Supplementation of Chitosan Alleviates High-Fat Diet-Enhanced

Mar 10, 2015 - Institute of Toxicology, College of Medicine, National Taiwan University, Taipei 100, Taiwan. ‡ Department of Food Science, College o...
0 downloads 8 Views 5MB Size
Download PDF
Article pubs.acs.org/JAFC

Supplementation of Chitosan Alleviates High-Fat Diet-Enhanced Lipogenesis in Rats via Adenosine Monophosphate (AMP)-Activated Protein Kinase Activation and Inhibition of Lipogenesis-Associated Genes Chen-Yuan Chiu,† Im-Lam Chan,‡ Tsung-Han Yang,‡ Shing-Hwa Liu,*,†,§,# and Meng-Tsan Chiang*,‡ †

Institute of Toxicology, College of Medicine, National Taiwan University, Taipei 100, Taiwan Department of Food Science, College of Life Science, National Taiwan Ocean University, Keelung 202, Taiwan § Department of Pediatrics, College of Medicine and Hospital, National Taiwan University, Taipei 100, Taiwan # Department of Medical Research, China Medical University Hospital, China Medical University, Taichung 104, Taiwan ‡

ABSTRACT: This study investigated the role of chitosan in lipogenesis in high-fat diet-induced obese rats. The lipogenesisassociated genes and their upstream regulatory proteins were explored. Diet supplementation of chitosan efficiently decreased the increased weights in body, livers, and adipose tissues in high-fat diet-fed rats. Chitosan supplementation significantly raised the lipolysis rate; attenuated the adipocyte hypertrophy, triglyceride accumulation, and lipoprotein lipase activity in epididymal adipose tissues; and decreased hepatic enzyme activities of lipid biosynthesis. Chitosan supplementation significantly activated adenosine monophosphate (AMP)-activated protein kinase (AMPK) phosphorylation and attenuated high-fat diet-induced protein expressions of lipogenic transcription factors (PPAR-γ and SREBP1c) in livers and adipose tissues. Moreover, chitosan supplementation significantly inhibited the expressions of downstream lipogenic genes (FAS, HMGCR, FATP1, and FABP4) in livers and adipose tissues of high-fat diet-fed rats. These results demonstrate for the first time that chitosan supplementation alleviates high-fat diet-enhanced lipogenesis in rats via AMPK activation and lipogenesis-associated gene inhibition. KEYWORDS: chitosan, high-fat diet, AMP-activated protein kinase, lipogenesis, gene expression

■

INTRODUCTION Obesity is well recognized as a chronic disease resulting from an energy imbalance including excessive energy storage and inadequate energy expenditure. The World Health Organization has shown that there are about 1.4 billion overweight adults, of which over 200 million men and nearly 300 million women were obese worldwide in 2008. That is, >10% of the world’s adult population is obese.1 Moreover, obesity is also an important contributor to several metabolism-related diseases such as type 2 diabetes mellitus, hyperlipidemia, cardiovascular diseases, and cancers,1,2 which may affect the quality of human life. It has been known that obese individuals have lipid homeostasis defects, which is associated with the dysfunction of liver and adipose tissue. As obesity develops, adipocytes undergo hypertrophy owing to increased triglyceride storage.3 The hypertrophic adipocytes lead to dysregulated secretion of adipokines (e.g., tumor necrosis factor-α, interleukin-6, leptin) and increased release of free fatty acids (FFA) into circulation.4 Elevated FFA are stored as triglyceride and then accumulates in the liver, leading to fatty liver.5 Hence, the adipose tissue and the liver have become major targets for antiobesity foods and food ingredients against human obesity.6,7 Chitosan is a partially N-deacetylated copolymer of glucosamine and N-acetylglucosamine derived from the polysaccharide chitin, which is a byproduct of crustaceans.8 Chitosan is also recognized as a marine functional food that it is shown to exhibit antidiabetic and antiobesity activity due to the indigestible characteristic acting as dietary fiber.9,10 Several © XXXX American Chemical Society

studies have shown that chitosan can reduce liver cholesterol by decreasing cholesterol absorption and increasing fecal fat excretion in human and animals, which may contribute to weight loss.11,12 Our previous study has also found that longterm chitosan feeding in a type 2 diabetic rat model suppresses plasma adipocytokines and lipid accumulation in livers and adipose tissues, which may further reduce insulin resistance in diabetic rats.13 Chitosan could also possess a potential to alleviate hyperglycemia through the decrease in liver gluconeogenesis in a type 1 diabetic rat model.14 However, the molecular mechanism of chitosan on lipid responses and lipid metabolism in liver and adipose tissues remains unclear. Recent studies have shown that adenosine monophosphate (AMP)-activated protein kinase (AMPK) plays a key role in regulating lipid metabolism of the liver and adipose tissue. Activated AMPK phosphorylation leads to inhibitory expressions of downstream lipid metabolism targets of AMPK in the liver or adipose tissue, including peroxisome proliferatoractivated receptor γ (PPARγ), sterol regulatory element binding proteins (SREBPs), fatty acid synthase (FAS), 3-hydroxy-3methylglutaryl coenzyme A (HMG-CoA) reductase (HMGCR), fatty acid transport proteins (FATPs), and fatty acid-binding proteins (FABPs).15−17 PPARγ and SREBP1c are Received: January 13, 2015 Revised: February 23, 2015 Accepted: February 23, 2015

A

DOI: 10.1021/acs.jafc.5b00198 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry known as the lipogenic transcription factors.18 Therefore, we hypothesized that chitosan might inhibit lipogenesis-related protein/gene expressions induced by obesity through an AMPK-regulated signaling pathway. In the present study, high-fat (HF) diet-fed rats were used as an in vivo obesity model to clarify the mode of action and the possible mechanism of chitosan in lipid responses and lipid-related metabolic changes.

■

animals as issued by the Animal Center of the National Science Council. Collection of Feces and Tissue Samples. At the end of the experimental period, animals were fasted for 12 h prior to being sacrificed by exsanguination via the abdominal aorta while under carbon dioxide anesthesia. The liver and epididymal and perirenal white adipose tissues from each animal were excised, dried, weighed, flash-frozen, and stored at −80 °C until biopsy. Feces were collected for three consecutive days before euthanasia and stored at −80 °C until lipid content analysis was performed. Triglyceride (TG) and Total Cholesterol (TC) Determination. The levels of hepatic and fecal TG and TC were measured as described previously by Carlson and Glodfarb.19 Briefly, 0.2 g of liver or feces was mixed with 4 mL of chloroform/methanol (2:1, v/v). The chloroform layer was collected and concentrated in a Speed Vac Sc 110 rotary evaporator (Savant, Farmingdale, NY, USA). After the addition of Triton X-100, the sample was assayed with TG enzymatic kits (Audit Diagnostics, Cork, Ireland) and TC enzymatic kits (Audit Diagnostics) according to the manufacturer’s instructions. Determination of Hepatic Lipid Metabolism Enzymes. Hepatic fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC) were assayed as described previously by Nepokroeff et al.20 and Mohan and Kekwick,21 respectively. HMGCR reductase was determined as described previously by Edwards et al.22 The enzyme activities were determined by the rate of nanomoles of NADPH increased. Lipolysis Rate Measurement. Adipose tissue (0.2 g) was minced into small pieces and placed in 2 mL of 25 mM N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid buffer containing 1 μM isoproterenol and incubated at 37 °C. Isoproterenol produced a dose-dependent increase in lipolysis. There was a time-dependent increase in lipolysis. After 1, 2, and 3 h of incubation, 0.2 mL of medium was used to measure the levels of glycerol by a commercial reagent (RANDOX GY105, Amtrim, UK), and then the absorbance at 520 nm was recorded using a spectrophotometer. The lipolysis rate was indicated by micromoles of glycerol released per gram of tissue per hour. Lipoprotein Lipase (LPL) Activity. LPL activity in adipose tissue was measured as described previously by Kusunoki et al.23 Adipose tissue (0.1 g) was minced into small pieces and placed in Krebs− Ringer bicarbonate buffer (pH 7.4) in the presence of heparin (10 units/mL) for 60 min at 37 °C. The heparin solution was mixed with an equal volume of 2 mM p-nitrophenyl butyrate (pNPB). Absorbance at 400 nm was recorded following a 10 min incubation using a spectrophotometer. LPL activity was recorded as the amount of pnitrophenol product formed over the 10 min incubation. Histological Examination. Epididymal white adipose tissue was fixed with 10% formalin and paraffin embedded. Standard sections of 5 μm were mounted on glass slides and stained with hematoxylin and eosin (H&E). The sections were observed and photographed with an Olympus BX51 light microscope (Olympus, Tokyo, Japan). Three H&E sections of each group were selected, and three random fields of each section were used to measure adipocyte area by ImageJ software, which is represented as the average adipocyte area. Western Blot Analysis. Total protein containing 50−100 μg was separated on 10% sodium dodecyl sulfate (SDS)−polyacrylamide minigels and transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). After blocking, blots were incubated with antibodies for phosphorylated AMPKα (p-AMPKα), AMPKα (Cell Signaling Technology, Danvers, MA, USA), microsomal triglyceride transfer protein (MTTP), angiopoietin-like 4 (Angptl4), GAPDH, PPAR-γ, β-actin (Santa Cruz Biotechnology, Santa Cruz, CA, USA), apolipoprotein E (ApoE) (Bioss Antibodies, Woburn, MA, USA), and SREBP1c (Proteintech Group, Chicago, IL, USA) in phosphate-buffered saline (PBS)/Tween-20 for 1 h, followed by two washings in PBS/Tween-20, and then incubated with horseradish peroxidase-conjugated goat anti-mouse or anti-rabbit IgG for 30 min. Moreover, GAPDH served as a control for sample loading and integrity. The antibody-reactive bands were revealed by the enhanced

MATERIALS AND METHODS

Materials. High molecular weight (HMW) chitosan was purchased from Taiwan Tanabe Seiyaku Co. (Taipei, Taiwan). Chitosan was prepared by processing crab shell, which involves demineralization, deprotienization, and deacetylation. The measurements of average molecular weight (MW) and degree of deacetylation (DD) of chitosan were determined by high-performance liquid chromatography and Fourier transform infrared spectroscopy, respectively. The detection of viscosity was performed on chitosan dissolved in 0.1 N HCl solution by a viscometer (CV20, Haake Mess-Technik GmbH Co., Karlsruhe, Germany). The DD of chitosan was about 89.8%, and the average MW and viscosity of chitosan were about 560 kDa and 33 cP, respectively. Cellulose was obtained from Sigma Chemical Co. (St. Louis, MO, USA). Animals and Diets. Male, 6-week-old Sprague−Dawley rats were purchased from BioLASCO Taiwan Co., Ltd. (Taipei, Taiwan). Rats were fed a chow diet (Rodent Laboratory Chow, Ralston Purina, St. Louis, MO, USA) for 1 week, and then the animals were randomly divided into two groups: a control group that received standard rodent diet with 5% cellulose (ND) and a HF group that received a HF diet with 5% cellulose. After 4 weeks of acclimation, the rats that received a HF diet were further randomly divided into four groups: (1) HF-dietfed rats with 5% cellulose, (2) HF-diet-fed rats with 3% HMW chitosan (HF diet+3%CS), (3) HF-diet-fed rats with 5% HMW chitosan (HF+5%CS), and (4) HF-diet-fed rats with 7% HMW chitosan (HF+7%CS). Each group contained eight animals. The compositions of the experimental diets given to test animals are shown in Table 1. Rats were housed in individual stainless steel cages in a

Table 1. Composition (Percent) of Experimental Dietsa ingredient casein lard soybean oil vitamin mixtureb mineral mixturec cholesterol choline chloride cholic acid corn starch cellulose chitosand

ND

HF

HF+3%CS

HF+5%CS

HF+7%CS

20 3 2 1 4

20 15 2 1 4 0.5 0.2 0.2 53.1 5

20 15 2 1 4 0.5 0.2 0.2 53.1 2 3

20 15 2 1 4 0.5 0.2 0.2 53.1

20 15 2 1 4 0.5 0.2 0.2 51.1

5

7

0.2 65.8 5

a

ND, normal control diet; HF, high-fat diet; HF+3%CS, HF + 3% chitosan; HF+5%CS, HF + 5% chitosan; HF+7%CS, HF + 7% chitosan. bAIN-93 vitamin mixture. cAIN-93 mineral mixture. dThe average molecular weight and viscosity of chitosan were about 5.6 × 105 Da and 33 mPa·s, respectively. The degree of deacetylation was about 89.8%. room kept at 23 ± 1 °C and 40−60% relative humidity with a 12 h light and dark cycle (lighting from 8:00 a.m. to 8:00 p.m.). The body weight was measured every week. After the 7 week feeding study, the animals were sacrificed. This study was approved by the Animal House Management Committee of the National Taiwan Ocean University (permission no. ACUC98045). The animals were maintained in accordance with the guidelines for the care and use of laboratory B

DOI: 10.1021/acs.jafc.5b00198 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 2. Primer Sequences gene

forward (5′ to 3′)

reverse (5′ to 3′)

length (bp)

FABP4 FAS FATP1 HMGCR GAPDH

CCTTTGTGGGGACCTGGAAA CTTGGGTGCCGATTACAACC GTGCGACAGATTGGCGAGTT TGTGGGAACGGTGACACTTA CTGGAGAAACCTGCCAAGTATGAT

TGACCGGATGACGACCAAGT GCCCTCCCGTACACTCACTC GCGTGAGGATACGGCTGTTG CTTCAAATTTTGGGCACTCA TTCTTACTCCTTGGAGGCCATGTA

152 163 106 101 250

chemiluminescence kit (BioRad Laboratories, Redmond, WA, USA) and were exposed to Kodak radiographic film. Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) Analysis. Total RNA was extracted from the liver and epididymal fat tissues using Trizol (Invitrogen, Carslbad, CA, USA) and was reverse-transcribed to cDNA using a MMLV High Performance Reverse Transcriptase kit as recommended by the manufacturer (Epicentre, Madison, WI, USA). The sequences of the designed primers are shown in Table 2. GAPDH was used as an internal control. The resultant cDNA was stored at −20 °C until commencement of the qRT-PCR procedures. For qRT-PCR, the reaction was done on StepOne Real-Time PCR Systems (Applied Biosystems, Life Technologies, Grand Island, NY, USA) to check the expression using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific, Waltham, MA, USA). Relative quantification of gene expression was performed by using the comparative threshold cycle method (ΔΔCT), in which the expression level of each target gene was normalized to the levels of GAPDH. Data output was expressed as fold changes of mRNA expression levels, given by 2−ΔΔCT. Statistical Evaluation. Results are given as mean ± standard deviation (SD) values. The significant difference from the respective controls for each experimental test condition was assessed by one-way analysis of variance (ANOVA) and two-tailed Student’s t test. The statistical software SPSS for Windows version 10.0.7C (SPSS, Chicago, IL, USA) was used.

tissue weights was exhibited only in the HF diet + 7% chitosan group (Table 3). There were no significant changes in plasma TC levels of all tested groups. The plasma TG of HF-diet-fed rats exhibited a decreased level as compared to the ND group, which could be significantly reversed by chitosan (3, 5, and 7%) supplementation (Table 3). The effects of chitosan on adipose tissue characteristics are shown in Figures 2 and 3. Rats fed the HF diet showed a significant increase (29.74%, p < 0.05) in cell size of epididymal adipose tissues, and supplementation of 5 and 7% chitosan could significantly suppress hypertrophic adipocyte formation (adipose cell size: HF, 36.45 ± 3.03 μm2; HF+5%CS, 29.5 ± 2.67 μm2; HF+7%CS, 21.25 ± 1.85 μm2) (Figure 2B). Moreover, the TG level (Figure 3A) and the LPL activity (Figure 3B) in epididymal fat of HF-diet-fed rats were elevated, and the rate of lipolysis (Figure 3C) was contrarily diminished. Supplementation of 7% chitosan in the diet significantly raised the lipolysis rate and decreased the accumulation of TG and the LPL activity. We next tested the levels of TG and TC in the livers and feces. As shown in Figure 4 and Table 4, the livers/feces of the HF-diet-fed rats supplemented with chitosan (3, 5, and 7%) contained significantly less/more TC than the HF-diet-fed control rats. The TG levels were also decreased by 27.68% (p < 0.05) in the livers of the HF+7%CS group and increased in the feces of chitosan-supplemented groups (HF+CS7% vs HF, an increase of 46.88%, p < 0.05). Furthermore, the increased hepatic enzyme activities of lipid biosynthesis (acetyl-CoA carboxylase, fatty acid synthase, and HMG-CoA reductase) in HF-diet-fed rats could also be efficiently ameliorated by chitosan (7%) supplementation (Figure 4). We next examined protein expressions of Angptl4, MTTP, and ApoE, which are known to be involved in TG metabolism.24−26 The inhibitions of Angptl4, MTTP, and ApoE protein expressions were observed in the plasma and liver of HF-diet-fed rats, which could be significantly reversed by chitosan supplementation (Figure 5). Effects of Chitosan on Lipogenesis-Related Factors in Livers and Adipose Tissues of HF-Diet-Fed Rats. AMPK is known to play an important role in regulating lipid metabolism of the liver and adipose tissue.15−17 We next investigated the effects of chitosan on AMPK-regulated lipogenesis-associated protein/gene expressions in HF-diet-fed rats. We found that the suppression of AMPK phosphorylation in livers (Figure 6) and adipose tissues (Figure 7) of HF-diet-fed rats could be significantly reversed by chitosan supplementation in a dosedependent manner (HF+CS3, 5, and 7% vs HF, increases of 3.39-, 3.67-, and 4.98-fold in livers, respectively, p < 0.05 for all groups; increases of 0.5-, 1.3-, and 1.5-fold in adipose tissues, respectively, p < 0.05 for HF+5%CS and HF+7%CS). Supplementation of 7% chitosan in the diet could also significantly attenuate the HF-diet-increased protein expressions of PPARγ (Figures 6 and 7) and SREBP1c (Figures 6 and 7) in livers (HF+CS7% vs HF, decreases of 80 and 25% in

■

RESULTS Effects of Chitosan on Lipid Responses and LipidRelated Metabolic Changes in HF-Diet-Fed Rats. During the obesity induction period (first 4 weeks), the body weights of HF-diet-fed rats were significantly higher than those of NDfed rats, and supplementation of 7% chitosan could efficiently decrease the increased body weights in HF-diet-fed rats throughout the rest of the 7 weeks (HF+7%CS vs HF, a decrease of 9.13%, p < 0.05) (Figure 1 and Table 3). In addition, rats fed a HF diet supplemented with chitosan (3, 5, and 7%) had lower liver weights, and a significant reduction (HF+7%CS vs HF, a decrease of 18.18%, p < 0.05) in adipose

Figure 1. Effects of chitosan on body weights of HF-diet-fed rats. The changes of body weights in rats fed the HF diet in the presence or absence of chitosan (3−7%) during induction period (weeks 0−4) and experimental period (weeks 4−11) are shown. Results are expressed as the mean ± SD for each group (n = 8). (∗) p < 0.05 as compared with the HF-diet group. C

DOI: 10.1021/acs.jafc.5b00198 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Table 3. Effects of Chitosan on Liver and Adipose Tissue Weights and Plasma Lipid Profile in Sprague−Dawley Rats Fed the Different Experimental Diets for 7 Weeksa diet relative liver wt (g/100 g BW) rel adipose tissue wtb (g/100 g BW) triglyceride (mg/dL) total cholesterol (mg/dL)

ND

HF

HF+3%CS

HF+5%CS

HF+7%CS

2.5 ± 0.1* 5.0 ± 1.0 152.7 ± 33.1* 92.0 ± 22.2

5.3 ± 0.5 4.4 ± 0.8 88.5 ± 28.0 93.7 ± 12.2

4.6 ± 0.5* 4.7 ± 1.2 126.1 ± 37.6* 98.8 ± 14.5

4.6 ± 0.5* 3.7 ± 0.4 124.0 ± 30.3* 96.8 ± 18.1

3.8 ± 0.3* 3.6 ± 0.8* 132.1 ± 40.8* 90.9 ± 26.9

Results are expressed as the mean ± SD for each group (n = 8). (*) p < 0.05 versus HF. bThe adipose tissue weight is the sum of epididymal and perirenal white adipose tissue weight.

a

Figure 2. Effects of chitosan on adipocyte morphology of HF-diet-fed rats: (A) histological morphology of adipocytes; (B) mean adipocyte size. Histological analysis of epididymal white adipose tissues isolated from rats fed different experimental diets for 7 weeks is shown. Tissue sections were stained with H&E. Results are expressed as the mean ± SD for each group (n = 3). Scale bar = 100 μm. (∗) p < 0.05 as compared with HF diet alone group.

Figure 3. Effects of chitosan on adipose tissue characteristics of HFdiet-fed rats: levels of triglyceride (A), lipoprotein lipase (LPL) activity (B), and lipolysis rate (C) in epididymal white adipose tissues of Sprague−Dawley rats fed different experimental diets for 7 weeks. Results are expressed as the mean ± SD for each group (n = 8). (∗) p < 0.05 as compared with HF diet alone group.

PPARγ and SREBP1c expressions, respectively, p < 0.05) and adipose tissues (HF+CS7% vs HF, decreases of 41 and 74% in PPARγ and SREBP1c expressions, respectively, p < 0.05). Further investigations were carried out to determine the effect of chitosan on lipogenesis-associated gene expressions in livers or epididymal adipose tissues, such as FAS, HMGCR, FATP1, and FABP4. As shown in Figure 8, supplementation of 7% chitosan in the diet significantly inhibited the gene expressions in livers (FAS and HMGCR) (HF+CS7% vs HF, decreases of 67 and 62% in FAS and HMGCR expressions, respectively, p < 0.05; Figure 8A) and in adipose tissues (FATP1 and FABP4) (HF+CS7% vs HF, decreases of 78 and 68% in FATP1 and FABP4 expressions, respectively, p < 0.05; Figure 8B) of HF diet-fed rats.

■

DISCUSSION Chitosan is used as a dietary supplement against obesity because synthetic compounds exhibit some harmful side effects, including dry mouth, constipation, and insomnia.18,27 Sumiyoshi and Kimura have indicated that low molecular weight chitosan prevents increases in body weights, white adipose tissue weights, and accumulation of liver lipids and enhances the fecal fat excretion in mice fed a HF diet.28 Liu and colleagues have also shown that chitosan and its two derivatives, O-carboxymethyl chitosan and N-[(2-hydroxy-3D

DOI: 10.1021/acs.jafc.5b00198 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 4. Effects of chitosan on hepatic lipid profile and enzyme activity of lipid biosynthesis in HF-diet-fed rats rats: levels of triglyceride (A), total cholesterol (B), acetyl-CoA carboxylase (C), fatty acid synthase (D), and HMG-CoA reductase (E) in livers of Sprague−Dawley rats fed different experimental diets for 7 weeks. Results are expressed as the mean ± SD for each group (n = 8). (∗) p < 0.05 as compared with HF diet alone group.

Table 4. Changes of Fecal Weight, Triglyceride, and Total Cholesterol Concentration in Rats Fed the Different Experimental Diets for 7 Weeksa diet feces wet wt (g/day) feces dry wt (g/day) triglyceride (mg/g feces) triglyceride (mg/day) total cholesterol (mg/g feces) total cholesterol (mg/day) a

1.6 1.5 1.8 2.6 3.4 4.9

ND

HF

HF+3%CS

HF+5%CS

HF+7%CS

± ± ± ± ± ±

1.9 ± 0.3 1.6 ± 0.2 3.2 ± 1.2 5.0 ± 2.0 14.1 ± 2.7 22.3 ± 4.5

2.1 ± 0.3 1.8 ± 0.2 4.9 ± 0.7* 8.7 ± 2.0* 21.8 ± 2.8* 38.3 ± 5.3*

2.4 ± 0.3* 2.0 ± 0.2* 5.2 ± 1.1* 10.3 ± 2.9* 22.9 ± 2.7* 45.0 ± 8.0*

2.7 ± 0.7* 2.3 ± 0.5* 4.7 ± 0.6* 10.9 ± 3.2* 21.7 ± 1.5* 50.2 ± 12.4*

0.2* 0.2 0.6* 1.3* 0.7* 1.2*

Results are expressed as the mean ± SD for each group (n = 8). (*) p < 0.05 versus HF.

nutrition-induced obesity.29 In the current study, we have shown similar effects of HMW chitosan as the aforementioned studies on the body weight and the level of TG in livers and

N,N-dimethylhexadecylammonium)-propyl] chitosan chloride, decrease the body weights and the levels of TG and free fatty acids and increase fecal lipid excretion in a murine overE

DOI: 10.1021/acs.jafc.5b00198 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 5. Effects of chitosan on angiopoietin-like protein 4 (Angptl4) expression in the plasma and microsomal triglyceride transfer protein (MTTP) and apolipoprotein E (ApoE) protein expressions in the liver of HF-diet-fed rats. Protein expressions of Angplt4, MTTP, and ApoE were measured by Western blotting. Densitometric analysis for protein levels corrected to each internal control is shown. Results are expressed as the mean ± SD for each group (n = 4−6). (∗) p < 0.05 as compared with HF diet alone group.

Figure 6. Effects of chitosan on hepatic protein expressions of lipid metabolism of HF-diet-fed rats. Protein expressions of p-AMPKα, PPARγ, and SREBP1c were measured by Western blotting. Densitometric analysis for protein levels corrected to each internal control is shown. Results are expressed as the mean ± SD for each group (n = 4−6). (∗) p < 0.05 as compared with the HF diet alone group.

feces of HF-diet-fed rats. Although the association between chitosan and obesity has been well established, the detailed mechanism that links chitosan to lipid-related metabolic changes remains unclear. Obesity develops due to an imbalance of lipid metabolism. Lipoprotein lipase and lipolysis rate are known to play important roles in TG metabolism. Lipoprotein lipase is an enzyme that hydrolyzes triglycerides of triglyceride-rich lipoproteins (such as very-low-density lipoprotein, VLDL) into nonesterified fatty acids and glycerol.30 Lipolysis in the adipose tissue is modulated in a stepwise process by adipose triglyceride lipase (ATGL), hormone-sensitive lipase (HSL), and monoacylglycerol lipase (MAGL). The regulation is that ATGL

initiates lipolysis by cleaving the fatty acids (FA) from triacylglycerol and then HSL and MAGL react on diacyglycerol and monoacylglycerol to release two additional FAs and one glycerol.31 However, previous studies have shown that the HF diet dysregulates lipolysis and lipid metabolism, increasing LPL activities and decreasing lipolysis rates in visceral and subcutaneous adipocytes, which may promote adipocyte enlargement by facilitating TG accumulation in adipocytes.23,32 The results of the present study were in agreement with those F

DOI: 10.1021/acs.jafc.5b00198 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 8. Effects of chitosan on lipogenesis-associated gene expressions in livers and epididymal white adipose tissues of HFdiet-fed rats. Gene expressions of livers (FAS and HMGCR) (A) and epididymal white adipose tissues (FATP1 and FABP4) (B) were determined by qRT-PCR. Results are expressed as the mean ± SD for each group (n = 6). (∗) p < 0.05 as compared with the HF diet alone group.

reduction of dietary carbohydrate.33,34 Meugnier et al. have also found a significant decreased circulating TG level of lean men with fat overfeeding.35 We further found that Angptl4, characterized as a suppressor of LPL in the plasma,36 MTTP, which functioned as a transporter of TG in the liver,37 and ApoE, acting as a VLDL-TG secretion enhancer in the liver,38 were down-regulated by HF diet feeding, indicating it might result in TG accumulation in the liver. Administration of chitosan-supplemented diet (5 and 7%) could significantly reverse this phenomenon to the baseline level. These findings suggest that supplementation of chitosan in the diet may improve the altered lipid homeostasis induced by HF diet. AMPK is a major regulator of cellular energy homeostasis (glucose and lipid metabolism) in the target tissues (liver, adipose tissue, and muscle).39 AMPK can also phosphorylate and inactivate acetyl-CoA carboxylase (ACC) and HMGCR in the liver, which are the rate-limiting enzymes of fatty acid and sterol synthesis, respectively.40 Additionally, AMPK is capable of down-regulating lipogenic transcription factor SREBPs, which regulates the lipogenesis-associated genes, including FATP, FABP, FAS, ACC, and HMGCR.41,42 Moreover, PPARγ is known to be a key positive regulator of adipogenesis and TG storage in adipocyte. It has been demonstrated that AMPK exerts antiadiposity activity through the suppression of PPARγ in adipose tissue.43 In the present study, we found that HF diet feeding inactivated the protein expression of AMPK and promoted the protein expressions of PPARγ and SREBP and the lipogenesis-associated gene expressions in the liver and adipose tissue. The significant increase of lipogenic tran-

Figure 7. Effects of chitosan on adipose protein expressions of lipid metabolism of HF-diet-fed rats. Protein expressions of p-AMPKα, PPARγ, and SREBP1c were measured by Western blotting. Densitometric analysis for protein levels corrected to each internal control is shown. Results are expressed as the mean ± SD for each group (n = 4−6). (∗) p < 0.05 as compared with the HF diet alone group.

in the foregoing research that HF diet feeding suppressed the rate of lipolysis and elevated LPL activities, which may induce FA entry into adipose tissue, resulting in adipocyte enlargement. In addition, supplementation of 5 and 7% chitosan in the diet significantly reversed the dysregulation of lipid metabolism in HF-diet-fed rats. In the present study, we found a paradoxically decreased plasma TG in HF-diet-fed rats. A decreased plasma TG has also been reported in HF-diet-fed mice, which may be owing to G

DOI: 10.1021/acs.jafc.5b00198 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

triglycerides, leading to adipocyte hypertrophy.51 FATP1, the first member of FA transport proteins, is mostly expressed in adipose tissue and also present in muscle. It is reported that mice with whole body deletion of FATP1 ( fatp1−/−) are protected from HF-diet-induced obesity and insulin resistance.52 Once FAs have crossed the membrane, they are transported by FATPs and bound by cytoplasmic FABPs. FABP4 is highly expressed in adipose tissue and also one of the most abundant proteins in mature adipocytes.53 Several studies have shown that deficiency of FABP4 expression protects mice from dietary or genetic obesity-induced metabolic syndrome, such as hypercholesterolemia, insulin resistance, and atherosclerosis.54−56 In the present study, we found that supplementation of chitosan in the diet significantly decreased the mRNA expression of FATP1 and FABP4 in epididymal adipose tissues and alleviated the levels of TG in epididymal adipose tissues. It is therefore plausible that chitosan attenuated adipocyte hypertrophy via inhibiting FA synthesis and uptake. On the basis of evidence presented in this study, we conclude that a postulated mechanism for the lipid regulation of chitosan is that chitosan activates AMPK phosphorylation and sequentially suppresses downstream expression of lipogenic transcription factors and lipogenesis-associated genes, which can attenuate TG accumulation and lipid biosynthesis in the liver and adipose tissues.

scription factors and lipogenesis-associated genes results in promoting lipid synthesis in the liver and the abnormal accumulation of fat in the liver, which may refer to the fatty liver. Recent studies have suggested that the derivatives of chitin and chitosan (carboxymethyl chitin and chitosan oligosaccharides) exert the antiobesity effect on blocking lipid accumulation and inhibition of adipocyte differentiation via AMPK activation in 3T3-L1 adipocytes.44,45 We further found that administration of a chitosan-supplemented diet, especially supplementation of 7% chitosan, was resistant to HF-dietinduced obesity and fat accumulation in the liver accompanying AMPK activation and suppressive expression of lipogenic transcription factors and lipogenesis-associated genes. On the other hand, leptin is an adipocyte-secreted hormone in proportion to white adipose mass. Obesity is known to be characterized by leptin resistance. Leptin is capable of stimulating the fatty acid oxidation via AMPK activation, which prevents lipid accumulation in nonadipose tissues.43 Our previous study has found that chitosan can induce leptin secretion, which triggers the inhibition of liver gluconeogenesis via AMPK activation in streptozotocin-induced diabetic rats.14 Therefore, chitosan reversed the inhibition of HF diet on AMPK activity through the induction of leptin secretion. In general, it would be reasonable to assume that AMPK is necessary for inhibition of lipogenic transcription factors and downstream target lipogenic genes in the liver and adipose tissue. Chitosan can serve as an antiobesity functional food for control of lipid accumulation in the liver and the adipose tissue via AMPK activation. In the present study, we found that the abdominal (epididymal and perinephrial) adipose tissue weights and blood TC levels were not changed, but TG exhibited a decreased level in HF-diet-fed (15% lard + 0.5% cholesterol) rats for 11 weeks as compared to the ND-fed rats. Takeuchi et al. have shown that the weights of abdominal (epididymal, perinephrial, and mesenteric) adipose tissue in rats are not affected by feeding a lard fat-containing (20% lard) diet for 12 weeks as compared with dietary vegetable oils.46 Bronkowska et al. have found that the blood level of TC, but not TG, in rats fed a lard-containing diet (15% lard + 1% cholesterol) for 28 days is higher than in rats receiving the diet containing vegetable oil.47 However, Li et al. have shown that the blood TG contents in rats fed a HF diet (10% lard + 1% cholesterol) are higher than those of rats receiving ND on day 6, but the TG contents drop to a statistically significant level lower than NDfed rats on day 42.48 Moreover, Á guila et al. have found that the serum TC levels are not changed, but serum TG levels are significantly decreased in rats long-term (45 weeks) fed a HF diet (29% lipids−lard + egg yolk) as compared with rats fed a soybean oil-containing diet.49 These previous and our findings indicate that the different experimental conditions or parameters for HF diet may affect the changes in blood lipid profile in experimental animals. During obesity, there is an increase in adipocyte size by abnormal TG accumulation, which is not only associated with FA biosynthesis but also with the regulation of FA fluxes, including fatty acid transport proteins (FATPs) and fatty acid binding proteins (FABPs).3,50 The putative mechanism of lipogenesis in adipocytes during obesity is that excess insulin activated LPL located on the cell surface of vascular endothelium, and activated LPL removes FA from chylomicron and VLDL into adipocytes through fatty acid transporters, such as FABP and FATP. FA is subsequently esterified into

■

AUTHOR INFORMATION

Corresponding Authors

*(S.-H.L.) Mail: Institute of Toxicology, College of Medicine, National Taiwan University, No. 1, Section 1, Jen-Ai Road, Taipei 10051, Taiwan. Phone: 886-2-23123456, ext. 88605. Fax: 886-2-23410217. E-mail: [email protected]. *(M.-T.C.) Phone: +886-2-24622192, ext. 5117/5118. Fax: +886-2-24634203. E-mail: [email protected]. Funding

This study was supported by a grant from the National Science Council of Taiwan (NSC103-2313-B-019-001-MY3). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED ACC, acetyl-CoA carboxylase; AMPK, AMP-activated protein kinase; CS, chitosan; FA, fatty acid; FABPs, fatty-acid-binding proteins; FAS, fatty acid synthase; FATPs, fatty acid transport proteins; HF, high fat; HMW, high molecular weight; HMGCoA, 3-hydroxy-3-methylglutaryl coenzyme A; HMGCR, HMG-CoA reductase; LPL, lipoprotein lipase; ND, standard rodent diet with 5% cellulose; PPARγ, peroxisome proliferatoractivated receptor-gamma; SREBPs, sterol regulatory element binding proteins; TC, total cholesterol; TG, triglyceride

■

REFERENCES

(1) World Health Organization (WHO). Obesity and overweight, 2014; http://www.who.int/mediacentre/factsheets/fs311/en/. (2) Mokdad, A. H.; Ford, E. S.; Bowman, B. A.; Dietz, W. H.; Vinicor, F.; Bales, V. S.; Marks, J. S. Prevalence of obesity, diabetes, and obesity-related health risk factors, 2001. JAMA, J. Am. Med. Assoc. 2003, 289 (1), 76−79. (3) Ouchi, N.; Parker, J. L.; Lugus, J. J.; Walsh, K. Adipokines in inflammation and metabolic disease. Nat. Rev. Immunol. 2011, 11 (2), 85−97. (4) Jung, U. J.; Choi, M. S. Obesity and its metabolic complications: the role of adipokines and the relationship between obesity,

H

DOI: 10.1021/acs.jafc.5b00198 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

alcoholic steatohepatitis in novel spontaneous mouse model. J. Hepatol. 2010, 52 (6), 903−912. (25) Oike, Y.; Akao, M.; Kubota, Y.; Suda, T. Angiopoietin-like proteins: potential new targets for metabolic syndrome therapy. Trends Mol. Med. 2005, 11 (10), 473−479. (26) Maugeais, C.; Tietge, U. J.; Tsukamoto, K.; Glick, J. M.; Rader, D. J. Hepatic apolipoprotein E expression promotes very low density lipoprotein-apolipoprotein B production in vivo in mice. J. Lipid Res. 2000, 41 (10), 1673−1679. (27) Walsh, A. M.; Sweeney, T.; Bahar, B.; O’Doherty, J. V. Multifunctional roles of chitosan as a potential protective agent against obesity. PLoS One 2013, 8 (1), No. e53828. (28) Sumiyoshi, M.; Kimura, Y. Low molecular weight chitosan inhibits obesity induced by feeding a high-fat diet long-term in mice. J. Pharm. Pharmacol. 2006, 58 (2), 201−207. (29) Liu, X.; Zhi, X.; Liu, Y.; Wu, B.; Sun, Z.; Shen, J. Effect of chitosan, O-carboxymethyl chitosan, and N-[(2-hydroxy-3-N,Ndimethylhexadecyl ammonium)propyl] chitosan chloride on overweight and insulin resistance in a murine diet-induced obesity. J. Agric. Food Chem. 2012, 60 (13), 3471−3476. (30) Roberts, C. K.; Barnard, R. J.; Liang, K. H.; Vaziri, N. D. Effect of diet on adipose tissue and skeletal muscle VLDL receptor and LPL: implications for obesity and hyperlipidemia. Atherosclerosis 2002, 161 (1), 133−141. (31) Lafontan, M.; Langin, D. Lipolysis and lipid mobilization in human adipose tissue. Prog. Lipid Res. 2009, 48 (5), 275−297. (32) Gaidhu, M. P.; Anthony, N. M.; Patel, P.; Hawke, T. J.; Ceddia, R. B. Dysregulation of lipolysis and lipid metabolism in visceral and subcutaneous adipocytes by high-fat diet: role of ATGL, HSL, and AMPK. Am. J. Physiol. Cell Physiol. 2010, 298 (4), C961−C971. (33) Guo, J.; Jou, W.; Gavrilova, O.; Hall, K. D. Persistent dietinduced obesity in male C57BL/6 mice resulting from temporary obesigenic diets. PLoS One 2009, 4 (4), No. e5370. (34) Biddinger, S. B.; Almind, K.; Miyazaki, M.; Kokkotou, E.; Ntambi, J. M.; Kahn, C. R. Effects of diet and genetic background on sterol regulatory element-binding protein-1c, stearoyl-CoA desaturase 1, and the development of the metabolic syndrome. Diabetes 2005, 54 (5), 1314−1323. (35) Meugnier, E.; Bossu, C.; Oliel, M.; Jeanne, S.; Michaut, A.; Sothier, M.; Brozek, J.; Rome, S.; Laville, M.; Vidal, H. Changes in gene expression in skeletal muscle in response to fat overfeeding in lean men. Obesity (Silver Spring) 2007, 15 (11), 2583−2594. (36) Shan, L.; Yu, X. C.; Liu, Z.; Hu, Y.; Sturgis, L. T.; Miranda, M. L.; Liu, Q. The angiopoietin-like proteins ANGPTL3 and ANGPTL4 inhibit lipoprotein lipase activity through distinct mechanisms. J. Biol. Chem. 2009, 284 (3), 1419−1424. (37) Jamil, H.; Gordon, D. A.; Eustice, D. C.; Brooks, C. M.; Dickson, J. K., Jr.; Chen, Y.; Ricci, B.; Chu, C. H.; Harrity, T. W.; Ciosek, C. P., Jr.; Biller, S. A.; Gregg, R. E.; Wetterau, J. R. An inhibitor of the microsomal triglyceride transfer protein inhibits apoB secretion from HepG2 cells. Proc. Natl. Acad. Sci. U.S.A. 1996, 93 (21), 11991− 11995. (38) Kuipers, F.; Jong, M. C.; Lin, Y.; Eck, M.; Havinga, R.; Bloks, V.; Verkade, H. J.; Hofker, M. H.; Moshage, H.; Berkel, T. J.; Vonk, R. J.; Havekes, L. M. Impaired secretion of very low density lipoproteintriglycerides by apolipoprotein E-deficient mouse hepatocytes. J. Clin. Invest. 1997, 100 (11), 2915−2922. (39) Hardie, D. G. The AMP-activated protein kinase pathway − new players upstream and downstream. J. Cell Sci. 2004, 117 (Pt 23), 5479−5487. (40) Clarke, P. R.; Hardie, D. G. Regulation of HMG-CoA reductase: identification of the site phosphorylated by the AMP-activated protein kinase in vitro and in intact rat liver. EMBO J. 1990, 9 (8), 2439− 2446. (41) Srivastava, R. A.; Pinkosky, S. L.; Filippov, S.; Hanselman, J. C.; Cramer, C. T.; Newton, R. S. AMP-activated protein kinase: an emerging drug target to regulate imbalances in lipid and carbohydrate metabolism to treat cardio-metabolic diseases. J. Lipid Res. 2012, 53 (12), 2490−2514.

inflammation, insulin resistance, dyslipidemia and nonalcoholic fatty liver disease. Int. J. Mol. Sci. 2014, 15 (4), 6184−223. (5) Grummer, R. R. Etiology of lipid-related metabolic disorders in periparturient dairy cows. J. Dairy Sci. 1993, 76 (12), 3882−3896. (6) Rahman, A.; Kumar, S. G.; Yun, J. W. Proteome analysis in adipose tissue of ob/ob mice in response to chitosan oligosaccharides treatment. Biotechnol. Bioprocess. Eng. 2010, 15, 559−571. (7) Lai, Y. S.; Chen, W. C.; Ho, C. T.; Lu, K. H.; Lin, S. H.; Tseng, H. C.; Lin, S. Y.; Sheen, L. Y. Garlic essential oil protects against obesitytriggered nonalcoholic fatty liver disease through modulation of lipid metabolism and oxidative stress. J. Agric. Food Chem. 2014, 62 (25), 5897−5906. (8) Deuchi, K.; Kanauchi, O.; Imasato, Y.; Kobayashi, E. Effect of the viscosity or deacetylation degree of chitosan on fecal fat excreted from rats fed on a high fat diet. Biosci., Biotechnol., Biochem. 1995, 59, 781− 785. (9) Chen, J. K.; Yeh, C. H.; Wang, L. C.; Liou, T. H.; Shen, C. R.; Liu, C. L. Chitosan, the marine functional food, is a potent adsorbent of humic acid. Mar. Drugs 2011, 9 (12), 2488−2498. (10) Shahidi, F.; Abuzaytoun, R. Chitin, chitosan, and co-products: chemistry, production, applications, and health effects. Adv. Food Nutr. Res. 2005, 49, 93−135. (11) Yao, H. T.; Chiang, M. T. Effect of chitosan on plasma lipids, hepatic lipids, and fecal bile acid in hamsters. J. Food Drug Anal. 2006, 14, 183−189. (12) Gallaher, D. D.; Gallaher, C. M.; Mahrt, G. J.; Carr, T. P.; Hollingshead, C. H.; Hesslink, R., Jr.; Wise, J. A glucomannan and chitosan fiber supplement decreases plasma cholesterol and increases cholesterol excretion in overweight normocholesterolemic humans. J. Am. Coll. Nutr. 2002, 21 (5), 428−433. (13) Hsieh, Y. L.; Yao, H. T.; Cheng, R. S.; Chiang, M. T. Chitosan reduces plasma adipocytokines and lipid accumulation in liver and adipose tissues and ameliorates insulin resistance in diabetic rats. J. Med. Food 2012, 15 (5), 453−460. (14) Liu, S. H.; Chang, Y. H.; Chiang, M. T. Chitosan reduces gluconeogenesis and increases glucose uptake in skeletal muscle in streptozotocin-induced diabetic rats. J. Agric. Food Chem. 2010, 58 (9), 5795−800. (15) Yuan, H. D.; Piao, G. C. An active part of Artemisia sacrorum Ledeb inhibits adipogenesis via the AMPK signaling pathway in 3T3L1 adipocytes. Int. J. Mol. Med. 2011, 27 (4), 531−536. (16) Lim, C. T.; Kola, B.; Korbonits, M. AMPK as a mediator of hormonal signalling. J. Mol. Endocrinol. 2010, 44 (2), 87−97. (17) Jeong, K. J.; Kim, G. W.; Chung, S. H. AMP-activated protein kinase: an emerging target for ginseng. J. Ginseng Res. 2014, 38 (2), 83−88. (18) Bray, G. A. A concise review on the therapeutics of obesity. Nutrition 2000, 16 (10), 953−960. (19) Carlson, S. E.; Goldfarb, S. A sensitive enzymatic method for determination of free and esterified tissue cholesterol. Clin. Chim. Acta 1977, 79 (3), 575−582. (20) Nepokroeff, C. M.; Lakshmanan, M. R.; Porter, J. W. Fatty-acid synthase from rat liver. Methods Enzymol. 1975, 35, 37−44. (21) Mohan, S. B.; Kekwick, R. G. Acetyl-coenzyme A carboxylase from avocado (Persea americana) plastids and spinach (Spinacia oleracea) chloroplasts. Biochem. J. 1980, 187 (3), 667−676. (22) Edwards, P. A.; Lemongello, D.; Kane, J.; Shechter, I.; Fogelman, A. M. Properties of purified rat hepatic 3-hydroxy-3methylglutaryl coenzyme A reductase and regulation of enzyme activity. J. Biol. Chem. 1980, 255 (8), 3715−3725. (23) Kusunoki, M.; Hara, T.; Tsutsumi, K.; Nakamura, T.; Miyata, T.; Sakakibara, F.; Sakamoto, S.; Ogawa, H.; Nakaya, Y.; Storlien, L. H. The lipoprotein lipase activator, NO-1886, suppresses fat accumulation and insulin resistance in rats fed a high-fat diet. Diabetologia 2000, 43 (7), 875−880. (24) Shindo, N.; Fujisawa, T.; Sugimoto, K.; Nojima, K.; Oze-Fukai, A.; Yoshikawa, Y.; Wang, X.; Yasuda, O.; Ikegami, H.; Rakugi, H. Involvement of microsomal triglyceride transfer protein in nonI

DOI: 10.1021/acs.jafc.5b00198 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry (42) Oikari, S.; Ahtialansaari, T.; Heinonen, M. V.; Mauriala, T.; Auriola, S.; Kiehne, K.; Fölsch, U. R.; Jänne, J.; Alhonen, L.; Herzig, K. H. Downregulation of PPARs and SREBP by acyl-CoA-binding protein overexpression in transgenic rats. Pfluegers Arch. 2008, 456 (2), 369−377. (43) Sugden, M. C.; Warlow, M. P.; Holness, M. J. The involvement of PPARs in the causes, consequences and mechanisms for correction of cardiac lipotoxicity and oxidative stress. Curr. Mol. Pharmacol. 2012, 5, 224−240. (44) Kong, C. S.; Kim, J. A.; Bak, S. S.; Byun, H. G.; Kim, S. K. Antiobesity effect of carboxymethyl chitin by AMPK and aquaporin-7 pathways in 3T3-L1 adipocytes. J. Nutr. Biochem. 2011, 22 (3), 276− 281. (45) Rahman, A.; Kumar, S. G.; Kim, S. W.; Hwang, H. J.; Baek, Y. M.; Lee, S. H.; Hwang, H. S.; Shon, Y. H.; Nam, K. S.; Yun, J. W. Proteomic analysis for inhibitory effect of chitosan oligosaccharides on 3T3-L1 adipocyte differentiation. Proteomics 2008, 8 (3), 569−581. (46) Takeuchi, H.; Matsuo, T.; Tokuyama, K.; Shimomura, Y.; Suzuki, M. Diet-induced thermogenesis is lower in rats fed a lard diet than in those fed a high oleic acid safflower oil diet, a safflower oil diet or a linseed oil diet. J. Nutr. 1995, 125 (4), 920−925. (47) Bronkowska, M.; Orzeł, D.; Łoźna, K.; Styczyńska, M.; Biernat, J.; Gryszkin, A.; Zieba, T.; Kapelko, M. Effect of resistant starch RS4 added to the high-fat diets on selected biochemical parameters in Wistar rats. Rocz. Panstw. Zakl. Hig. 2013, 64 (1), 19−24. (48) Li, N.; Chen, Z.; Mao, X.; Yu, J.; Zhao, R. Effects of lipid regulation using raw and processed radix polygoni multiflori in rats fed a high-fat diet. Evidence-Based Complement. Alternat. Med. 2012, 2012, 329171. (49) Aguila, M. B.; Loureiro, C. C.; Pinheiro, A. D. R.; MandarimDe-Lacerda, C. A. Lipid metabolism in rats fed diets containing different types of lipids. Arq. Bras. Cardiol. 2002, 78 (1), 25−38. (50) Westerbacka, J.; Kolak, M.; Kiviluoto, T.; Arkkila, P.; Sirén, J.; Hamsten, A.; Fisher, R. M.; Yki-Järvinen, H. Genes involved in fatty acid partitioning and binding, lipolysis, monocyte/macrophage recruitment, and inflammation are overexpressed in the human fatty liver of insulin-resistant subjects. Diabetes 2007, 56 (11), 2759−2765. (51) Maeda, N.; Funahashi, T.; Shimomura, I. Metabolic impact of adipose and hepatic glycerol channels aquaporin 7 and aquaporin 9. Nat. Clin. Pract. Endocrinol. Metab. 2008, 4 (11), 627−634. (52) Wu, Q.; Ortegon, A. M.; Tsang, B.; Doege, H.; Feingold, K. R.; Stahl, A. FATP1 is an insulin-sensitive fatty acid transporter involved in diet-induced obesity. Mol. Cell. Biol. 2006, 26 (9), 3455−3467. (53) Maeda, K.; Cao, H.; Kono, K.; Gorgun, C. Z.; Furuhashi, M.; Uysal, K. T.; Cao, Q.; Atsumi, G.; Malone, H.; Krishnan, B.; Minokoshi, Y.; Kahn, B. B.; Parker, R. A.; Hotamisligil, G. S. Adipocyte/macrophage fatty acid binding proteins control integrated metabolic responses in obesity and diabetes. Cell Metab. 2005, 1 (2), 107−119. (54) Hotamisligil, G. S.; Johnson, R. S.; Distel, R. J.; Ellis, R.; Papaioannou, V. E.; Spiegelman, B. M. Uncoupling of obesity from insulin resistance through a targeted mutation in aP2, the adipocyte fatty acid binding protein. Science 1996, 274 (5291), 1377−1379. (55) Boord, J. B.; Maeda, K.; Makowski, L.; Babaev, V. R.; Fazio, S.; Linton, M. F.; Hotamisligil, G. S. Adipocyte fatty acid-binding protein, aP2, alters late atherosclerotic lesion formation in severe hypercholesterolemia. Arterioscler. Thromb. Vasc. Biol. 2002, 22 (10), 1686− 1691. (56) Perrella, M. A.; Pellacani, A.; Layne, M. D.; Patel, A.; Zhao, D.; Schreiber, B. M.; Storch, J.; Feinberg, M. W.; Hsieh, C. M.; Haber, E.; Lee, M. E. Absence of adipocyte fatty acid binding protein prevents the development of accelerated atherosclerosis in hypercholesterolemic mice. FASEB J. 2001, 15 (10), 1774−1776.

J

DOI: 10.1021/acs.jafc.5b00198 J. Agric. Food Chem. XXXX, XXX, XXX−XXX