Surface-Anchoring of Spontaneously Dimerized Epidermal Growth

102

Bioconjugate Chem. 2009, 20, 102–110

Surface-Anchoring of Spontaneously Dimerized Epidermal Growth Factor for Highly Selective Expansion of Neural Stem Cells Tadashi Nakaji-Hirabayashi, Koichi Kato, and Hiroo Iwata* Institute for Frontier Medical Sciences, Kyoto University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. Received July 31, 2008; Revised Manuscript Received November 21, 2008

To develop culture substrates for use in selective expansion of neural stem cells (NSCs), epidermal growth factor (EGF)-containing chimeric proteins were designed and synthesized by means of recombinant DNA technology. The chimeric proteins consisted of three components including an EGF domain, an R-helical oligopeptide, and a hexahistidine sequence. Two different R-helical oligopeptides were separately incorporated into chimeric proteins. Structural analyses by native gel electrophoresis and circular dichroism spectroscopy revealed that the heterodimer of these proteins was spontaneously formed through coiled-coil association of the R-helical oligopeptides. The monomeric and dimeric forms of these chimeric proteins were immobilized to the glass-based substrate via coordinate bonding between the hexahistidine and Ni(II) ions fixed on a substrate. The results of cell culture assays with NSCs showed that cells proliferated most rapidly and selectively on a substrate with the surfaceanchored EGF dimer. The rate of cell proliferation on the surface with dimeric EGF was 1.3-2.0 times higher on the surfaces with monomeric EGF. In addition, the content of stem cells, determined 96 h after cell seeding, was highest on the surface with dimeric EGF (98%) among the surfaces studied (90-97% on surfaces with monomeric EGF). The observed growth rate and the stem cell content on the surface with EGF dimer were far beyond those in the standard neurosphere culture. The effect of surface-anchored dimeric EGF may be attributed to the enhanced dimerization of EGF-EGF receptor complexes leading to efficient signaling for mitogenic activity. We conclude that surface-anchoring of the EGF dimer provides an excellent substrate that allows the highly efficient expansion of NSCs.

INTRODUCTION Large-scale production of neural stem cells (NSCs) with high purity is crucial for their clinical application in cell transplantation therapy for neurodegenerative diseases such as Parkinson’s disease (1, 2). The culture substrate previously developed by our group (3) has the potential to provide the culture method that allows to selective expansion of NSCs from heterogeneous cell populations. The substrate was designed to display epidermal growth factor (EGF), a strong activator for the proliferation of NSCs (4), on the surface of a glass-based substrate. The key feature of substrate preparation was to terminally anchor EGF molecules to the surface through the hexahistidine sequence that was fused with EGF via recombinant DNA technology (5). The surface-anchoring of engineered growth factors was also reported by Ogiwara et al. (6, 7) and Nagaoka et al. (8). The EGF-anchored substrate facilitates production of a cell population rich in NSCs (purity >92%). The selectivity of stem cell expansion is much higher than the neurosphere culture (9, 10) that has been used as the most standard method to obtain NSCs. However, a population expanded by our culture method still contains approximately 7% differentiated cells. For this reason, the present study was undertaken to improve much more the efficiency of NSC production. Our strategy adopted here was to promote the interaction of surface-anchored EGF with EGF receptors (EGFR) by designing spontaneously dimerizing EGF. Numerous studies have shown that EGF binding to EGFR triggers receptor dimerization that is considered to be a critical step for the subsequent transduction of intracellular * To whom correspondence should be addressed. Prof. Hiroo Iwata, E-mail: [email protected], Tel & Fax: +81-75-751-4119.

signaling (11). Inspired by this mechanism, we designed EGF-containing chimeric proteins that spontaneously form a dimerized form of EGF. The dimer was terminally anchored onto the substrate. Our expectation is that the preformed dimeric structure of EGF facilitates the formation of EGFEGFR dimer complexes more efficiently than the monomeric form of EGF as presented on our previous substrate. Our strategy for the spontaneous dimerization of EGF is to incorporate an R-helical oligopeptide that has the ability to participate in the formation of a coiled-coil structure. To avoid aggregation of proteins in expression host cells due to spontaneous homodimerization, we implemented here a heterodimerization system in which (EKLASVK)5 (K5) and (KELASVE)5 (E5) peptides form a stable coiled-coil structure. These peptides were designed according to previous reports (12, 13). The coiled-coil structure formed by the intermolecular association of R-helical peptides is an abundant motif found in various proteins (14) and has also been utilized for creating engineered biomaterials such as hydrogels (15-17), nanostructured molecular machines (18), and scaffolds for tissue engineering (19). In this study, we synthesized two chimeric proteins containing an EGF domain and the K5 or E5 oligopeptide. As we previously reported, a hexahistidine sequence was further added to the C-terminus of both chimeric proteins, so as to anchor the chimeric proteins through coordination to the substrate on which Ni(II) ions were fixed. The heterodimerization of chimeric proteins was examined by native polyacrylamide gel electrophoresis (native PAGE) and circular dichroism (CD) spectroscopy. The effect of surfaceanchored EGF dimer was studied by analyzing the adhesion and proliferation of cultured NSCs and the phosphorylation of EGFR. These assays revealed that NSCs proliferate much

10.1021/bc800331t CCC: $40.75  2009 American Chemical Society Published on Web 12/30/2008

Surface-Anchoring of Spontaneously Dimerized EGF

Figure 1. (A) Structure of EGF-containing chimeric proteins synthesized. (B) Schematic representation for the preparation of chimeric genes.

rapidly on the substrate with dimeric EGF than that with the monomeric one.

EXPERIMENTAL PROCEDURES Plasmids. Synthetic DNA fragments (ca. 50 mer) corresponding to 5′-terminal, middle, and 3′-terminal parts of DNA encoding (EKLASVK)5 (K5) and (KELASVE)5 (E5) were purchased from Invitrogen (Carlsbad, CA). The 5′-terminal fragment contained 21-mer oligonucleotides for heptapeptides (PGGGGGP) to be inserted between EGF and the K5 or E5 sequence as a flexible linker (20, 21) (Figure 1A). These fragments were ligated with each other in a proper order using the method by Pachuk et al. (22) to obtain DNAs encoding fulllength K5 or E5 flanked with PGGGGGP at the N-terminus. The sequence of all oligonucleotides was shown in Table 1. All steps for ligation are schematically represented in Figure 1B. The 5′-end of the DNA fragments including sense 2 and 3 and antisense 2 and 3 were phosphorylated using T4 polynucleotide kinase. Then, the phosphorylated oligonucleotides were mixed with sense 1 and antisense 1 (each 1 µM) in a 50 µL reaction buffer (20 mM Tris-HCl, 25 mM KCl, 10 mM magnesium chloride, 0.5 mM NAD, and 0.01% Triton X-100, pH 8.3) containing 0.3 U/µL thermostable DNA ligase (Ampligase, Epicenter Technologies, Madison, WI) and 1 µM bridge oligonucleotides (Table 1). Chain reaction cloning was allowed to proceed by thermal cycling using GeneAmp 9600 (Applied Biosystems, Foster City, CA) under the following conditions:

Bioconjugate Chem., Vol. 20, No. 1, 2009 103

50 cycles, denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and ligation at 66 °C for 1 min. Finally, the ligated DNA was amplified by polymerase chain reaction (PCR) using outer primers (Table 1). The forward primers contained 20mer oligonucleotides that overlapped with the 3′-region of EGF gene. Reverse primers contained an Xho I restriction site. On the other hand, the EGF gene was amplified by PCR from pET22b-EGF (4) using specific primers (Table 1). The forward primers contained an Nde I site at the 5′-end. The reverse primers were flanked with 20-mer oligonucleotides that overlapped with the 5′-region of DNA for PGGGGGP-K5 or PGGGGGP-E5. The DNAs for EGF and PGGGGGP-K5 or PGGGGGP-E5 were annealed, extended by overlap extension (23), and amplified by PCR to obtain EGF-PGGGGGP-K5 and EGF-PGGGGGP-E5 chimeric genes. The chimeric genes were digested with Nde I and Xho I and inserted into the Nde I-Xho I site of pET-22b (Novagen, Darmstadt, Germany). The plasmids (pET-22b-EGF-K5, pET-22b-EGF-E5) were cloned in Escherichia coli (E. coli) DH5R. The correctness of the plasmids was confirmed by sequencing. Protein Expression, Purification, and Refolding. The EGF chimeric proteins, EGF-K5-His and EGF-E5-His, were expressed in E. coli strain BL21-codonplus (Stratagene, La Jolla, CA) using overnight express autoinduction system (Novagen). The preparation of a control protein, EGF-His, was reported previously (4). These proteins obtained as inclusion bodies were extracted with 8 M urea solution containing 5 mM 2-mercap¨ KTA chromatogtoethanol and then purified using a Prime A raphy system (GE Healthcare Bio-Science Corp., Piscataway, NJ) equipped with a His Trap HP column (GE Healthcare). These proteins were refolded by dialyzing against a solution of reduced and oxidized forms of glutathione. The detailed conditions of the refolding procedure were provided in Supporting Information Table S3. Protein concentration was determined using a microBCA kit (Pierce Biotechnology, Rockford, IL). The yields of EGF-K5-His and EGF-E5-His were determined to be, respectively, 210 mg and 275 mg per liter of medium. The purity and molecular size of proteins were analyzed by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The biological activity of EGF contained in these proteins was assessed from the mitogenic activity in neurosphere culture (9). Heterodimerization. EGF-K5-His and EGF-E5-His were mixed in PBS at various compositions, and the coiled-coil association between E5 and K5 peptide segments was allowed to proceed at room temperature for 30 min to obtain their heterodimer (dEGF-His). Heterodimerization was assessed by native PAGE in which 3 µg of total proteins were electrophoresced in 16% polyacrylamide gel with 50 mM Tris-HCl running buffer (pH 8.3) containing 192 mM glycine followed by staining with Coomassie brilliant blue. CD Spectroscopy. Chimeric proteins were dissolved in PBS (pH 7.4) to a mean residue concentration of 4.2 mM (EGFHis) or 4.4 mM (EGF-K5-His, EGF-E5-His, and dEGF-His). dEGF-His solution was prepared by mixing 0.5 mg/mL EGFE5-His (250 µL) with 0.5 mg/mL EGF-K5-His (250 µL). CD spectra were recorded with JASCO J-805 spectropolarimeter and a 1-mm path length cell at a response time of 0.5 s, a bandwidth of 1 nm, a scan speed of 100 nm/min, and 20 °C with an accumulation of 8 scans. Substrate Preparation. As reported previously (3), EGFcontaining chimeric proteins were anchored through the His sequence onto a glass-based substrate bearing a thin gold layer and a carboxylic acid-terminated alkanethiol monolayer on the surface. In brief, the mixed self-assembled monolayer consisting of 10% 16-mercapto-1-hexadecanoic acid (Aldrich, Munich, Germany) and 90% (1-mercaptoundec-11-yl)triethylene glycol

104 Bioconjugate Chem., Vol. 20, No. 1, 2009

Nakaji-Hirabayashi et al.

Table 1. Sequences of Primers and Oligonucleotides Used for the Synthesis of EGF-K5-His and EGF-E5-His (A) EGF-K5-His primer or oligonucleotide

sequence (5′ f 3′)

K5-sense 1 K5-sense 2 K5-sense 3 K5-antisense 1 K5-antisense 2 K5-antisense 3 bridge oligonucleotide I bridge oligonucleotide II forward primer reverse primer forward primer for EGF reverse primer for EGF

ctgaagtggtgggaactgcgcccaggcggtggaggtgggccggagaaattagcttct gttaaggaaaagttggcctcagtcaaagagaagctcgcaagtgtgaaagaa aaactggcgtccgtaaaggaaaaactcgctagcgtaaagctcgagcatgatg agaagctaatttctccggcccacctccaccgcctgggcgcagttcccaccacttcag ttctttcacacttgcgagcttctctttgactgaggccaacttttccttaac catcatgctcgagctttacgctagcgagtttttcctttacggacgccagttt gaggccaacttttccttaacagaagctaatttctccggcc tcctttacggacgccagtttttctttcacacttgcgagct ctgaagtggtgggaactgcgcc catcatgctcgagctttacgc ggccggcatatgaatagtgactctgaatgtcccc tctccggcccaccgcctgggcgcagttcccaccacttcag (B) EGF-E5-His

primer or oligonucleotide

sequence(5′f3′)

E5-sense 1 E5-sense 2 E5-sense 3 E5-antisense 1 E5-antisense 2 E5-antisense 3 bridge oligonucleotide I bridge oligonucleotide II forward primer reverse primer forward primer for EGF reverse primer for EGF

ctgaagtggtgggaactgcgcccaggcggtggaggtgggccgaaggagttagcttct gttgaaaaggaattggcctcagtcgagaaagaactcgcatccgtagagaag gagctagcgagtgtggaaaaggagcttgctagcgttgaactcgaggatctag agaagctaactccttcggcccacctccaccgcctgggcgcagttcccaccacttcag cttctctacggatgcgagttctttctcgactgaggccaattccttttcaac ctagatcctcgagttcaacgctagcaagctccttttccacactcgctagctc gaggccaattccttttcaacagaagctaactccttcggcc cttttccacactcgctagctccttctctacggatgcgagttc ctgaagtggtgggaactgcgcc ctagatcctcgagttcaacgc ggccggcatatgaatagtgactctgaatgtcccc ccttcggcccaccgcctgggcgcagttcccaccacttcag

(TEG-thiol, SensoPath Technologies, Bozeman, MT) was formed on a gold-evaporated surface. The triethylene glycolterminated alkanethiol was used to prevent nonspecific protein adsorption and to control the surface density of EGF chimeric proteins (3). Then, the terminal carboxylic acid of 16-mercapto1-hexadecanoic acid was activated by immersing the plate in an aqueous solution containing 50 mM N,N′-dicyclohexyl carbodiimide and 25 mM N-hydroxysuccinimide at room temperature for 30 min. Then, the plate was exposed to an aqueous solution containing 10 mM N-(5-amino-1-carboxypentyl) iminodiacetic acid (NTA; Dojindo Laboratories, Kumamoto, Japan) to couple with the activated carboxylic acid followed by exposure to 40 mM NiSO4 solution to chelate Ni(II) ions. The His sequence in the chimeric proteins was coordinated to the fixed Ni(II) ions to anchor the proteins onto the surface. For the immobilization of dEGF-His, a solution containing 0.5 mg/mL EGF-E5-His and 0.5 mg/mL EGF-K5-His was prepared, and then the Ni(II)-chelated surface was exposed to the mixted

solution. Prior to cell culture assays, the glass plates were washed with PBS and culture medium to remove weakly adsorbed chimeric proteins. Surface Plasmon Resonance (SPR) Analysis. SPR analysis was carried out as before (3, 24) using an in-house SPR apparatus. The light reflectance was continuously monitored at an incident angle 0.5° smaller than the resonance angle during the following procedures: After equilibrating with PBS, the surface of a Ni(II)-chelated gold plate was exposed to 20 mM sodium phosphate buffer (pH 7.4) containing 20 mM imidazole (binding buffer) in a flow cell for 5 min followed by circulation of binding buffer containing 50 µg/mL chimeric protein for 65 min. Subsequently, pure binding buffer was circulated for 50 min. The reflectance was converted to the resonance angular shift. The angular shift observed before and after the binding of chimeric protein was converted to the amount of EGF chimeric protein, assuming that unit angular shift corresponds to a protein density of 0.5 µg/cm2 (25).

Figure 2. (A) The result of SDS-PAGE analysis for EGF-His, EGF-K5-His, and EGF-E5-His. M represents molecular weight standard. (B) The result of native-PAGE analysis performed for the mixture of EGF-K5-His and EGF-E5-His at various compositions. Compositions are indicated above the image of the gel. (C) Circular dichroism spectra of (a) EGF-His, (b) EGF-E5-His, (c) EGF-K5-His, and (d) dEGF-His.


Figure 3. The growth curve of neurosphere-forming cells cultured in suspension in base medium containing 2% B27 with 20 ng/mL (O) EGF-His, (b) EGF-E5-His, (0) EGF-K5-His, and (9) dEGF-His or (∆) without growth factor (control). Initial cell number: 2.1 × 104 cells/ mL. Table 2. Percentages of Cells Expressing Nestin and βIII after 4-Day Suspension Culture in the Presence of Chimeric Proteins or 4-Day Adherent Culture on the Substrate with Surface-Anchored Chimeric Proteinsa

a Data are expressed as mean ( standard deviation (n ) 3, dissolved in medium; n ) 5, immobilized on substrate). *Statistically significant (Tukey’s HSD test, p < 0.05).

Figure 4. SPR sensorgrams obtained during the binding and dissociation of (a) EGF-His, (b) EGF-K5-His, (c) EGF-E5-His, and (d) dEGF-His to the Ni-chelated surfaces.

Cell Isolation and Culture. Cell isolation from the striatum of rat fetus (E16) and neurosphere culture were performed as reported previously (3-5). All the procedures were conducted according to the guidelines of the Animal Welfare Committee of the institute. Neurosphere forming cells at passage 2 were


dissociated into single cells by treatment with 0.05% trypsinEDTA solution. The single cells were suspended in a base medium [DMEM/F12 (1:1), 3 mM glutaMAX, 100 units/mL penicillin, 100 µg/mL streptomycin, and 5 µg/mL heparin] supplemented with 2% B27, and then seeded at 3 × 104 cells/ cm2 onto the substrates prepared as described earlier. Cells were cultured for 4 days at 37 °C under 5% CO2 atmosphere. Finally, cells were washed gently with base medium to remove weakly adhering cells and observed with a phase-contrast optical microscope (BX51 TRF, Olympus Optical Co., Ltd., Tokyo, Japan). Cell Proliferation Assay. Cell proliferation assays were carried out with neurosphere-forming cells cultured in suspension under base medium supplemented with 2% B27 containing 20 ng/mL EGF-His, EGF chimeric proteins, or recombinant human EGF (rhEGF, Invitogen Corp., Carlsbad, CA). Cells were cultured for 4 days, and then cell number was determined by the modified MTT assay (3). Cells were incubated in the base medium containing 10% cell counting reagent SF (Nacali Tesque, Kyoto, Japan) for 3 h, and then absorbance at 450 nm was determined for the medium using a microplate reader (model 5500, Bio-Rad, Hercules, CA). The number of cells proliferated on the substrates was also determined by the modified MTT assay. After the substrate was washed with DMEM/F12 (1:1) to remove nonadhering cells, cell number was determined as described above. The absorbance was converted to cell number using a calibration curve. The assays were carried out at 24, 36, 48, 60, 72, and 96 h after cell seeding. Immunocytochemistry. After fixation and permeabilization, cells were immunofluorescently stained using antibodies against a neural stem cell marker (nestin, 1:200, mouse monoclonal Rat 401, BD pharmingen, Franklin Lakes, NJ) and a neuronal marker (class III β-tubulin; βIII, 1:600, rabbit polyclonal, Covance, Princeton, NJ), as reported previously (3, 5, 23). The localization of fluorescently labeled secondary antibodies was analyzed with an epifluorescent microscope (DP70, Olympus). Cells expressing these markers were counted on microphotographs for the area of 340 × 460 µm2, which contained at most approximately 800 total cells, using Image J software (National Institutes of Health, Bethesda, MD). Cell numbers were determined on five different microphotographs for each sample, and the data are shown as the mean plus/minus standard deviation for five independent samples. In addition, neurosphere cells were dissociated and immunocytochemically stained. The conditions for fixation, permeabilization, blocking, reaction with antibodies, and counterstaining were the same as described above, but these procedures were performed in suspension by separating cells from each solution by centrifugation. The total cells and nestin- and βIII-positive cells were counted in the same manner as described above. Western Blotting. Cells cultured for 2 days on the substrate were harvested using a cell scraper and dissolved in a lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 1 mM Na3VO4, 10 mM Na4P2O7, and 25 mM β-glycerolphosphate; pH 7.5) containing a cocktail of protease inhibitors (Complete Mini, Roche Diagnostics, Mannheim, Germany). The lysate was separated by SDS-PAGE and electrically blotted to a poly(vinylidene fluoride) membrane. After blocking with Blocking One-P (Nacalai Tesque, Kyoto, Japan), the membrane was immersed in a solution containing antibody against the phosphorylated form of EGFR (1:1000, #2236, Cell Signaling Technology, Danvers, MA) or total EGFR (1:1000, #2232, Cell Signaling Technology). The antibodies bound to the membrane were reacted with HRP-linked secondary antibody (1:5000, GE Healthcare) and visualized by the chemiluminescence reagent



Figure 5. (A) Phase-contrast images of cells cultured for 48 h on the substrates with surface-anchored chimeric proteins. The identity of surfaceanchored chimeric proteins is shown in the images. Bars: 100 µm. (B) Growth curves of cells cultured on the substrate with surface-anchored (O) EGF-His, (b) EGF-E5-His, (0) EGF-K5-His, and (9) dEGF-His. Data are expressed as mean ( standard deviation (n ) 3). Cell seeding density: 3.0 × 104 cells/cm2. *Cell growth on the substrates with dEGF-His was significantly large compared with that on each of the other substrates (Tukey’s HSD test, p < 0.05). Apparent doubling time was 14.6 ( 2.3 h (EGF-His), 10.0 ( 1.0 h (EGF-K5-His), 8.7 ( 1.2 (EGF-E5-His), and 7.1 ( 1.3 h (dEGF-His), when determined from growth curves for 24-60 h.

statistically analyzed using software (JMP5.0.1a, SAS Institute Inc., Cary, NC). One-way analysis of variance (ANOVA) was performed for assessing significant differences. Tukey’s honestly significant difference (HSD) test was performed for multiple comparisons at a significance level set of p < 0.05.

RESULTS

Figure 6. Immunofluorescent staining of nestin (red) and βIII (green) expressed in cells cultured for 4 days on the substrate with surfaceanchored (A) EGF-His, (B) EGF-E5-His, (C) EGF-K5-His, and (D) dEGF-His. Bars: 100 µm.

(ECL plus, GE Healthcare). The intensity of protein bands was determined using Image J software. The data are shown as mean plus/minus standard deviation for three independent experiments. Statistical Analysis. The results of cell proliferation, immunostaining of nestin and βIII, and Western blotting were

Characterization of Chimeric Proteins. As shown in Figure 2A, purified EGF-K5-His, EGF-E5-His, and EGF-His gave single bands in SDS-PAGE analysis. The molecular weights estimated from the mobility of protein bands are 7.1 kDa for EGF-His, 14.8 kDa for EGF-K5-His, and 15.6 kDa for EGFE5-His. These molecular weights are nearly in agreement with those estimated from their amino acid compositions. However, a slight difference is seen between EGF-E5-His and EGF-K5His, though these proteins are expected to have similar molecular weights. This is probably due to the acidic nature of EGF-E5His that has the low capacity of SDS binding and hence exhibits reduced mobility in SDS-PAGE. Figure 2B shows the result of native PAGE analysis carried out for the mixture of EGF-K5-His and EGF-E5-His at various compositions. Lanes 1 and 7 represent results for pure EGFK5-His and EGF-E5-His, respectively. When the mixtures of these proteins were analyzed (Figure 2B, lanes 2-6), new bands appeared at the position between the bands of EGF-K5-His and EGF-E5-His, associated with a decrease in band intensity for both EGF-K5-His and EGF-E5-His. This result suggests the


Figure 7. (A) The result of Western blot analysis for the phosphorylated EGFR and total EGFR. Lysates were prepared from cells cultured for 2 days on the substrate with surface-anchored chimeric proteins. N.C.: Negative control. Cells were cultured for 1 day in serum-free base medium without EGF-His. P.C.: Positive control. Cells were cultured for 1 day in serum-free base medium in the absence of EGF-His and then stimulated for 15 min with 1 µg/mL EGF-His. Data shown are representative of three independent experiments. (B,C) Quantative evaluation for the band intensity of (B) total EGFR and (C) pY1068EGFR. The data are expressed as mean ( standard deviation (n ) 3). The asterisk indicated the statistical significance (Tukey’s HSD test, p < 0.05) compared to other EGF-containing chimeric proteins.

formation of heterodimer, dEGF-His. A single, most intense band was visualized in lane 5 where the equimolar mixture of these proteins was electrophoresced. This result indicates the spontaneous and stoichiometric heterodimerization of EGF-K5His and EGF-E5-His. However, the intensity of the dEGF-His bands appear to be higher than that expected from the mixing ratios and the band intensities of single components, EGF-K5His and EGF-E5-His. This is probably due to enhancement of band intensity by dimer formation as shown in Supporting Information Figures S1 and S2. Dimerization of Chimeric Proteins. Figure 2C shows the CD spectra recorded for EGF-containing chimeric proteins. The CD spectrum of EGF-His exhibited a small negative cotton effect around 216 nm, indicating the existence of β-strands (26). This is explained well from the fact that native EGF consists of 41% β-strands other than loops and random coils (no R-helical segments) (27). The spectrum of EGF-His is similar to that of native EGF (Supporting Information Figure S4) (27). In the spectrum of EGF-E5-His, a negative Cotton effect is additionally observed at 198 nm. This is indicative of random coil structure present in EGF-E5-His. Our observation that, as described earlier, this protein exhibited EGF bioactivity (Figure 3) suggested the proper secondary structure of the EGF domain. Thus, the random coil structure is presumably attributed to the E5 peptide. On the other hand, EGF-K5-His obviously exhibited a negative Cotton effect at 222 nm, representing R-helical structure due to the K5 peptide. The mixture of EGF-E5-His with EGF-K5-His displayed stronger dichroism at 208 and 222 nm and reduced absorption at 198 nm. This result suggests that


heterodimerization, as detected by native PAGE (Figure 2B), is ascribed to the coiled-coil association between E5 and K5 peptides. CD analysis was additionally carried out for R-helical segments alone and in a mixture with wild-type EGF, EGFE5-His, or EGF-K5-His. These analyses were carried out with the tandem form of E5 [(KELASVE)10, E10], because we failed to prepare E5 and K5 peptides in sufficient quantities for CD analysis, probably due to degradation of the short peptides during their expression in and purification from E. coli. The tandem form of K5 [(EKLASVK)10] was also prepared but could not be used because of its poor solubility. As shown in Supporting Information Figures S4-S7, no detectable intermolecular and intramolecular interactions of the helical peptide operated with the EGF and His segments. The data further suggested self-associations of the helical peptides, associated with strong negative Cotton effect at 222 nm. Biological Activity of Chimeric Proteins. Figure 3 shows the results of proliferation assays for the chimeric proteins. Cells proliferated approximately 5-fold during 96 h in the presence of chimeric proteins with no significant differences between conditions. The observed growth rates were similar to that for neurosphere-forming cells cultured in base medium containing rhEGF. This result suggests that the EGF domain contained in chimeric proteins holds biological activity without any perturbation of the His peptide. As shown in Table 2, when chimeric proteins were dissolved in a medium, their molecular architectures had minor effects on the differentiation of neurosphereforming cells. Surface Immobilization of Chimeric Proteins. The monomeric and dimeric forms of the chimeric proteins were coordinated to the Ni(II)-fixed surfaces. These processes were monitored by surface plasmon resonance analysis (3). As shown in Figure 4, all the chimeric proteins gave a similar angular sift corresponding to the surface density of ca. 0.32-0.35 µg/cm2. This result implies that, on a molar basis, the surface density of an EGF domain on the EGF-His-immobilized substrate is approximately 1.5-fold higher than that on the substrates with immobilized EGF-K5-His, EGF-E5-His, and dEGF-His. Adhesion, Extension, and Proliferation of NSCs. Supporting Information Figure S8 shows the phase-contrast microphotographs of cells cultured on the substrates with different chimeric proteins. The morphology of cells on the surface with EGF-His is similar to that observed in our previous studies (3-5). On this surface, cells proliferated and extended neurites. In comparison with the substrate with EGF-His, a slightly increased number of cells initially adhered on the substrates with EGFK5-His and EGF-E5-His, and the larger number of cells are seen at the same time points. These trends are much more notable on the substrate with surface-anchored dEGF-His. In particular, cell confluency on the substrate with dEGF-His at 48 h (Figure 5A) is similar to that on the EGF-His-anchored substrate at 96 h. Figure 5B shows the growth curves for cells cultured on the substrates with different chimeric proteins. The cell number increased 30-fold on the substrate with EGF-His during the initial 96 h, being in good accordance with our previous results (4). On the other hand, cells on the substrates with EGF-K5His, EGF-E5-His, and dEGF-His were expanded, respectively, 42-, 45-, and 60-fold for 96 h. As shown in Figure 5B, the apparent doubling time is shorter in the case of EGF-E5-His and EGF-K5-His than EGF-His, and much more shortened in the case of dEGF-His (approximately half of the case with EGFHis). Selective Expansion of NSCs. Figure 6 shows the result of immunofluorescent staining of cells cultured for 4 days on the substrates with surface-anchored chimeric proteins.



Figure 8. Schematic representation for EGF-containing chimeric proteins anchored to the Ni-chelated surface through coordination. Bold lines in the molecular formula represent chelate bonding. TEG-thiol: triethylene glycol-containing alkanethiol.

On all of the substrates studied here, the majority of cells expressed a neural stem cell marker, nestin (visualized in red), while few cells expressed a neuronal marker, βIII (visualized in green). These results indicate that neural stem cells were selectively proliferated on the substrates with surface-anchored chimeric proteins. However, as shown in Table 2, the fraction of nestin-expressing stem cells is varied depending on the type of chimeric proteins: The fraction of stem cells is significantly higher on the substrate with EGFE5-His and EGF-K5-His than EGF-His. The highest fraction is seen on the substrate with dEGF-His among the substrates studied, although there was no statistical difference between the substrates with dEGF-His and EGF-E5-His. EGFR Signaling. EGFR is a member of tyrosine kinase receptors and phosphorylated upon ligand binding to activate an intracellular signaling cascade (11). To analyze the phosphorylation of EGFR by Western blotting, we used antibodies against the phosphorylated form of EGFR (specific for pY1068EGFR) and total EGFR (specific for both phosphorylated and nonphosphorylated forms). The results are shown in Figure 7A. Neurosphere-forming cells were starved for 24 h in growth factor free base medium and then treated with 1 µg/mL EGF for 15 min before lysis as a positive control. Cells just starved in the absence of EGF were used as a negative control. Total EGFR was detected to a similar extent in negative and positive control cells, whereas pY1068-EGFR was detected exclusively for the cells treated with EGF. In the case of cells cultured for 2 days on the substrates with surface-anchored chimeric proteins, strong bands of pY1068-EGFR are seen for all of the substrates, indicating the occurrence of receptor phosphorylation. The band intensities determined for total EGFR and pY1068-EGFR are shown in Figure 7B and C. As can be seen in Figure 7B, the level of EGFR expression was almost similar between substrates. In contrast, EGFR was most efficiently phosphorylated on the substrate with anchored dEGF-His (Figure 7C). The differences

in the level of phosphorylation are statistically insignificant among the substrates with EGF-His, EGF-E5-His, and EGFK5-His.

DISCUSSION The E5 and K5 peptides were designed to create an R-helical coiled-coil structure stable under the physiological conditions. The coiled-coil structure is stabilized by hydrophobic effects operated between L and V at the core region of the associating chains (12, 13). We incorporated these peptides separately into EGF-His. Analyses by native PAGE (Figure 2B) and CD spectroscopy (Figure 2C) revealed that spontaneous coiled-coil association takes place to form a heterodimer consisting of EGFE5-His and EGF-K5-His. In CD spectroscopic analysis (Figure 2C), disordered structure was suggested for the E5 peptide contained in monomeric EGF-His. R-Helical structure is induced in the E5 peptide when associated with EGF-K5-His (Figure 2C). According to these findings, the structure of the chimeric proteins at the surface may be schematically represented as in Figure 8. On the surface with fixed Ni(II) ions, the His-containing EGF chimeric proteins are expected to be anchored through coordinate bonding, exposing the EGF domain toward outer environment. Our previous study using the monomeric form of EGF-His (3-5) demonstrated the structural integrity of surfaceanchored EGF-His. In addition, it was shown that stable anchoring is necessary to establish adherent culture of NSCs (5). These effects are important for both the selective capture of EGFR-expressing NSCs on the surface and the efficient EGFR signaling leading to the active proliferation of captured cells (6-8). In spite of the lower surface density of an EGF domain with dEGF-His, EGF-K5-His, and EGF-E5-His compared with EGFHis, the adhesion and proliferation of cells were most prominent on the surface with anchored dEGF-His. It is likely that, on the substrate with dEGF-His, the dimerized form of EGF efficiently facilitates dimerization of EGFR, transducing intracellular


signaling for mitogenic activity (Figure 7), associated with reduced doubling time (Figure 5B). Therefore, it appears that the highest purity of NSCs obtained on the substrate with surface-anchored dEGF-His is attributed to both efficient signaling in and rapid growth of NSCs. Moreover, the adhesion and proliferation of cells were also promoted on the surfaces with anchored EGF-K5-His and EGF-E5-His (Figure 5A,B) compared to the surface with EGF-His. These results suggest that the E5 and K5 peptides inserted between the EGF domain and the His sequence function as a flexible linker. Interestingly, the molecular architecture of chimeric proteins has an effect on the proliferation and differentiation of neurosphere-forming cells only when the chimeric proteins are anchored at the surface, but not when dissolved in solution (Figures 3 and 5B, and Table 2). It is considered that EGFR signaling is activated by dimerization of EGF-EGFR complexes (11). In the case of surfaceanchored monomeric EGF-His, the probability of receptor dimerization seems to be limited because of the reduced mobility of surface-anchored EGF. In the case of EGF anchored to the surface as a dimer, such a constraint may not affect receptor dimerization because two EGF domains are always located in close proximity to each other. Conceivably, this is the reason for the most efficient proliferation of NSCs observed on the surface with dEGF-His (Figure 6). Our estimation suggests that the distance between two EGF domains in the dimer form is approximately comparable to the span of two binding sites in dimerized EGFR (28). The results in which both EGF-E5-His and EGF-K5-His were surface-anchored as a single component also provided more efficient substrates than EGF-His does (Figures 5A,B and 6). This can also be explained from the mobility of the EGF domain enhanced by E5 and K5 peptides inserted between the EGF domain and the His sequence. Interestingly, the effects of these peptides are not noticeable when chimeric proteins are used as diffusible factors (Figures 3 and 5B). Accordingly, the selective expansion of NSCs can be most efficiently achieved on the substrate with surface-anchored dEGF-His. On this substrate, cells are expanded 60-fold during 96 h of culture. It is important to note that more than 98% of the expanded cells express a stem cell marker, nestin, with no expression of a neuronal marker, βIII. These specifications are in large contrast to those with the standard neurosphere culture by which cells proliferate 6-fold for 96 h (Figure 3) to produce a heterogeneous population containing 60% of nestin-expressing cells (3).

CONCLUSION By means of recombinant DNA technology, EGF was engineered to carry an R-helical peptide and a hexahistidine sequence. The chimeric proteins, EGF-E5-His and EGF-K5His, spontaneously form a heterodimer, dEGF-His. NSCs proliferate most rapidly and selectively on the substrate with surface-anchored dEGF-His, compared to the other substrates with monomeric EGF. This effect may be attributed to the enhanced dimerization of EGF-EGFR complexes at the cell-substrate interface. The rate of cell proliferation on this surface is far beyond those on our conventional substrate with monomeric EGF-His, as well as those in the standard neurosphere culture. In conjunction with the capability of highly selective expansion of NSCs, it follows that the dEGF-Hisimmobilized substrate allows the most efficient preparation of NSCs. For the clinical application of our technology, further feasibility study is needed with human NSCs.

ACKNOWLEDGMENT The part of this study was supported by Grant-in-Aid for Scientific Research (19300171,19 · 6117), MEXT, and a grant


of Long-Range Research Initiative from the Japan Chemical Industry Association. T. N.-H. acknowledges JSPS for a research fellowship. Supporting Information Available: Conditions of dialysis, the results of native PAGE, CD spectra and the related experimental procedures, and phase-contrast images of cells. This material is available free of charge via the Internet at http:// pubs.acs.org.

LITERATURE CITED (1) Kim, S. U. (2004) Human neural stem cells genetically modified for brain repair in neurological disorder. Neuropathology 24, 159–171. (2) Goldman, S. (2005) Stem and progenitor cell-based therapy of the human central nervous system. Nat. Biotechnol. 23, 862– 871. (3) Nakaji-Hirabayashi, T., Kato, K., Arima, Y., and Iwata, H. (2007) Oriented immobilization of epidermal growth factor onto culture substrates for the selective expansion of neural stem cells. Biomaterials 28, 3517–3529. (4) Kato, K., Sato, H., and Iwata, H. (2005) Immobilization of histidine-tagged recombinant proteins onto micropatterned surfaces for cell-based functional assays. Langmuir 21, 7071–7075. (5) Nakaji-Hirabayashi, T., Kato, K., and Iwata, H. (2008) Essential role of structural integrity and firm attachment of surfaceanchored epidermal growth factor in adherent culture of neural stem cells. Biomaterials 29, 4403–4408. (6) Ogiwara, K., Nagaoka, M., Cho, C. S., and Akaike, T. (2005) Construction of a novel extracellular matrix using a new genetically engineered epidermal growth factor fused to IgGFc. Biotechnol. Lett. 27, 1633–1637. (7) Ogiwara, K., Nagaoka, M., Cho, C. S., and Akaike, T. (2006) Effect of photo-immobilization of epidermal growth factor on the cellular behaviors. Biochem. Biophys. Res. Commun. 345, 255–259. (8) Nagaoka, M., Ise, H., Harada, I., Koshimizu, U., Maruyama, A., and Akaike, T. (2008) Embryonic undifferentiated cells show scattering activity on a surface coated with immobilized Ecadherin. J. Cell. Biochem. 103, 296–310. (9) Reynolds, B. A., Tetzlaff, W., and Weiss, S. A. (1992) A multipotent EGF-responsive striatal embryonic progenitor cell produces neurons and astrocytes. J. Neurosci. 12, 4565–4574. (10) Caldwell, M. A., He, X., Wilkie, N., Pollack, S., Marshall, G., Wafford, K. A., and Svendsen, C. N. (2001) Growth factors regurate the survival and fate of cells derived from human neurospheres. Nat. Biotechnol. 19, 475–479. (11) Ullrich, A., and Schlessinger, J. (1990) Signal transduction by receptors with tyrosine kinase activity. Cell 61, 203–212. (12) McLachlan, A. D., and Stewart, M. (1975) Tropomyosin coiled-coil interactions: Evidence for an unstaggered structure. J. Mol. Biol. 98, 293–304. (13) Tripet, B., Wagschal, K., Lavigne, P., Mant, C. T., and Hodges, R. S. (2000) Effects of side-chain characteristics on stability and oligomerization state of a de noVo-designed model coiled-coil: 20 Amino acid substitutions in position “d”. J. Mol. Biol. 300, 377–402. (14) Meyers, M. A., Chen, P.-Y., Lin, A. Y.-M., and Seki, Y. (2008) Biological materials: Structure and mechanical properties. Prog. Mater. Sci. 53, 1–206. (15) Wang, C., Stewart, R. J., and Kopecˇek, J. (1999) Hybrid hydrogels assembled from synthetic polymers and coiled-coil protein domains. Nature 397, 417–420. (16) Petka, W. A., Harden, J. L., McGrath, K. P., Wirtz, D., and Tirrell, D. A. (1998) Reversible hydrogels from self-assembling artificial proteins. Science 281, 389–392. (17) Mi, L., Fischer, S., Chung, B., Sundelacruz, S., and Harden, J. L. (2006) Self-assembling protein hydrogels with modular integrin binding domains. Biomacromolecules 7, 38–47.

110 Bioconjugate Chem., Vol. 20, No. 1, 2009 (18) Fujita, Y., Funabashi, H., Mie, M., and Kobatake, E. (2007) Design of a thermocontrollable protein complex. Bioconjugate Chem. 18, 1619–1624. (19) Nakaji-Hirabayashi, T., Kato, K., and Iwata, H. (2008) Selfassembling chimeric protein for the construction of biodegradable hydrogels capable of interaction with integrins expressed on neural stem/progenitor cells. Biomacromolecules 9, 1411– 1416. (20) Rose, G. D., Gierasch, L. M., and Smith, J. A. (1985) Turns in peptides and proteins. AdV. Protein Chem. 37, 1–109. (21) Leszczynsky, J. F., and Rose, G. D. (1986) Loops in globular proteins: a novel category of secondary structure. Science 234, 849–855. (22) Pachuk, C. J., Samuel, M., Zurawski, J. A., Snyder, L., Phillips, P., and Satishchandran, C. (2000) Chain reaction cloning: a one-step method for directional ligation of multiple DNA fragments. Gene 243, 19–25. (23) Nakaji-Hirabayashi, T., Kato, K., Arima, Y., and Iwata, H. (2008) Multifunctional chimeric proteins for the sequential regulation of neural stem cell differentiation. Bioconjugate Chem. 19, 516–524.

Nakaji-Hirabayashi et al. (24) Hirata, I., Morimoto, Y., Murakami, Y., Iwata, H., Kitano, E., Kitamura, H., and Ikada, Y. (2000) Study of complement activation on well-defined surface using surface plasmon resonance. Colloids Surf., B: Biointerfaces 18, 285–292. (25) Knoll, W. (1991) Polymer thin films and interfaces characterized with evanescent light. Makromol. Chem. 192, 2827–2856. (26) Kelly, S. M., Jess, T. J., and Price, N. C. (2005) How to study proteins by circular dichroism. Biochem. Biophys. Acta 1751, 119–139. (27) Prestrelski, S. J., Arakawa, T., Wu, C.-S. C., O’Neal, K. D., Westcott, K. R., and Narhi, L. O. (1992) Solution structure and dynamics of epidermal growth factor and transforming growth factor R. J. Biol. Chem. 267, 319–322. (28) Ogiso, H., Ishitani, R., Nureki, O., Fukai, S., Yamanaka, M., Kim, J.-H., Saito, K., Sakamoto, A., Inoue, M., Shirouzu, M., and Yokoyama, S. (2002) Crystal structure of the complex of human epidermal growth factor and receptor extracellular domains. Cell 110, 775–787. BC800331T

Surface-Anchoring of Spontaneously Dimerized Epidermal Growth

Recommend Documents