice transgenic for Hyper-cytokines have been described. This is likely due to the superior potency of these designer cytokines which are accompanied by undesirable stress responses 11. For the viral homologue of IL-6 (vIL-6), which is a poor activator of IL-6 trans-signaling as compared to Hyper-IL-6, we demonstrated that moderate serum concentrations in transgenic mice above 130 ng/ml were lethal and massively ill vIL-6 transgenic mice could only be established with much lower expression levels11. To tackle this problem we developed a strategy enabling the expression of super-active Hyper-cytokines without inducing untimely side-effects and lethality. Therefore we adopted split-intein mediated protein ligation in a process called reversible inactivation via self-splicing inteins (Internal proteins) for Hyper-cytokine generation. Using this strategy we aimed to produce inactive Hyper-cytokine precursors that can be activated via split-intein mediated protein trans-splicing (PTS).

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Inteins are naturally occurring proteins found in all domains of life that excise themselves from precursor proteins in a process called protein trans-splicing 12. In split-inteins the intein domain is split into two fragments that are located on two separate polypeptide chains. Following non-covalent association of the N- and C-terminal fragments protein transsplicing can occur and will give rise to the ligation of the fused peptide or protein segments 12. The splicing process is carried out over a wide range of time-scales and occurs in matters of seconds to minutes for the fastest split-inteins 13, 14. Boundary conditions including temperature, redox environment and pH optima are intein-dependent. Split-inteins have successfully been used for a variety of applications including protein purification and labeling 15, or to reconstitute large or harmful proteins expressed from separate plasmids in vitro 16, 17. There are numerous studies describing the application of split-inteins in eukaryotic cells. These include PTS mediated protein ligation for a variety of purposes like fluorescence labeling 18, induced cell organelle targeting 19 or reconstitution of large hard to express or difficult to clone genes e.g. the L-type calcium channel 16. In addition there is a scarce number of in vivo studies in mice and drosophila using split-intein splicing in vivo e.g. to reconstitute cre drivers from split cre recombinase in order to control gene expression 20 or to induce enzyme activity through rapamycin dependent conditional protein splicing 21. However, to the best of our knowledge split-intein mediated PTS has not been applied to the production of secreted proteins via the secretory pathway of eukaryotic cells. For efficient protein ligation within the secretory compartment split-inteins have to tolerate a variety of different reaction conditions including different redox conditions. We chose the two split-inteins gp41-1 and IMPDH which rely on a Ser instead of a Cys amino acid residue in position +1 of the Cextein (first amino acid downstream the InteinC). These two split-inteins exhibit the highest trans-splicing rates and yields, which rates up to 10-fold and 6-fold higher than the wellknown Npu DnaE intein, and have been demonstrated to be active under a broad variety of reaction conditions 22. Both split-inteins might be active under the variety of conditions prevailing in the secretory compartment 13, 22. Here we report the development of a system suitable for generation of secreted proteins through split-intein mediated PTS of inactive cytokine-precursors suggesting PTS within the ER-Golgi compartment. Moreover, protein ligation is demonstrated with inactive split-cytokine precursors of the designercytokines Hyper-IL-6 (I-H-IL-6AB-CD-Fc) and Hyper-IL-11 (IH-IL-11 AB-CD-Fc). RESULTS AND DISCUSSION Split-intein mediated protein ligation of sIL-6R and IL-6 generates active Hyper-IL-6 We aimed to generate H-IL-6-Fc using a split-intein based expression strategy. In this approach H-IL-6-Fc is formed through split-intein mediated protein ligation from individually expressed sIL-6R and IL-6 fused to the N- and C-terminal halves of the split-inteins, respectively (Fig 1A). H-IL-6-Fc formed through split-intein mediated protein ligation following co-transfection of two plasmids encoding Hyper-IL-6-Fc precursors was termed I-H-IL-6-Fc. Because splicing has to be most likely executed under the redox conditions prevailing in the ER-Golgi compartment, we selected the split-inteins gp411 and IMPDH. These two split inteins are highly effective and

Page 2 of 29

tolerate a variety of reaction conditions22. Two types of expression vectors containing 1) the IL-6R signal peptide in frame with the sequence encoding sIL-6R followed by the Nterminal half of the split-inteins gp41-1 or IMPDH (gpIN or IN, respectively) and the ER-retention signal KDEL (ER) or 2) the IL-6 signal peptide fused to the C-terminal half of the splitinteins gp41-1 or IMPDH (gpIC or IC, respectively) in frame with IL-6 and an Fc tag were generated (Fig. S1). Coexpression of plasmids coding for sIL-6R-gpIN-ER and gpICIL-6-Fc or sIL-6R-IN-ER and IC-IL-6-Fc in COS-7 or HEK293 cells resulted in the formation of I-H-IL-6-Fc in cell lysates and supernatants (Fig. 1B, Fig. 2A, Fig. S2). gp41-1 mediated formation of I-H-IL-6-Fc was observed via Western blotting in supernatants and cell lysates of HEK293 cells co-transfected with expression plasmids encoding sIL-6R-gpIN (SGY) and gpIC-IL-6-Fc or sIL-6R-gpIN and gpIC-IL-6-Fc . sIL-6R-gpIN (SGY) and sIL-6R-gpIN differ in the linker connecting sIL-6R and gpIN (Fig. S1). Based on Western blotting both combinations produced I-H-IL-6-Fc, however, large amounts of unligated products were observed as dominant low molecular weight bands. Protein ligation of sIL-6R (sIL-6R-IN-ER) and IL-6-Fc (IC-IL-6-Fc) via IMPDH was very efficient as judged from the presence of comparably low amounts of non-ligated sIL-6R or IL-6-Fc in supernatants or lysates of co-transfected cells (Fig. 2A). Using the split-intein gp41-1 more non-ligated sIL-6R (sIL-6R-gpIN-ER) and IL-6-Fc (gpIC-IL-6-Fc) intein fusion proteins and less I-H-IL-6-Fc were detected (Fig. 1B). Thus we selected IMPDH as the split-intein better suited for our purpose. To quantify PTS mediated I-H-IL-6-Fc formation, we developed an ELISA that specifically recognizes the complex IL-6/sIL-6R and H-IL-6-Fc but neither the individual components IL-6 nor IL-6R. In short, the ELISA uses a coating antibody directed against IL-6 and a detection antibody directed against sIL-6R. Using this H-IL-6-complex ELISA, we detected comparable amounts (240 and 260 ng/ml) of H-IL-6-Fc formation in cell culture supernatants through standard overexpression of a H-IL-6-Fc fusion protein from a control plasmid or co-expression (sIL-6R-IN-ER/IC-IL-6) induced PTS (Fig. 2B). Importantly, no I-H-IL-6 was detected in sIL-6R-INER or IC-IL-6-Fc transfected cells, verifying that the ELISA did not cross-react with IL-6 or sIL-6R. Correct processing and formation of PTS generated I-H-IL6-Fc was assessed via its biological activity using Ba/F3 cells stably transduced with gp130. Ba/F3-gp130 cells are murine pre-B cells that proliferate solely upon IL-3 or H-IL-6 stimulation. Incubation of Ba/F3-gp130 cells with conditioned supernatants containing I-H-IL-6-Fc induced proliferation while supernatants of sIL-6R-IN-ER, IC-IL-6-Fc or eGFP transfected cells did not induce proliferation (Fig. 2C). H-IL-6-Fc stimulation of gp130 expressing cells induces STAT3 tyrosine phosphorylation 23. Thus, we further compared the biological activities of standard expression of H-IL-6-Fc from a single cDNA and PTS derived I-H-IL-6-Fc by analyzing STAT3 phosphorylation. As depicted in Figure 2D, conditioned supernatants containing I-H-IL-6-Fc induce STAT3 phosphorylation in Ba/F3-gp130 cells similar to a H-IL-6-Fc control. Thus, it can be concluded that PTS mediated I-H-IL-6-Fc formation yields correctly assembled biologically active Hyper-cytokines. Secretion of Hyper-IL-6 precursor IC-IL-6-Fc has been observed by Western blotting, while sIL-6R-IN-ER was retained in the ER (Fig. 2A). However, to confirm that the biological


Page 3 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


activity observed in conditioned supernatants is due to I-H-IL6-Fc formation and not due to the presence of a complex of secreted IL-6 and sIL-6R, inhibition assays with tocilizumab were performed. Tocilizumab is an anti-human IL-6R neutralizing antibody that prevents formation of IL-6/sIL-6R complexes 24. Importantly, tocilizumab interferes with IL-6/sIL6R,- but not with H-IL-6-induced signaling 25. As expected, stimulation of Ba/F3-gp130 cells with conditioned supernatants containing H-IL-6-Fc and I-H-IL-6-Fc induced proliferation in the absence and presence of tocilizumab, whereas tocilizumab prevented the proliferation of Ba/F3-gp130 cells following incubation with IL-6 and sIL-6R (Fig. 2E). In contrast, the IL-6 trans-signaling-specific inhibitor sgp130Fc, which blocks both IL-6/sIL-6R and H-IL-6 26, was able to inhibit IH-IL-6-Fc induced proliferation and STAT3 phosphorylation (Fig. 2D and 2F). Thus, it can be concluded that active I-H-IL6-Fc is secreted following split-intein mediated protein ligation. To independently analyze that sIL-6R-IN-ER is not secreted to form unligated IL-6/sIL-6R complexes, splicing-deficient mutants sIL-6R-mIN-ER and mIC-IL-6-Fc were generated. Essential catalytic amino-acid residues in IN at position Cys1, in IC at position Asn40 and in the C-extein at position Ser+1 were changed to Ala to disrupt the trans-splicing activity of the split-inteins 13. Co-expression of sIL-6R-mIN-ER and mICIL-6 did not yield I-H-IL-6-Fc as shown by Western blotting and ELISA (Fig. 3A, B). However, supernatants of cells coexpressing sIL-6R-mIN-ER and mIC-IL-6-Fc did induce proliferation in Ba/F3-gp130 cells (Fig. 3C), indicating that despite the ER retention signal within sIL-6R-mIN-ER a complex of sIL-6R-IN-ER and IC-IL-6-Fc may be formed in the culture supernatant that induces IL-6 trans-signaling. Taken together, we demonstrate that biologically active I-HIL-6-Fc is generated through split-intein mediated PTS of IL-6 and sIL-6R. Inteins typically require reducing conditions for their activity, because they operate with two catalytic cysteines that are involved in the formation of thioesterintermediates 27-29. However, non-reducing conditions are encountered in the cellular secretory compartments 9. To the best of our knowledge, split-intein mediated protein ligation of secreted proteins within the ER-Golgi has not been demonstrated thus far. Using our split-intein based expression system we obtained PTS mediated Hyper-cytokine formation through the secretory pathway. While we do not have direct evidence for PTS to occur within the secretory compartment, we find it highly unlikely to occur in the cytosol, due to the presence of signal peptides on both precursors, or the extracellular space judging from the absence of sIL-6R-IN-ER in cell culture supernatants. In addition, it is well known that IL-6 and its receptor are secreted via classical secretion through the ERGolgi pathway 30-32. Further, we demonstrate that using splicing deficient intein mutants, the I-H-IL-6-Fc formation is strongly diminished but not completely abrogated, albeit nonfused biologically active IL-6/sIL-6R complexes were formed. Possibly this is due to leakage of sIL-6R-IN-ER into the cell culture supernatant followed by non-covalent complex formation with IC-IL-6-Fc. Split2-Cytokine protein-ligation: Combination of Split-IL-6 variants and split-inteins generates I-H-IL-6AB-CD-Fc Our above described approach generates secreted IC-IL-6Fc. This could be problematic especially for in vivo applica-

tions since the secreted IC-IL-6-Fc will be able to induce IL-6 classic signaling via membrane bound IL-6R. Furthermore it may form a complex with endogenous sIL-6R and induce trans-signaling. Thus, to prevent secretion of biologically active IL-6 that might induce classic and trans-signaling, we designed biologically inactive split-IL-6 variants. Within these mutants we separated crucial binding sites for IL-6R and gp130 by physically splitting IL-6 into two separately expressed halves. These can be rejoined via split-inteins yielding active H-IL-6 (Fig. 4A). For optimal split-intein mediated protein ligation these split-inteins require a Ser residue as the first amino acid of the C-extein 22. IL-6 is a four helix bundle cytokine with an up-up-down-down topology and connecting loops AB, BC and CD. Three cleavage positions (S80, S135, T165) within the loop structures of IL-6 were identified that seemed suitable for intein-mediated protein-ligation 33. The identified residues are located in loop segments connecting helices A-B, B-C, and C-D (Fig. 4B). Thr at position 165 in the C-D loop of IL-6 was mutated to Ser to ensure optimal PTS activity. The N-terminal domains A, AB and ABC of IL6 were genetically fused via a linker sequence to the sIL-6R, followed by the N-terminal fragment of split-intein IMPDHand an ER retention signal resulting in cDNAs coding for sIL-6R-IL-6A-IN-ER, sIL-6R-IL-6AB-IN-ER and sIL-6R-IL6ABC-IN-ER, respectively. The corresponding cDNAs coding for IL-6 helices BCD (IC-IL-6BCD-Fc), CD (IC-IL-6CD-Fc) and D (IC-IL-6D-Fc) contained the IL-6 signal peptide, the Cterminal fragment of the split-intein IMPDH followed by the C-terminal IL-6 fragments and an Fc tag. As demonstrated in Figures 4C and 4D, all split-IL-6-fusion proteins were expressed in COS-7 cells. Moreover, we observed split-intein mediated protein ligation and I-H-IL-6 formation for all combinations in cell lysates (I-H-IL-6A-BCD, I-H-IL-6AB-CD and I-HIL-6ABC-D) (Fig. 4C and 4D). I-H-IL-6AB-CD was also detected via Western blotting in cell culture supernatants of transfected COS-7 cells. Albeit, the protein trans-splicing reaction was less efficient for split-IL-6 variants compared to their non-split counterpart, about 3 and 2.5 ng/ml of the fusion proteins I-HIL-6AB-CD-Fc and I-H-IL-6ABC-D-Fc but no I-H-IL-6A-BCD-Fc were detected in cell culture supernatants as determined by ELISA, respectively (Fig. 5A). Interestingly, the amounts of Hyper-cytokine expression was within the physiological activity concentration range of 1-10 ng/ml. Compared to standard H-IL-6-Fc expression and PTS mediated I-H-IL-6-Fc formation approximately 100x less I-H-IL-6AB-CD-Fc and I-H-IL6ABC-D-Fc were generated following PTS mediated reconstitution from split-IL-6 variants. However, I-H-IL-6AB-CD-Fc and I-H-IL-6ABC-D-Fc were biologically active as judged from cell viability and STAT3 phosphorylation assays (Fig. 5 B and C). There was slightly more I-H-IL-6AB-CD-Fc produced compared to I-H-IL-6ABC-D-Fc. Consequently, the I-H-IL-6AB-CD-Fc variant combination was chosen for further experiments. To compare the biological activities of I-H-IL-6-Fc and I-H-IL-6AB-CDFc we purified both fusion proteins from cell culture supernatants via affinity chromatography. As displayed in Figure S3 IH-IL-6AB-CD-Fc was detected in the purified fractions via Western blotting. Importantly, only trace amounts of lower molecular weight bands possibly corresponding to co-purified IC-IL-6CD-Fc were detectable. This may be explained by ineffective secretion of the precursor protein due to the uncovering of hydrophobic patches within the split IL-6 structure resulting in aggregation and subsequent low secretion. This can also be observed comparing secretion efficiency of IC-IL-6-Fc and IC-



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

IL-6CD-Fc in Figures 2A and 4D. As a consequence, the presence of sIL-6R-IL-6AB-IN-ER/IC-IL-6CD-Fc complexes in biologically relevant concentrations of 200 and 10 ng/ml 25, respectively, can be ruled out. The concentration of purified IH-IL-6-Fc and I-H-IL-6AB-CD-Fc was determined by ELISA and proliferation of Ba/F3-gp130 cells induced with increasing concentrations of both proteins was analyzed. As demonstrated in Fig. 5D both proteins showed similar activities. We also generated expression plasmids encoding sIL-6RIL-6AB-mIN-ER and mIC-IL-6CD-Fc. These two proteins contain the same splicing deficient split-inteins as described above (Fig. 3) and should consequently not be able to form mI-HIL-6AB-CD-Fc. Importantly, Western blotting and ELISA analysis demonstrated that upon co-expression of these variants no Hyper-cytokine was formed (Fig. 6A and B). Moreover, no biological activity was detected in cellular proliferation assays following stimulation with conditioned cell culture supernatants of COS7 cells co-transfected with sIL-6R-IL-6AB-mIN-Er and mIC-IL-6CD-Fc (Fig. 6C). In addition, we tested whether the generated split-cytokines IC-IL-6CD-Fc and IC-IL-6-D-Fc retain any IL-6 activity. Therefore we stimulated Ba/F3 cells stably transduced with gp130 and IL-6R with conditioned supernatants containing split-cytokines. Ba/F3-gp130-IL-6R can proliferate in the presence of IL-6 alone. As displayed in Figure S4, IC-IL-6-Fc containing supernatants induced proliferation in Ba/F3-gp130-IL-6R cells. However, neither single transfection of IC-IL-6CD-Fc and IC-IL-6-D-Fc or the respective receptors sIL-6R-IL-6AB-IN-ER or sIL-6R-IL-6ABC-IN-ER induced proliferation in Ba/F3-gp130-IL-6R cells. The lack of mI-IL-6AB-CD-Fc formation and biological activity of supernatants containing sIL-6R-IL-6AB-mIN-ER/mIC-IL-6CD or single precursor molecules demonstrates that using our split2cytokine protein ligation approach a background-free Hypercytokine expression system was generated. Using inactive Hyper-IL-6 precursors, we present a splitintein based approach suitable to generate biologically active Hyper-IL-6. We identified possible splitting sites within IL-6 located in unstructured loops based on the crystal structure of IL-6. These sites allowed us to create truncated split2cytokines that upon split-intein mediated protein ligation will be rejoined to form active IL-6. Reif et al. 34 previously described the assembly of glycosylated IL-6 from E. coli produced fragments and a synthetic glycosylated fragment using split inteins. This already demonstrated that IL-6 fragments can be rejoined using split inteins. However, the study of Reif et al. was carried out with refolded peptides isolated from E. coli. The production of Hyper-cytokines is not possible in E. coli. Thus, as mentioned earlier we decided to generate Hypercytokines in eukaryotic cells via the secretory pathway using split-inteins gp41-1 and IMPDH which tolerate a broad variety of reaction conditions22. In order to generate precursor molecules that are readily accessible for PTS and provide the least amount of aggregation we decided for splitting positions in unstructured loops connecting the alpha-helices of IL-6. Further only positions were a Ser residues was placed in the +1 position of the C-extein were chosen to ensure optimal conditions for IMPDH. Splitting IL-6 into two inactive precursors at positions Ser135 and T165 enabled PTS mediated reconstitution of IL-6 while splitting IL-6 at position Ser80 did not yield active cytokine. IL-6 contains two disulfide bonds, connecting the AB-loop to helices A and B. Within the I-H-IL-6A-BCD precursors one unpaired Cys-residue resulted from splitting IL-6 at position Ser80. The observed lack of expression and I-

Page 4 of 29

H-IL-6A-BCD formation may thus be explained by Cys mediated aggregation. This emphasizes the importance of finding the correct sites for splitting proteins like cytokines. Split2cytokine expression resulted in about 3 ng/mL I-H-IL-6AB-CDFc or I-H-IL-6ABC-D-Fc which is sufficient to induce signal transduction9. It may indeed be advantageous to generate low amounts of Hyper-cytokines for many applications since these represent physiologically relevant concentrations. Combination of Split-IL-11 variants and split-inteins generates H-IL-11 Finally, we aimed to transfer the split-intein mediated split2cytokine assembly to Hyper-IL-11. Despite low intrinsic sequence similarity the structures of IL-6 and IL-11 are very similar. Thus we concluded that based on our previous experiments with the split2-IL-6 variants a split within the loop connecting helices B and C seems to be the optimal position for the generation of Hyper-IL-11 from split IL-11 precursors. Consequently, we chose to split IL-11 at position Ser117 which is within the loop connecting helices B and C of IL-11 at the position corresponding to Ser135 in IL-6 (Fig. 7A). Similarly to IL-6, splitting of IL-11 leads to uncovering of hydrophobic surfaces which may influence the efficiency of Hyper-IL-11 formation (Fig 7A). Plasmids encoding Myc-sIL11R-IN-ER, IC-IL-11-Fc, Myc-sIL-11R-IL-11AB-IN-ER and ICIL-11CD-Fc were generated. Following co-transfection into COS-7 cells I-H-IL-11-Fc formation was observed in cell lysates and cell culture supernatants (Fig. 7B) through Western blotting. Analogous to I-H-IL-6-Fc formation, split-intein mediated protein ligation was very efficient. In contrast to the generation of I-H-IL-6-Fc and I-H-IL-6AB-CD-Fc, similar amounts of I-H-IL-11 and I-H-IL-11AB-CD-Fc were formed following co-transfection, judging from Western blotting analysis. Biological activities of I-H-IL-11 and I-H-IL-11ABCD-Fc were examined based on induction of proliferation and STAT3 phosphorylation of stimulated Ba/F3-gp130 cells. Figure 7C shows that conditioned supernatants containing both variants of the split-intein assembled Hyper-cytokines induce comparable proliferation to H-IL-6-Fc and H-IL-11-Fc controls. Further, proliferation induced by all Hyper-cytokine containing supernatants was abrogated by addition of sgp130Fc. Stimulation of Ba/F3-gp130 cells with I-H-IL-11Fc and I-H-IL-11AB-CD-Fc also resulted in STAT3 phosphorylation (Fig. 7D), which could again be blocked by sgp130-Fc. These findings demonstrate that split-intein mediated protein ligation can also be utilized to generate biologically active H-IL-11-Fc from active and inactive split-cytokine precursor molecules. Albeit, there are also some examples of recombinant expression of proteins using split-inteins in eukaryotic cells 16, 18, 19, 35, there has been no report demonstrating how to utilize PTS for secreted proteins passaging the ER-Golgi compartment. Nagaraj et al. 19 demonstrate the use of split inteins to generate cytosolic fusion proteins that can be targeted to the ER following a rapamycin stimulus. PTS reactions described in this study were however, occurring in the cytosol. Subramanyam et al. 16 reported the split-intein mediated protein ligation of the L-type calcium channel, but here the splitintein mediated protein ligation activity was directed to the intracellular loops of the L-type calcium channel. Thus the actual trans-splicing reaction occured in the cytoplasm. Dhar et al. 18 were able to ligate GFP to the transmembrane region of the PDGF receptor using the Npu DnaE split-intein. The


Page 5 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


splicing reaction was, however, also not performed in the ER/golgi network but in cell culture supernatants from transfected cells and isolated GFP-DnaEN. The ability of splitintein fragments to associate and trans-splice in the presence of a myriad of other proteins and biomolecules exposes their tremendous potential for in vivo manipulation of protein structure and function on the posttranslational level 36, 37. While many studies using split-inteins in cultured cells were reported, examples to exploit protein trans-splicing in entire animals are very scarce 20, 21. Interestingly, to date mice transgenic for Hyper-IL-6 have not been described, likely due undesirable stress responses resulting in premature lethality 11. In the case of overexpressed secreted Hyper-cytokines we find it more convincing that such an observed stress response originates from excessive signaling rather than e.g. ER-stress. Hypercytokines will bind to their respective surface receptors and then mediate the stress response via these receptors. In line with this, PTS mediated reconstitution of Hyper-cytokines from inactive cytokine precursors might circumvent these stress responses because there will not be any biologically active secreted molecules prior to PTS mediated protein ligation. Thus, a background-free Hyper-cytokine expression system suitable for expression in eukaryotic cell culture and in vivo approaches was generated. For in vivo studies one major advantage of our split2-cytokine approach is the possibility to establish two separate mouse lines overexpressing inactive Hyper-cytokine precursors from inducible promotors. Both mouse lines should not experience any phenotypes due to the inactivity of the precursor molecules. Crossing these mouse lines will then yield mice transgenic for Hyper-cytokines. Our approach would thus be background free until mouse lines transgenic for Hyper-cytokine precursors are crossed. It may thereby simplify the generation of in vivo trans-signaling models and thus the analysis of biological consequences of IL6 trans-signaling in vivo. Using split-inteins with a higher tolerance for flanking amino acid sequences or improving the gp41-1 or IMPDH-1 split-inteins by directed protein evolution techniques 38 might further improve the splicing efficiencies and thereby the signal-to-background ratios. In addition, our split-intein based hyper-cytokine expression system may be useful to study receptor cross-talk and plasticity. Within the IL-6 family of cytokines cross talk has been demonstrated for several receptors and cytokines. The cytokine OSM has been shown to signal via two different β-receptors, the LIFR and the OSMR 39, CNTF can signal via two different α-receptors, the CNTFR and the IL-6R 39, 40. Also the IL-27 subunit p28 was shown to be able to signal via the IL-6R41. This phenomenon further increases the number of cells that can be stimulated by a given cytokine. It is likely there are unknown crosstalk interactions within the IL6 family. Using out split-intein expression system it is very easy to generate an expression library in which different hybrid cytokines can be generated through co-transfection of cytokines and receptors of interest. The resulting hybrid hyper-cytokines can then conveniently be screened in cell culture for activity. In summary we report a versatile split-intein based expression system for Hyper-IL-6-Fc and Hyper-IL-11-Fc. Our system might be adapted to additional cytokines, it is background free and virtually traceless since the split-inteins splice themselves out of the protein sequence. Using our split2 protein ligation strategy we are able to produce inactive precursor molecules that can be posttranslationally activated to reconstitute H-IL-6 activity. Thus our system may aid the establish-

ment of stable overexpression of challenging secreted proteins in vitro and in vivo. In combination with inducible promoter systems our approach may enable the establishment of transgenic trans-signaling models and simplify the study of crosstalk phenomena of cytokines and their receptors. METHODS Cells and reagents Authenticated mycoplasma-free HEK293 and COS7 cells were obtained from DMSZ GmbH (Braunschweig, Germany), and Ba/F3 cells from Immunex (Seattle, WA). HEK293 cells are listed in the ICLAC database. However, HEK293 cells were only used for production of recombinant proteins and data from HEK expression fits data from COS7 cells. The generation of Ba/F3-gp130 and Ba/F3-gp130-IL-6R cells has been described elsewhere 42, 43. All cells were grown under standard conditions (DMEM high glucose culture medium (GIBCO, Thermo Fisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (GIBCO, Thermo Fisher Scientific), 60 mg/L penicillin and 100 mg/L streptomycin (Genaxxon Bioscience), 37°C, 5% CO2, water-saturated atmosphere. Ba/F3-gp130 cells were cultured in the presence of 10 ng/ml recombinant Hyper-IL-6 9, 44and Ba/F3-gp130-IL-6R cells were cultured in the presence of 10 ng/ml recombinant IL-643. The hIL-6R monoclonal antibody (mAb) 4-11 was described previously 45. The phospho-STAT3 (Y705, D3A7; #9145), the STAT3 (124H6; #9139) mAb and the anti-myc antibody (#2278) were obtained from Cell Signaling Technology, anti human IgG1 Fc (#31423) and anti-mouse (#31432) antibodies were purchased from Thermo Scientific. Sgp130Fc was expressed in CHO-K1 cells and purified as described previously 26. Cloning The generation of the H-IL-6-Fc expression plasmid was described elsewhere9. The cDNA containing the coding sequences for split-inteins gp41-113 and IMPDH13were synthesized by GeneArt (Regensburg, Germany). To generate expression plasmids for sIL-6R-IN-ER pcDNA3.1-Hyper-IL-6Fc was digested with PmlI and BamHI and ligated with fragments containing the N-terminal half of the split-intein IMPDH or gp41-1 fused to a KDEL ER retention signal, respectively. Two different artificial linker segments were used to fuse sIL-6R to gpIN namely, GGGG and GGGGSGY. The resulting sequences encoded the fusion protein sIL-6RGGGG-gpIN-GGSGGAAAKDEL or sIL-6R-GGGGSGYgpIN-GGSGGAAAKDEL. The plasmids encoding gpIC/IC-IL6-Fc containing the IL-6 signal peptide followed by the Cterminal half of the split-intein gp41-1 or IMPDH and the IL-6 sequence (30-212; Uniprot: P05231) and a C-terminal Fc tag was generated by ligation into a HindIII and AgeI linearized pcDNA3.1-Hper-IL-6-Fc vector. Split-IL-6 plasmids were generated by standard cloning procedures via splicing by overlapping extension PCRs. Constructs were cloned with a 5' PmlI and a 3' NotI site in the case of pcDNA3.1-sIL-6R-IL-6AIN-ER, pcDNA3.1- sIL-6R-IL-6AB-IN-ER, pcDNA3.1- sIL-6RIL-6ABC-IN-ER and a 5' HindIII and a 3' BamHI site in the case of pcDNA3.1- IC-IL-6BCD-Fc, pcDNA3.1- IC-IL-6CD-Fc, pcDNA3.1- IC-IL-6D-Fc. For the generation of IC-IL-6D-Fc a T165S mutant was generated in order to have a Ser residue as the first amino acid of the C-extein.To generate splicing deficient intein variants, C1A and N40A/S41A mutations were introduced via site directed mutagenesis in the N- and C-intein



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

and the C-extein, respectively. Mutation of these highly conserved residues abolishes splicing activity 13, 22. The following primers were used for standard mutagenesis PCR: C1A_fw: GCCAGGCACGAAAGCGCCTCCGCCGCCT, C1A_rev: AGGCGGCGGAGGCGCTTTCGTGCCTGGC, N40A/S41A_fw: GCCTCCGCCGCCAGCGGCGTGCACC ACGGTGC, N40A/S41A_rv: GCACCGTGGTGCACGC CGCTGGCGGCGGAGGC. The cDNA for sIL-11R (1-315) was amplified via PCR from a pcDNA3.1-Myc-hIL-11R template 43 using the following primers: sIL-11Rfw: AACCCCTTAAGACC ATGAGCAGCAGCTGC and sIL11Rrv: CCGGGTACCCC AGGCCTCCGGGCTCC and subsequently cloned via AflII and KpnI into pcDNA3.1-sIL-6RIN-ER. The genes for IL-11 (Uniprot: P20809: amino acids (aa): 31-199), IL-11(aa: 31-116) and IL-11 (aa: 117-199) were synthesized by GeneArt (Regensburg, Germany) and subsequently subcloned via AgeI and NotI into pcDNA3.1-IC-IL-6Fc to generate pcDNA3.1-IC-IL-11-Fc and pcDNA3.1-IC-IL11CD-Fc or into pcDNA3.1-sIL-11R-IL-6-Fc to form pcDNA3.1-sIL-11R-IL-11-Fc and pcDNA3.1-sIL-11R-IL11(AB)-Fc. Structural analysis Structural analysis of cytokines and schematic representations were generated using the PyMOL Molecular Graphics System, Version 1.8 Schrödinger, LLC. Western blotting Cells were harvested by centrifugation 48 h post transfection. Adherent cells were lysed (4°C, 60 min) in mild lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1% Triton X-100, complete protease inhibitor mixture tablets). Culture supernatants and lysates were separated by SDS-PAGE under reducing conditions and transferred to a PVDF membrane. Membranes were blocked with 5% skim milk powder in TBS-T (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, and 0.05% Tween) and incubated with the indicated antibodies at 4°C over night. In the following, membranes were incubated with horseradish peroxidase fused secondary antibody. Proteins were detected with ECL Prime Western blotting detection reagent (GE Healthcare) according to the manufacturer’s instructions. Cytokine stimulation of cells for subsequent STAT3 analysis For cytokine stimulation, Ba/F3-gp130 cells were washed with PBS three times and starved in serum free DMEM for 3 h. Following starvation 106 cells were incubated with conditioned supernatants containing the indicated proteins. For inhibition assays with sgp130 hyper-cytokine containing supernatants were preincubated for 30 min with 10 µg/ml sgp130 prior to stimulation. Cells were stimulated for 15 min and subsequently harvested by centrifugation and lysed in buffer containing 50 mM Tris pH 7.5, 150 mM NaCl, 2 mM EDTA, 1% NP40, 1% Triton X-100, 1 mM Na3VO4, 1 mM NaF and 1 complete protease inhibitor cocktail tablet. Protein concentrations of cell lysates were determined via BCA assay. 50 µg of total protein were separated via SDS-PAGE and analyzed by Western blotting. Enzyme-linked-immuno-sorbent-assay (ELISA) To detect Hyper-IL-6-Fc, anti-human IL-6 (21670060, ImmunoTools, Friesoythe, diluted to 1 µg/ml in PBS) was coated overnight at room temperature on a microtiter plate. For detection of captured Hyper-IL-6-Fc a biotinylated human IL-6R mAb (BAF227, bio-techne, Wiesbaden, Germany) was used followed by incubation with streptavidin-horseradish peroxi-

Page 6 of 29

dase and the peroxidase substrate BM blue POD (bio-techne, Wiesbaden, Germany). Recombinant H-IL-6 was used as a concentration standard. ELISA was performed on cell culture supernatants from n = 3 individual transfections. Standard deviation was calculated for the three independent experiments. Proliferation assays Proliferation of Ba/F3-gp130 cells was determined following H-IL-6 stimulation as described previously 25 using the Cell Titer Blue Cell viability assay reagent (Promega, Karlsruhe, Germany) according to the manufacturer's protocol. The extinction at 590 nm was determined following excitation at 530 nm using a Tecan infinite M200 PRO reader. Data was recorded using the i-control 1.7 software (Tecan, AG). All values were detected in triplicates. Proliferation data was normalized by subtraction of the absorbance at time point t0 for each well from the final absorbance after 40-60 min. For relative proliferation values the relative light units of H-IL-6Fc, I-H-IL-6-Fc and IL-6/sIL-6R stimulated cells in the absence of inhibitors were set as 100%. Standard deviations were calculated from triplicates. Affinity chromatography 100 ml of cell culture supernatant of COS-7 cells transfected with H-IL-6 or co-transfected with expression plasmids resulting in I-H-IL-6AB-CD were cleared by centrifugation (45 min, 3000 x g, 4°C) followed by filtration through a 45 µm bottle top filter. Cleared supernatants were subjected to affinity chromatography using HiTrap Protein A HP columns (GELifesciences). Elution was achieved in 50 mM citrate (pH 3.25). Following elution 1 M Tris (pH 11) was added to neutralize the pH of the solution. Elution fractions were buffer exchanged into phosphate buffered saline (PBS) pH 7.4, concentrated and flash frozen in liquid nitrogen.


Page 7 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure. 1. Split-intein mediated expression of H-IL-6 from two separate genes. (A) Schematic illustration of split-intein mediated protein ligation of sIL-6R-IN-ER and IC-IL-6-Fc in the endoplasmic reticulum. sIL-6R-IN-ER contains a KDEL ER retention signal. IN and IC represent N- and C-terminal fragments of splitinteins gp41-1 or IMPDH. Co-expression of sIL-6R-IN-ER and ICIL-6-Fc leads to protein trans splicing mediated sIL-6R and IL-6– Fc fusion leading to H-IL-6-Fc formation. The ER retention signal and the intein are removed and active H-IL-6-Fc is secreted. Schematic assemblies are based on PDB 1P9M, 1N26, and 4CDH. Linker segments connecting proteins are depicted as colored lines. (B) Split-intein gp41-1 mediated formation of sIL6R-IL-6-Fc (I-H-IL-6-Fc). HEK293 cells were transfected with plasmids encoding H-IL-6-Fc, gpIC-IL-6-Fc, sIL-6R-gpIN-ER and sIL-6R-gpIN-ER (SGY). Lanes labeled I-H-IL-6-Fc contain samples prepared from cells co-transfected with gpIC-IL-6-Fc and sIL-6R-gpIN-ER (I-H-IL-6-Fc) or co-transcfected with gpIC-IL-6Fc and sIL-6R-gpIN-ER (SGY) (I-H-IL-6-Fc (SGY)). The addition SGY indicates that the artificial linker segment (GGGG) connecting sIL-6R and IN contains these additional amino acids. Cells were harvested and lysed 48 h post transfection. Supernatants and lysates were analyzed by Western blotting using antibodies against human IL-6R and human IgG Fc. Western blots shown are representative of two different experiments with similar outcomes.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2. PTS generated Hyper IL-6 is biologically active. (A) COS-7 cells transfected with plasmids encoding H-IL-6-Fc, sIL6R-IN-ER and IC-IL-6-Fc or co-transfected with sIL-6R-IN-ER and IC-IL-6-Fc (I-H-IL-6-Fc). Cells were harvested and lysed 48 hours post transfection. Supernatants and lysates were analyzed by Western blotting using antibodies against human IL-6R and human IgG Fc. (B) Comparison of Hyper-cytokine yields from protein trans-splicing and standard expression. ELISA analysis of supernatants of transfected COS-7 cells. H-IL-6-Fc and complexes of IL-6R/IL-6 were detected via ELISA as described in METHODS for n = 3 individual transfections. (C) Ba/F3 cells stably transduced with gp130 were stimulated with conditioned supernatants (10%) of cells transfected with sIL-6R-IN-ER, IC-IL6-Fc, co-transfected with sIL-6R-IN-ER and IC-IL-6-Fc(I-H-IL-6Fc), H-IL-6-Fc or eGFP (control). Cellular proliferation was determined after 48 h. Proliferation assays are representative assays from n = 3 individual experiments. White bars represent control experiments, black bars correspond to Hyper-cytokine containing supernatants. Cell viability is detected in relative light units (RLU). (D) Equal amounts of Ba/F3-gp130 cells were incubated with conditioned supernatants (10%) as described in (A). 15

Page 8 of 29

min post induction cells were lysed and analyzed for STAT3 phosphorylation by Western blotting using anti-Phospho-STAT3 and anti- STAT3 antibodies. H-IL-6-Fc and I-H-IL-6-Fc induction of STAT3 phosphorylation was investigated in presence and absence of trans-signaling inhibitor sgp130Fc (10 µg/ml). (E) Ba/F3-gp130 cells were incubated with conditioned cell culture supernatants (10%) containing I-H-IL-6-Fc, H-IL-6-Fc or recombinant sIL-6R/IL-6 (200 ng/ml / 10 ng/ml) in the presence of increasing concentrations of neutralizing IL-6R mAb Tocilizumab. (F) Ba/F3-gp130 cells were incubated with conditioned cell culture supernatants (10%) containing I-H-IL-6-Fc, H-IL-6Fc or recombinant sIL-6R/IL-6 (200 ng/ml / 10 ng/ml) in the presence of increasing concentrations of sgp130Fc. Normalization of relative proliferation was performed as described in METHODS. Western blots shown are representative of n = 3 different experiments with similar outcomes.


Page 9 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Splicing incompetent split-inteins cannot form Hypercytokines. (A) Western blotting analysis of cell culture supernatants and lysates of COS7 cells transfected with plasmids encoding the indicated proteins. I-H-IL-6-Fc and mI-H-IL-6-Fc indicate supernatants resulting from co-expression of sIL-6R-IN-ER and IC-IL-6-Fc or sIL-6R-mIN-ER and mIC-IL-6-Fc, respectively. mIN and mIC represent inactive mutants of N- and C-terminal fragments of split-intein IMPDH. Western blots shown are representative of n = 3 different experiments with similar outcomes. (B) Quantification of split-intein mediated Hyper-cytokine formation in conditioned supernatants from A. ELISA was performed as described in METHODS for n = 3 individual experiments. For non-mutated split-intein mediated I-H-IL-6-Fc formation data from Fig. 1C is displayed. (C) Ba/F3 cells stably transduced with gp130 were stimulated with conditioned supernatants containing the indicated proteins. Cellular proliferation was determined 48 hours post stimulation. A representative experiment is shown out of n = 3 experiments with similar outcomes. White bars represent control experiments, black bars correspond to Hyper-cytokine containing supernatants. Data is displayed in relative light units (RLU).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4. Split IL-6 variants can be rejoined via split-intein mediated protein ligation to form Hyper-cytokines. (A) Schematic representation of I-H-IL-6AB-CD-Fc formation using split-inteins and split-cytokines. Assemblies are based on PDB 1P9M, 1N26 and 4CDH. Linkers connecting fusion proteins are indicated as colored lines. (B) Topology maps and representations of hydrophobicity in surface representation of the intra-molecular helix interfaces of wt IL-6 and three split IL-6 variants based on PDB 1P9M. (C and D) COS-7 cells were transiently transfected with expression plasmids encoding the indicated proteins. Cells were harvested and lysed 48h post transfection. Cell culture supernatants and cell lysates were subsequently analyzed by Western blotting using monoclonal antibodies against human IL-6R (C) or anti human IgG Fc antibody (D). For split-IL-6 variants split positions are indicated by A-BCD, AB-CD or ABC-D where ABCD indicates a split of the IL-6 protein between amino acids 79

Page 10 of 29

and 80, AB-CD a split between 134 and 135 and ABC-D a split between positions 164 and 165. The ABC-D variant contains a T165S mutation to improve the protein splicing reaction. Western blots shown are representative of n = 3 different experiments with similar outcomes.


Page 11 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. PTS reconstituted split IL-6 variants are biologically active. (A) ELISA Quantification of Hyper-cytokine formation in conditioned supernatants of COS7 cells transfected with cDNAs encoding the displayed proteins. I-H-IL-6-Fc, I-H-IL-6A-BCD-Fc IH-IL-6AB-CD-Fc and I-H-IL-6ABC-D-Fc indicates supernatants of COS7 cells derived from co-transfection with sIL-6R-IN-ER and IC-IL-6-Fc, sIL-6R-IL-6A-IN-ER and IC-IL-6BCD-Fc, , sIL-6R-IL6AB-IN-ER and IC-IL-6CD-Fc and sIL-6R-IL-6ABC-IN-ER and IC-IL6D-Fc, respectively. ELISA quantification was performed as described earlier. (B) Ba/F3-gp130 cells were stimulated with conditioned supernatants of COS-7 cells containing the indicated proteins. For control samples conditioned supernatant of eGFP transfected cells was used. Cellular proliferation was determined as described earlier. White bars represent control experiments, black bars correspond to Hyper-cytokine containing supernatants. For data normalization relative light units (RLU) of H-IL-6-Fc samples were set to 100%. (C) Equal amounts of Ba/F3-gp130 cells were incubated with conditioned supernatants containing the

described proteins. 15 min post induction cells were lysed and analyzed for STAT3 phosphorylation by Western Blotting using anti-Phospho-STAT3 and anti-STAT3 antibodies. H-IL-6-Fc specific STAT3 phosphorylation was probed in the presence or absence of sgp130Fc. Western blots shown are representative of three different experiments with similar outcomes. (D) I-H-IL-6Fc and I-H-IL-6AB-CD-Fc were affinity purified from 100 ml cell culture supernatant via protein A agarose. Increasing concentrations of the enriched proteins were applied to Ba/F3-gp130 cells and cellular proliferation was determined after 48 h. Data is displayed in relative light units (RLU).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 29

Figure 6. Splicing deficient split2-IL-6 variants cannot form PTS derived I-H-IL-6-Fc (A) COS-7 cells were transfected with plasmids yielding the indicated proteins. I-H-IL-6-Fc, I-H-IL-6AB-CDFc, I-H-IL-6ABC-D-Fc, mI-H-IL-6-Fc and mI-H-IL-6AB-CD-Fc indicates samples of COS7 cells derived from co-transfection with sIL-6R-IN-ER and IC-IL-6-Fc, sIL-6R-IL-6AB-IN-ER and IC-IL6CD-Fc and sIL-6R-IL-6ABC-IN-ER and IC-IL-6D-Fc, sIL-6R-mINER and mIC-IL-6-Fc, sIL-6R-IL-6AB-mIN-ER and mIC-IL-6CD-Fc respectively. Cell lysates were analyzed by Western blotting using monoclonal antibodies against IL-6R and human IgG Fc. Western blots shown are representative of three different experiments with similar outcomes. (B) ELISA Quantification of Hyper-cytokine formation in conditioned cell culture supernatants resulting from COS7 cells transfected with plasmids yielding the indicated proteins. (C) Ba/F3-gp130 cells were stimulated with conditioned supernatants of COS-7 cells containing the indicated proteins. In the case of sgp130-fc inhibition, conditioned supernatants were preincubated with 5 ug/ml sgp130-Fc prior to stimulation. Cellular proliferation was determined as described earlier. White bars represent control experiments, black bars correspond to Hypercytokine containing supernatants.


Page 13 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. Hyper-IL-11-Fc can be formed through split-intein mediated Hyper-cytokine production. (A). Topology maps and surface representations of the hydrophobic surface of IL-11. Schematic representation of IL-11 and a split IL-11 variant based on PDB 4mhl. (B) Western blotting analysis of split-intein mediated H-IL-11-Fc formation in cell lysates and supernatants of transfected COS-7 cells. Western Blotting analysis was performed using anti-Fc and anti-myc antibodies. For lanes indicating I-HIL-11-Fc variants cells were co-transfected with sIL-11R-IN-ER and IC-IL-11-Fc or sIL-11R-IL-11AB-IN-ER and IC-IL-11CD-Fc. Western blots shown are representative of three different experiments with similar outcomes. (C) Ba/F3-gp130 cells stimulated with conditioned supernatants from COS-7 cells from (B) were analyzed for cellular proliferation as described before. For control samples conditioned supernatant of eGFP transfected cells was used. White bars represent control experiments, black bars correspond to Hyper-cytokine containing supernatants. In the case of sgp130-fc inhibition, conditioned supernatants were preincubated with 5 ug/ml sgp130-Fc prior to stimulation. (D) Western blotting analysis of STAT3 phosphorylation in Ba/F3-gp130 cells stimulated with Hyper-cytokine containing supernatants from (B). In the case of sgp130-fc inhibition, conditioned supernatants were preincubated with 5 ug/ml sgp130-Fc prior to stimulation. Western blots shown are representative of three different experiments with similar outcomes.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 29

ASSOCIATED CONTENT Supporting information Figure S1: Domain organization of constructed fusion proteins. Figure S2: Split-intein gp41-1 mediated formation of sIL-6R-IL6-Fc (I-H-IL-6-Fc). Figure S3: Affinity purification of I-H-IL6AB-CD-Fc. Figure S4: Split IL-6 variants IC-IL-6CD-Fc and IC-IL6D-Fc do not induce classic signaling. The supporting information available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author * [email protected]

Author Contributions The manuscript was written through contributions of all authors.

ACKNOWLEDGMENT This work was funded by grants from the Deutsche Forschungsgemeinschaft, Bonn, Germany (SFB877 project A10) and by the Cluster of Excellence ‘Inflammation at Interfaces’ and was supported by e:Bio – Modul II- Verbundprojekt: InTraSig and the Research Commission of the Medical Faculty of the HeinrichHeine University.

ABBREVIATIONS IL, Interleukin; sIL-6R, soluble IL-6R; gp130, glycoprotein 130; Jak/STAT, Janus kinase /signal transducer and activator of transcription; PTS, protein trans splicing; sIL-6R-gpIN-ER, fusion protein of sIL-6R, N-terminal part of split intein gp41-1 followed by ER retention signal KDEL; gpIC-IL-6-Fc, C-terminal part of split intein gp41-1 followed by IL-6 and the Fc part of human IgG1 sIL-6R-IN-ER, fusion protein of sIL-6R, N-terminal part of split intein IMPDH followed by ER retention signal KDEL; IC-IL6-Fc, C-terminal part of split intein IMPDH followed by IL-6 and the Fc part of human IgG1; I-H-IL-6-Fc, PTS generated H-IL-6Fc; sIL-6R-mIN-ER, sIL-6R fused to PTS deficient N-terminal fragment of IMPDH and an ER retention signal; mIC-IL-6-Fc, splicing deficient C-terminal fragment of IMPDH fused to IL-6 and a human IgG1 Fc tag;


Page 15 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES [1] Müllberg, J., Schooltink, H., Stoyan, T., Günther, M., Graeve, L., Buse, G., Mackiewicz, A., Heinrich, P. C., and Rose-John, S. (1993) The soluble interleukin-6 receptor is generated by shedding, European journal of immunology 23, 473-480. [2] Lust, J. A., Donovan, K. A., Kline, M. P., Greipp, P. R., Kyle, R. A., and Maihle, N. J. (1992) Isolation of an mRNA encoding a soluble form of the human interleukin-6 receptor, Cytokine 4, 96-100. [3] Rose-John, S., and Heinrich, P. C. (1994) Soluble receptors for cytokines and growth factors: generation and biological function, The Biochemical journal 300 281-290. [4] Guschin, D., Rogers, N., Briscoe, J., Witthuhn, B., Watling, D., Horn, F., Pellegrini, S., Yasukawa, K., Heinrich, P., and Stark, G. R. (1995) A major role for the protein tyrosine kinase JAK1 in the JAK/STAT signal transduction pathway in response to interleukin-6, The EMBO journal 14, 1421-1429. [5] Eulenfeld, R., Dittrich, A., Khouri, C., Müller, P. J., Mütze, B., Wolf, A., and Schaper, F. (2012) Interleukin-6 signalling: more than Jaks and STATs, European journal of cell biology 91, 486495. [6] Ataie-Kachoie, P., Pourgholami, M. H., and Morris, D. L. (2013) Inhibition of the IL-6 signaling pathway: a strategy to combat chronic inflammatory diseases and cancer, Cytokine & growth factor reviews 24, 163-173. [7] Rose-John, S. (2012) IL-6 trans-signaling via the soluble IL-6 receptor: importance for the pro-inflammatory activities of IL6, International journal of biological sciences 8, 1237-1247. [8] Lokau, J., Nitz, R., Agthe, M., Monhasery, N., Aparicio-Siegmund, S., Schumacher, N., Wolf, J., Möller-Hackbarth, K., Waetzig, G. H., Grötzinger, J., Müller-Newen, G., Rose-John, S., Scheller, J., and Garbers, C. (2016) Proteolytic Cleavage Governs Interleukin-11 Trans-signaling, Cell reports 14, 1761-1773. [9] Fischer, M., Goldschmitt, J., Peschel, C., Brakenhoff, J. P., Kallen, K. J., Wollmer, A., Grötzinger, J., and Rose-John, S. (1997) I. A bioactive designer cytokine for human hematopoietic progenitor cell expansion, Nature biotechnology 15, 142-145. [10] Dams-Kozlowska, H., Gryska, K., Kwiatkowska-Borowczyk, E., Izycki, D., Rose-John, S., and Mackiewicz, A. (2012) A designer hyper interleukin 11 (H11) is a biologically active cytokine, BMC biotechnology 12, 8. [11] Suthaus, J., Stuhlmann-Laeisz, C., Tompkins, V. S., Rosean, T. R., Klapper, W., Tosato, G., Janz, S., Scheller, J., and Rose-John, S. (2012) HHV-8-encoded viral IL-6 collaborates with mouse IL-6 in the development of multicentric Castleman disease in mice, Blood 119, 5173-5181. [12] Perler, F. B., Davis, E. O., Dean, G. E., Gimble, F. S., Jack, W. E., Neff, N., Noren, C. J., Thorner, J., and Belfort, M. (1994) Protein splicing elements: inteins and exteins--a definition of terms and recommended nomenclature, Nucleic acids research 22, 1125-1127. [13] Dassa, B., London, N., Stoddard, B. L., Schueler-Furman, O., and Pietrokovski, S. (2009) Fractured genes: a novel genomic arrangement involving new split inteins and a new homing endonuclease family, Nucleic acids research 37, 2560-2573. [14] Zettler, J., Schütz, V., and Mootz, H. D. (2009) The naturally split Npu DnaE intein exhibits an extraordinarily high rate in the protein trans-splicing reaction, FEBS letters 583, 909-914. [15] Wood, D. W., and Camarero, J. A. (2014) Intein applications: from protein purification and labeling to metabolic control methods, The Journal of biological chemistry 289, 14512-14519. [16] Subramanyam, P., Chang, D. D., Fang, K., Xie, W., Marks, A. R., and Colecraft, H. M. (2013) Manipulating L-type calcium channels in cardiomyocytes using split-intein protein transsplicing, Proceedings of the National Academy of Sciences of the United States of America 110, 15461-15466. [17] Shi, C., Tarimala, A., Meng, Q., and Wood, D. W. (2014) A general purification platform for toxic proteins based on intein transsplicing, Applied microbiology and biotechnology 98, 94259435. [18] Dhar, T., and Mootz, H. D. (2011) Modification of transmembrane and GPI-anchored proteins on living cells by efficient protein trans-splicing using the Npu DnaE intein, Chemical communications (Cambridge, England) 47, 3063-3065.

[19] Nagaraj, S., Wong, S., and Truong, K. (2011) Parts-based assembly of synthetic transmembrane proteins in mammalian cells, ACS synthetic biology 1, 111-117. [20] Wang, P., Chen, T., Sakurai, K., Han, B.-X. X., He, Z., Feng, G., and Wang, F. (2012) Intersectional Cre driver lines generated using split-intein mediated split-Cre reconstitution, Scientific reports 2, 497. [21] Schwartz, E. C., Saez, L., Young, M. W., and Muir, T. W. (2007) Post-translational enzyme activation in an animal via optimized conditional protein splicing, Nature chemical biology 3, 50-54. [22] Carvajal-Vallejos, P., Pallissé, R., Mootz, H. D., and Schmidt, S. R. (2012) Unprecedented rates and efficiencies revealed for new natural split inteins from metagenomic sources, The Journal of biological chemistry 287, 28686-28696. [23] Rakemann, T., Niehof, M., Kubicka, S., Fischer, M., Manns, M. P., Rose-John, S., and Trautwein, C. (1999) The designer cytokine hyper-interleukin-6 is a potent activator of STAT3-dependent gene transcription in vivo and in vitro, J Biol Chem 274, 12571266. [24] Sato, K., Tsuchiya, M., Saldanha, J., Koishihara, Y., Ohsugi, Y., Kishimoto, T., and Bendig, M. M. (1993) Reshaping a human antibody to inhibit the interleukin 6-dependent tumor cell growth, Cancer research 53, 851-856. [25] Garbers, C., Thaiss, W., Jones, G. W., Waetzig, G. H., Lorenzen, I., Guilhot, F., Lissilaa, R., Ferlin, W. G., Grötzinger, J., Jones, S. A., Rose-John, S., and Scheller, J. (2011) Inhibition of classic signaling is a novel function of soluble glycoprotein 130 (sgp130), which is controlled by the ratio of interleukin 6 and soluble interleukin 6 receptor, J Biol Chem 286, 42959-42970. [26] Jostock, T., Müllberg, J., Ozbek, S., Atreya, R., Blinn, G., Voltz, N., Fischer, M., Neurath, M. F., and Rose-John, S. (2001) Soluble gp130 is the natural inhibitor of soluble interleukin-6 receptor transsignaling responses, European journal of biochemistry / FEBS 268, 160-167. [27] Volkmann, G., and Mootz, H. D. (2013) Recent progress in intein research: from mechanism to directed evolution and applications, Cellular and molecular life sciences : CMLS 70, 1185-1206. [28] Shah, N. H., and Muir, T. W. (2014) Inteins: Nature's Gift to Protein Chemists, Chemical science (Royal Society of Chemistry : 2010) 5, 446-461. [29] Nicastri, M. C., Xega, K., Li, L., Xie, J., Wang, C., Linhardt, R. J., Reitter, J. N., and Mills, K. V. (2013) Internal disulfide bond acts as a switch for intein activity, Biochemistry 52, 59205927. [30] Monhasery, N., Moll, J., Cuman, C., Franke, M., Lamertz, L., Nitz, R., Görg, B., Häussinger, D., Lokau, J., Floss, D. M., Piekorz, R., Dimitriadis, E., Garbers, C., and Scheller, J. (2016) Transcytosis of IL-11 and Apical Redirection of gp130 Is Mediated by IL-11α Receptor, Cell reports 16, 1067-1081. [31] Stanley, A. C., and Lacy, P. (2010) Pathways for cytokine secretion, Physiology. [32] Sehgal, P. B., and Lee, J. E. (2011) Protein trafficking dysfunctions: role in the pathogenesis of pulmonary arterial hypertension, Pulmonary circulation. [33] Somers, W., Stahl, M., and Seehra, J. S. (1997) 1.9 A crystal structure of interleukin 6: implications for a novel mode of receptor dimerization and signaling, The EMBO journal 16, 989-997. [34] Reif, A., Siebenhaar, S., Tröster, A., Schmälzlein, M., Lechner, C., Velisetty, P., Gottwald, K., Pöhner, C., Boos, I., Schubert, V., Rose‐John, S., and Unverzagt, C. (2014) Semisynthesis of Biologically Active Glycoforms of the Human Cytokine Interleukin 6, Angewandte Chemie 126, 12321-12327. [35] Topilina, N. I., and Mills, K. V. (2014) Recent advances in in vivo applications of intein-mediated protein splicing, Mobile DNA 5, 5. [36] Borra, R., Dong, D., Elnagar, A. Y., Woldemariam, G. A., and Camarero, J. A. (2012) In-Cell Fluorescence Activation and Labeling of Proteins Mediated by FRET-Quenched Split Inteins, Journal of the American Chemical Society 134, 63446353. [37] David, Y., Vila-Perelló, M., Verma, S., and Muir, T. W. (2015) Chemical tagging and customizing of cellular chromatin states using ultrafast trans-splicing inteins, Nature Chemistry 7, 394402.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 29

[38] Appleby-Tagoe, J. H., Thiel, I. V., Wang, Y., Wang, Y., Mootz, H. D., and Liu, X.-Q. Q. (2011) Highly efficient and more general cis- and trans-splicing inteins through sequential directed evolution, The Journal of biological chemistry 286, 3444034447. [39] Garbers, C., Hermanns, H. M., Schaper, F., Müller-Newen, G., Grötzinger, J., Rose-John, S., and Scheller, J. (2012) Plasticity and cross-talk of interleukin 6-type cytokines, Cytokine & growth factor reviews 23, 85-97. [40] Schuster, B., Kovaleva, M., Sun, Y., Regenhard, P., Matthews, V., Grötzinger, J., Rose-John, S., and Kallen, K.-J. J. (2003) Signaling of human ciliary neurotrophic factor (CNTF) revisited. The interleukin-6 receptor can serve as an alphareceptor for CTNF, The Journal of biological chemistry 278, 9528-9535. [41] Crabé, S., Guay-Giroux, A., and Tormo, A. J. (2009) The IL-27 p28 subunit binds cytokine-like factor 1 to form a cytokine regulating NK and T cell activities requiring IL-6R for signaling, The Journal of …. [42] Garbers, C., Jänner, N., Chalaris, A., Moss, M. L., Floss, D. M., Meyer, D., Koch-Nolte, F., Rose-John, S., and Scheller, J. (2011) Species specificity of ADAM10 and ADAM17 proteins in interleukin-6 (IL-6) trans-signaling and novel role of ADAM10 in inducible IL-6 receptor shedding, The Journal of biological chemistry 286, 14804-14811. [43] Nitz, R., Lokau, J., Aparicio-Siegmund, S., Scheller, J., and Garbers, C. (2015) Modular organization of Interleukin-6 and Interleukin-11 α-receptors, Biochimie 119, 175-182. [44] Schroers, A., Hecht, O., Kallen, K.-J. J., Pachta, M., Rose-John, S., and Grötzinger, J. (2005) Dynamics of the gp130 cytokine complex: a model for assembly on the cellular membrane, Protein science : a publication of the Protein Society 14, 783790. [45] Chalaris, A., Rabe, B., Paliga, K., Lange, H., Laskay, T., Fielding, C. A., Jones, S. A., Rose-John, S., and Scheller, J. (2007) Apoptosis is a natural stimulus of IL6R shedding and contributes to the proinflammatory trans-signaling function of neutrophils, Blood 110, 1748-1755.


Page 17 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For Table of Contents Use Only

Split2 protein-ligation generates active IL-6-type Hypercytokines from inactive precursors. Jens M. Moll1, Melanie Wehmöller1, Nils C. Frank1, Lisa Homey1, Paul Baran1, Christoph Garbers2, Larissa Lamertz1, Jonathan H. Axelrod3, Eithan Galun3, Henning D. Mootz4, Jürgen Scheller1*

ACS Paragon Plus Environment

17

Figure 1

A 1


Page 18 of 29 ER-Golgi network

2 3 4 5 sIL-6R 6 7 8 9 10 11 12 13 14 15 16 17 kDa 18 19 20 100 21 22 23 50 24 40 25 26 WB: IL-6R 27 28 29 kDa 30 31 32 100 33 3470 35 50 36 37 38 39 WB: Fc 40 Supernatants 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

Protein splicing & H-IL-6 formation

IC-IL-6-Fc

sIL-6R-IN

IL-6

+ IN

Secretion IC

IgG-Fc

+

Intein

KDEL

I-H-IL-6-Fc

Intein KDEL

KDEL

B

kDa H-IL-6-Fc

H-IL-6-Fc

100 sIL6R-gpIN-ER

50

sIL-6RgpIN-ER

40

kDa H-IL-6-Fc

H-IL-6-Fc

gpIC-IL-6-Fc 100 gpIC-IL-6-Fc

70 50

Lysate


Page 19 of 29 Figure 2


1 A 2

B 350

H-IL-6-Fc sIL-6R-IN-ER

Hyper-IL-6 (ng/ml)

3 4 5 6 7 8 9WB: IL-6R 10 11 12 13 WB: Fc 14 Supernatants Lysates 15 16 17 Ba/F3-gp130 18 40000 19 30000 20 21 20000 22 23 10000 24 25 0 26 27 28 29 30 31 Ba/F3-gp130 120 32 33 100 34 80 35 60 36 H-IL-6 H-IL-6-Fc 37 40 I-H-IL-6 I-H-IL-6-Fc 38 20 39 IL-6/IL-6R IL-6/sIL-6R 40 0 41 10-3 10-2 0.1 10 0,001 0,01 0,1 11 10 42 Tocilizumab [mg/ml] 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

H-IL-6-Fc

300 250 200 150 100 50

IC-IL-6-Fc

0

D

normalized RLU

C

pSTAT3

STAT3 sgp130

E

120 relative proliferation (%)

relative proliferation (%)

F

3

100 10 100 1000

+

+

Ba/F3-gp130

100 80 60 H-IL-6-Fc H-IL-6-Fc

40

I-H-IL-6-Fc I-H-IL-6-Fc

20

IL-6/sIL-6R IL-6/IL-6R

0 -4

-3

-2

10 10 10 0,00010,001 0,01


0.1 0,1 sgp130Fc [mg/ml]

1 1

10 10

Figure 3


A 1 2 3 4 5 6 7 8WB: IL-6R 9 10 11 Fc WB: 12 Supernatants 13 14 15 16 17400 18 19 20200 21 22 0 23 24 25 26 27 28 2930000 Ba/F3-gp130 30 3120000 32 33 3410000 35 36 0 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

H-IL-6-Fc IL-6R-IN-ER H-IL-6-Fc IC-IL-6-Fc Lysates

Hyper-IL-6 (ng/ml)

B

normalized RLU

C


Page 20 of 29

Page 21 of 29 Figure 4 A sIL-6R-IL-6 -I AB


Site III N

IC-IL-6CD-Fc

B

IL-6 Ser135

IL-6AB IL-6CD 1 A B C D Site II 2 sIL-6R 3 IgG-Fc NH2 COOH IN IC 4 Site I 5 6 Split IL-6A-BCD 7 Ser80 8 Protein splicing & Intein H-IL-6 formation 9 B C D A 10 AA 11 Intein NH2 COOH 12 IL-6A IL-6BCD 13 Aa 1-79 Aa 80-212 14 I-H-IL-6AB-CD-Fc 15 16 17 18 19 20 21 22 H-IL-6-Fc sIL-6R-IN-ER 23 24 25 26 27 28 29 H-IL-6-Fc 30 sIL-6R-IL-6A-IN-ER 31 32 33 34 35 36 H-IL-6-Fc 37 sIL-6R-IL-6AB-IN-ER 38 39 40 41 42 43 H-IL-6-Fc 44 sIL-6R-IL-6ABC-IN-ER 45 WB: Fc 46WB: IL-6R WB: IL-6R Supernatants Lysates 47Supernatants 48 49 50 51 52 53 54 55 ACS Paragon Plus Environment 56 57 58

+

+

C

Split IL-6AB-CD

C D

A B

NH2

COOH

IL-6CD IL-6AB Aa 1-134 Aa 135-212

Split IL-6ABC-D T165S A B C

D

NH2

COOH IL-6ABC IL-6D Aa 1-164 Aa165-212

D

H-IL-6-Fc IC-IL-6-Fc

H-IL-6-Fc IC-IL-6BCD-Fc

H-IL-6-Fc IC-IL-6CD-Fc

H-IL-6-Fc IC-IL-6D-Fc WB:Fc Lysates

Figure 5 300 200

A-BCD

AB-CD

ABC-D

10 7.5 5 2.5 0

C

Page 22 of 29

Ba/F3-gp130 Ba/F3-gp130

120 normalized proliferation in %

2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

B

350

100 A-BCD

AB-CD

ABC-D

80 60 40 20 0

D H-IL-6-Fc

I-H-IL-6A-BCD-Fc

Ba/F3-gp130

pSTAT3

50000

STAT3

40000

sgp130 (10 µg/ml)

+

+

normalized RLU

Hyper-IL-6 (ng/ml)

A1


30000 20000 I-H-IL-6-FC I-H-IL-6-Fc 10000

H-IL-6-Fc

I-H-IL-6AB-CD-Fc

BC-I-H-IL-6-Fc I-H-IL-6AB-CD-Fc

0 0

pSTAT3 STAT3 sgp130 (10 µg/ml)

+

H-IL-6-Fc

+

I-H-IL-6ABC-D-Fc

pSTAT3 STAT3 sgp130 (10 µg/ml)

+

+


2

4 6 H-IL-6-Fc [ng/ml]

8

10

1 A 2 3 4 5 H-IL-6-Fc 6 sIL-6R-IL-6AB-mIN-ER 7 WB: IL-6R 8 Lysates 9 H-IL-6-Fc 10 mIC-IL-6CD-Fc 11WB: Fc 12Lysates 13 14 15 16 17 30000 Ba/F3-gp130 18 19 25000 20 21 20000 22 15000 23 24 10000 25 26 5000 27 0 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58


B

H-IL-6 (ng/ml)

Page 23 of 29 Figure 6

normalized RLU

C

5 ug/ml sgp130-Fc


Figure 7 1 A

IL-11

2 3 4 A B C D 5 6 COOH 7 NH2 8 9 10 11 12 13 14 15 50000 Ba/F3-gp130 16 17 40000 18 19 30000 20 21 20000 22 23 10000 24 25 26 0 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

ACS Synthetic Biology Split IL-11AB-CD S117

A B

NH2

C normalized RLU

B

C D

COOH

WB: Myc

WB: Myc

WB: Fc

WB: Fc

Supernatants IL-11AB Aa 1-116

Page 24 of 29

Lysates

Supernatants

Lysates

IL-11CD Aa 117-199

D H-IL-11-Fc

I-H-IL-11-Fc

pSTAT3 STAT3 + sgp130Fc

sgp130Fc (10µg/ml)

+

H-IL-11-Fc

+

I-H-IL-11AB-CD-Fc

pSTAT3 STAT3 sgp130Fc (10µg/ml)


+

+

Page 25 of 29 Figure S1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58


SP

sIL-6R

GGGG gpIN GGSGGSAAAKDEL

sIL-6R-gpIN-ER

SP

sIL-6R

GGGGSGY gpIN GGSGGSAAAKDEL

sIL-6R-gpIN-ER (SGY)

SP

gpIC GGGGS

IL-6 AAA

gpIC-IL-6-Fc

Fc

GGSGGSAAAKDEL

IN

sIL-6R-IN-ER

SP

sIL-6R

GGGG

SP

sIL-6R

GGGGSGY

SP

IC

SP

sIL-6R

(GGGGS)2 IL-630-79

IN

GGSGGSAAAKDEL

sIL-6R-IL-6A-IN-ER

SP

sIL-6R

(GGGGS)2 IL-630-134

IN

GGSGGSAAAKDEL

sIL-6R-IL-6AB-IN-ER

SP

sIL-6R

(GGGGS)2 IL-630-164

IN

GGSGGSAAAKDEL

sIL-6R-IL-6ABC-IN-ER

SP

IC

IL-680-212 AAA

Fc

IC-IL-6BCD-Fc

SP

IC

IL-6135-212AAA

Fc

IC-IL-6CD-Fc

SP

IC

IL-6165-212AAA

Fc

IC-IL-6D-Fc

SP

sIL-6R

SP

mIC GGGGS

GGGGS

IN

IL-6 AAA

GGSGGSAAAKDEL

sIL-6R-IN-ER (SGY)

Fc

IC-IL-6-Fc

mIN GGSGGSAAAKDEL

GGGG

IL-6 AAA

(GGGGS)2 IL-630-134

SP

sIL-6R

SP

mIC IL-6135-212AAA

SP

sIL-11R GGGG

SP

IC

SP

sIL-11R (GGGGS)2 IL-1122-116

SP

IC

mIN GGSGGSAAAKDEL

Splicing deficient split-inteins

sIL-6R-IL-6AB-mIN-ER mIC-IL-6CD-Fc

Fc

IN

I-H-IL-6-Fc from split cytokines

sIL-6R-mIN-ER mIC-IL-6-Fc

Fc

I-H-IL-6-Fc

GGSGGSAAAKDEL

sIL-11R-IN-ER I-H-IL-11-Fc

GGGGS IL-11 AAA

IL-11117-199

AAA

Fc

IC-IL-11-Fc

Fc IN

GGSGGSAAAKDEL

sIL-11R-IL-11AB-IN-ER I-H-IL-11-Fc from split cytokines IC-IL-11CD-Fc


Figure S2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 kDa 18 19 20 100 21 22 2350 24 2540 26 WB: IL-6R 27 28 29 30 kDa 31 32 33 100 34 3570 3650 37 38 39 WB: Fc Supernatants 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58


Page 26 of 29

kDa H-IL-6-Fc

H-IL-6-Fc

100

sIL-6RgpIN-ER

sIL6R-gpIN-ER 50 40

kDa

H-IL-6-Fc

H-IL-6-Fc

100

gpIC-IL-6-Fc 70

gpIC-IL-6-Fc

50

Lysate


Page 27 of 29 Figure S3 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18Protein in ng 19 20 100 21 70 22 50 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58


I-H-IL-6AB-CD-Fc 500

200

400

800 H-IL-6-Fc IC-IL-6CD-Fc

WB: Fc


Figure S4

Ba/F3-gp130-IL-6R 30000

normalized RLU

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58


20000

10000

0


Page 28 of 29

Page 29 of Table of29 contents 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58


Classic-signaling

Classic-signaling

Split intein

sIL-6R-IN

IN

Split intein & split cytokine

IC

IC-IL-6-Fc

sIL-6RIL-6AB-IN

IN

IC

IC-IL6CD-Fc

Intein splicing Intein

Intein Intein

Intein I-H-IL-6-Fc Trans-signaling

ER-Golgi

I-H-IL-6AB-CD-Fc Trans-signaling


Split2 protein-ligation generates active IL-6-type Hyper-cytokines from

Recommend Documents