Synthesis of Recombinant Mouse Crystallin Proteins and in Vitro

Feb 16, 2017 - recombinant mouse Crystallin proteins produced in Escherichia ... KEYWORDS: eye lens crystallin, refractive index, refractivity, induce...
0 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/journal/abseba

Synthesis of Recombinant Mouse Crystallin Proteins and in Vitro Measurement of Their Refractivity Akiho Furuyama,† Chiyuki Matsushima,‡ Takahiro Yokoi,‡ Mitsuyoshi Ueda,‡ and Eiichi Tamiya*,† †

Department of Applied Physics, Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871, Japan Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa Oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan

‡

ABSTRACT: The eye lens is an organ that focuses light onto the retina and is reported to have a high refractive index in vertebrates. An analysis of refractivity was conducted using recombinant mouse Crystallin proteins produced in Escherichia coli (E. coli) compared with bovine serum albumin (BSA) and other commercially available proteins. Not only did we measure the refractivity but for one of the crystallins, Cryba1, we also confirmed that it responds uniquely to its environmental conditions. The crystallin showed high refractivity, as expected, and we confirmed that the electrical charge of the Cryba1 molecule influences its refractivity. KEYWORDS: eye lens crystallin, refractive index, refractivity, induced dipole, Greek-key motif

■

INTRODUCTION

ible materials that handle photons and electrons for signal translation and transportation are still awaited. For detecting elements for chemical detection, a number of antibodies and enzymes have been examined, taking advantage of their molecular recognition ability.6−8 Those detecting systems are usually highly sensitive at the molecular level but cannot collect actual signals. Accordingly, mediators are coupled with each protein, thus allowing us to detect the molecular recognition as signals.9−11 However, signals from such mediators, for example fluorescent,9,10,12,13 are still weak at the single molecular level, so that enhancing technology such as use of quantum dots (QDs) is being eagerly explored to realize detection at low chemical concentration.10,12,13 Once a standard method to enhance detected signals is established, the antibodies and enzymes can reasonably be applied as highly sensitive detecting elements in biosensors.9,13,14 Although establishment of detecting elements, mediators, and signal enhancing elements in biosensors antecedent, matrixes to support such elements and signal transportation, is still at the beginning of the development.15−17 Most of the efforts for its development are made to utilize hydrophilic non-natural material and we do not know research that developed protein-based matrix material. The eye is an organ with sensitivity to light that translates light signals into nerve signals. This translation is performed on the retina, where retinal light excitation is coordinated with conformational changes in rhodopsin, a G protein-coupled receptor (GPCR), on the retina. Rhodopsin is thought to be a potential candidate for detecting element for metal-ion

Proteins as functional molecules are considered promising candidates for life sciences and biomedical applications, and researches that utilize their chemical property-based functions, such as enzymatic activity, molecular recognition, and switching, is eagerly being conducted. Whereas many researches include biochemical detections and pharmaceutical uses, our research aimed to utilize the physical properties of structural proteins. Structural proteins such as spider web proteins and virus capsid proteins are now being recognized as good candidates for functional biomaterials because of their astonishing mechanical and structural properties and research is being conducted to reveal the mechanisms of mechanical and structural properties. Silk proteins and spider web proteins possess enormous mechanical strength in their direction of length, and researchers have recently reproduced their mechanical strength via biomimicry.1−3 Proteins constructing virus capsids are known to act as blocks to assemble polyhedral protein complexes, and the mechanism of the complex formation to utilize the capsid as nano carrier4,5 has been attracting attention. Whereas research to understand the mechanical strength and mechanisms of protein complex formation is eagerly conducted, we aimed at understanding and reproducing not the mechanical or structural properties but the optical and electrical properties of proteins that are still in their dawn. Our aim is to provide protein-based materials with unique optical properties. We expect that such materials can provide solutions for biosensing technologies. For biosensors, in which biosignals are detected and translated into optical or electrical signals to be transported to analytical devices, detecting elements are eagerly explored. But development of biocompat© 2017 American Chemical Society

Received: September 30, 2016 Accepted: February 15, 2017 Published: February 16, 2017 502

DOI: 10.1021/acsbiomaterials.6b00605 ACS Biomater. Sci. Eng. 2017, 3, 502−508

Article

ACS Biomaterials Science & Engineering Table 1. Primers Used in Cloning Crystallin Genes primer name

5′-3′

pET-41a(+)F pET-41a(+)R FLAG-Crybal F FLAG-Crybal R Crybal(238−253)F Crybal(418−406)R FLAG-Crybb2 F FLAG-Crybb2 R Crybb2(194−209) F Crybb2(418−402) R FLAG-Cryge F FLAG-Cryge R Cryge(257−273) F Cryge(273−257) R

TAATACCTAGGCTGCTAAACAAAGCC CTTGTCGTCGTCGTCTTTATAATCCATATGTATATCTCCTTCTTAAAGTTAAACAAAATTATT AAAGACGACGACGACAAGGAGACCCAGACTGTGCAGC TGTTTAGCAGCCTAGGTATTATTGTATTCGGCGAATTGATTGGATC GCTTCTGTGGGCAAC CCGACTGGCGTCC AAAGACGACGACGACAAGGCCTCAGACCACCAGACACA TGTTTAGCAGCCTAGGTATTAGCTGGAGGGGTGGAAGG CTAATTGCAAGGGCGA TTTCCTGGTATCCATGG AAAGACGACGACGACAAGGGGAAGATCACCTTCTATGAGGAC TGTTTAGCAGCCTAGGTATTAATAGAAATCCATGATTCTCCTCAGAGAGC GTTCTCACAGGATCAAG CTTGATCCTGTGAGAAC

sensing,18,19 but was not the first choice for matrix material considering its structural feature as a GPCR. The eye lens, which is an organ that focuses light onto the retina, is transparent with a high refractivity and consists of proteins called crystallins, which take up more than 50 wt %.20 From a prediction of the protein refractive increment based on the amino acid composition, eye lens crystallins are expected to have high refractivity21 and drew our attention as basal of protein-based matrix materials supporting each elements and transporting the optical signals. Since the 1980s, studies have measured the refractive indices of the eye lens in organs acquired from the eyes of animals.22 In the early 2000s, proteomic analyses of eye lenses were reported using mass spectrometry and 2D-PAGE,23,24 thus revealing the composition of types of crystallins within the eye lens. Many studies have been reported regarding eye lens and crystallins, but the motivations for those studies was to reveal the mechanism of cataracts or to understand the unique differentiation mechanism of the eye lens as an organ.25 Our approach is to reveal the mechanism of physical property presentation in the eye lens or crystallins, aiming at the utilization of the proteins as materials which similar research results have not yet been reported. In addition, the surprisingly high refractivity of the eye lens, which, in the mouse, presents as a refractive index as high as n = 1.66,26 pushed us forward to select eye lens proteins as our target protein, in anticipation of their future potential as protein materials. The eye lens consists mainly of proteins called crystallins and water,27 and the concentration of proteins can be up to 600 mg/mL.20 The compositional breakdown of crystallins in the adult mouse eye lens is as follows: α-crystallins, 27%; βcrystallins, 31%; and γ-crystallins, 19%.23 α-Crystallins act as chaperones that stabilize β- and γ-crystallins from thermal aggregation and are highly homologous to small heat shock protein.28 Crystallins were initially thought to have evolved as eye lens proteins, but previous studies found that crystallins were recruited from proteins that had already existed before their evolution.29 Therefore, not only α-crystallins, but also βand γ-crystallins reasonably possess functions other than those of eye lens proteins, and recent research has come to reveal some of these mysteries.29−31 Thus, the eye lens comprised derivative proteins of such recruited proteins to best realize the favored property, such as refractivity, transparency, stability, concentration, and others.

Why is the eye lens so highly refractive? The high refractivity is a requisite to efficiently focus light onto retina and the high protein concentration in the eye lens certainly is presumed to contribute to realize the refractivity. However, via calculational prediction, previous research has proposed that the high refractivity of the eye lens is due to not only the concentration but also to the refractivity of the Crystallin proteins themselves.21 Verifying this reported result and revealing the mechanism how proteins present high refractivity apart from its concentration would provide a foothold for utilizing Crystallin as a biocompatible optical material. Another advantage to exploiting crystallins as a protein-based material is their expected stability, both temporally and thermodynamically. The eye lenses of vertebrates and invertebrates are formed from fiber cells at the early stage of their growth;25 once they are matured, the composition inside the eye lens does not change for the rest of the animal’s lifetime.24 The stability of the crystallin proteins alone is not yet proven, but it is a natural coincidence that crystallin proteins are stable, which may allow their application as an optical material. Here, we report the in vitro measurements of the refractivity of recombinant mouse crystallins compared with reference proteins (β-casein, trypsinogen, and bovine serum albumin (BSA)). We then hypothesize that the relevance of the crystallin conformation and its refractivity can be validated by the results.

■

EXPERIMENTAL SECTION

Materials and Methods. Strains and Media. The Escherichia coli (E. coli) strain DH5α [F‑, ΔlacU169 (φ80lacZΔM15), hsdR17(rK‑, mK+), recAl, endA1, deoR, thi-1, supE44, gyrA96, relA1, λ‑] (TOYOBO, Osaka, Osaka Japan) was used as a host for DNA manipulation. The E. coli strain BL21 (DE3) [F‑, ompT, hsdS(rB‑, mB‑), dcm+, Tetr, gal, λ(DE3), endA, The, [argU, proL, Camr]] (Agilent Technologies, Santa Clara, CA USA) was used as a host for protein production. All transformants were grown in Luria−Bertani media [1% (w/v) tryptone, 0.5% (w/v) yeast extract, and 1% (w/v) sodium chloride] containing 10 μg/mL kanamycin (LBK medium). Construction of Plasmids Encoding Mutant βA1-, βB2-, and γECrystallin Genes (cryba1, crybb2, and cryge, Respectively). All primers used in this paper are listed in Table 1. DNA fragments encoding cryba1, crybb2, and cryge genes were cloned from mouse eye cDNA (Zyagen, San Diego, CA USA) and were inserted into pET41a(+) plasmid (EMD Chemicals Novagen Brand, Madison, WI USA) using an In-Fusion HD Cloning Kit (Clontech Laboratories, Mountain View, CA USA). The constructed recombinant genes were composed of the T7 RNA polymerase sequence, the Crystallin gene, and a 503

DOI: 10.1021/acsbiomaterials.6b00605 ACS Biomater. Sci. Eng. 2017, 3, 502−508

Article

ACS Biomaterials Science & Engineering FLAG-tag encoding sequence, eliminating the multiple cloning sites, GST-tag, S-tag, and HIS-tag encoding sequences that were originally installed in pET-41a(+). The DNA sequences were confirmed on a 310 Genetic Analyzer using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA USA). The resulting plasmids were named pET-41a(+)-FLAG-Cryba1, -Crybb2, and -Cryge, respectively. Production and Purification of FLAG-tagged βA1-, βB2- ,and γECrystallin (FLAG-Cryba1, FLAG-Crybb2, and FLAG-Cryge, Respectively). pET-41a(+)-FLAG-Cryba1 was transformed into BL21 (DE3), and the transformant was precultivated in LBK medium for 14 h at 37 °C under shaking conditions. At OD600 = 0.5, the culture solution was subcultivated to LBK medium, and at OD600 = 0.5, isopropyl β-D-1thiogalactopyranoside was added for a final concentration of 1 mM. The shaking cultivation was continued for another 48 h at 30 °C. The E. coli cells were harvested by centrifugation and washed with TBS (pH 7.4) twice. Then, 10 mL of TBS buffer was added per 1 g of the cell pellet, and the cell was resuspended in the TBS buffer. The cells were crushed using Nanoruptor (Toshodenki, Yokohama, Kanagawa Japan), a homogenizer (30 s × 4 times, with 30 s intervals at 0 °C). After centrifugation, the supernatant containing the produced FLAG-Cryba1 (cell lysate) was decanted into a fresh container. The Anti-FLAG M2 Affinity Gel (SIGMA-Aldrich, St. Louis, MO USA): 2 vol % of the lysate was properly prepared according to the technical bulletin and added to the lysate acquired above. The mixture was rotated at 4 °C for 1 h and washed with TBS three times to remove nonspecific proteins. FLAG-Cryba1 was eluted from the gel using 0.1 M glycine HCl, pH 3.5, and 10 vol % of 0.5 M Tris HCl with 1.5 M NaCl (pH 7.4) was added to neutralize the extract. The extract was concentrated and replaced with 0.1 x PBS (Nippon Gene, Tokyo, Japan) with a Ultracel YM-10 filter Unit (EMD Millipore, Billerica, MA USA). The concentration was deduced from 285 nm UV absorbance (A285) measured using a NanoDrop 1000 (Thermo Fisher Scentific, Waltham, MA USA) and calculated extinction coefficient.32 The same procedure was applied for FLAG-Crybb2 and FLAG-Cryge. SDS-PAGE, CBB Staining, and Western Blotting. The purified FLAG-Cryba1, FLAG-Crybb2, and FLAG-Cryge proteins were separated by SDS-PAGE in a 5−20% gradient polyacrylamide gel. The protein bands were detected with CBB staining (CBB Stain One, Nacalai Tesque, Kyoto, Kyoto Japan) and Western blotting applying anti-Flag M2Monoclonal antibody-peroxidase conjugate (SIGMAAldrich) and a subsequent chemical luminescent reaction using ECL Western blotting detection reagents (GE Healthcare, Little Chalfont, Buckinghamshire UK). Circular Dichroism (CD) Spectrum. The CD spectra were measured using a spectropolarimeter (J720, Jasco, Tokyo, Japan). The fresh purified FLAG-Crystallin solutions were measured at room temperature. Spectra in the far-UV region (190−240 nm) were collected using a 1 mm quartz cell and averaged over 10 scans. Native-PAGE. The purified FLAG-Cryba1, FLAG-Crybb2, and FLAG-Cryge were separated by Blue Native PAGE in a 5−20% gradient polyacrylamide gel at pH 7.4. Refractive Index. The refractive indices of solutions were measured using a refractometer (RX-5000α, ATAGO, Tokyo, Japan). First, 100 μL of the solution was applied to the detecting glass surface controlled at 25 °C, and the measurement was carried out. Data were collected three times, averaged, and rounded up to the nearest ten thousandth.

efficiently. We harvested the E. coli and then crushed and purified it with anti-FLAG affinity gel to obtain FLAG-tagged crystallin proteins, as shown in Figure 1.

Figure 1. SDS-PAGE result of purified FLAG-tagged crystallins produced in E. coli; (a) CBB-staining and (b) Western blotting show anti-FLAG affinity gel chromatography efficiently isolated the purified proteins.

To determine whether the recombinant crystallins produced in E. coli folded appropriately such that they possessed reasonable structural characteristics, we measured the CD spectra to gather secondary structural information on the obtained recombinant proteins. We then applied native-PAGE to understand their state of assembly. According to previous X-ray crystallographic analysis,33 bovine βB2-crystallin, which has 98.5% genetic homology to the mouse βB2-Crystallin (herein, Crybb2), consists mainly of beta-strands and the protein molecules are likely to form tetramers. From the results shown in Figure 2, we considered this sufficiently convincing evidence to support the idea that all three recombinant crystallins possess reasonable structures (FLAG-Cryba1, homotetramer; FLAG-Crybb2, homotetramer; and FLAG-Cryge, homooctamer) to further discuss the optical properties of Crystallin proteins as candidates for protein-based materials. Refractive Indices of FLAG-Tagged Crystallins and Reference Proteins. Previous research indicated that the eye lens is one of the organs that show a remarkably high refractive index. We had two initial hypotheses to explain this characteristic: (1) the high refractive index is dependent simply on the concentration of proteins in the eye lens, which is extremely high (600 g/mL) compared to that of other localized protein under natural conditions; and (2) the crystallin proteins themselves show high refractivity either/both residue- and structure-wise. To confirm the peculiarity of crystallin proteins and verify the hypotheses, we measured the refractive increments (RIs) of FLAG-tagged crystallins and reference proteins under neutral conditions using a refractometer (see Table 2). From this result, we understand that FLAG-crystallins are indeed highly refractive compared to the reference proteins and that among these crystallins, FLAG-Cryba1 is the most highly refractive. Furthermore, the high refractivity of the eye lens is due not only to the high concentration of the proteins but also to the residual and structural aspects of the proteins themselves. Residual Effect on Protein Refractivity. In the 1960s, it was reported that each molecular residue within the amino acid sequence of a protein has different contributions to the refractivity of the protein and that the refractivity of a protein

■

RESULTS AND DISCUSSIONS Expression and Purification of Mouse Crystallins in E. coli. Cryba1, crybb2, and cryge were expressed in E. coli BL21(DE3) harboring the plasmid pET-41a(+)-FLAG-Cryba1, -Crybb2, and -Cryge, which were designed to produce respective Crystallin proteins with a FLAG peptide sequence at the N-terminus (FLAG-Cryba1, FLAG-Crybb2, and FLAGCryge, respectively). We cultivated the E. coli in LB medium with kanamycin and IPTG induction at the early stage of cultivation such that it would produce the target proteins 504

DOI: 10.1021/acsbiomaterials.6b00605 ACS Biomater. Sci. Eng. 2017, 3, 502−508

Article

ACS Biomaterials Science & Engineering

Figure 2. (a) CD spectra of the recombinant crystallins showing beta-strands as their major secondary structures. (b) 1, 2, and 3 indicate FLAGCryba1, FLAG-Crybb2, and FLAG-Cryge, respectively; the location where monomers should appear is shown with the box; and the native-PAGE result shows the formation of homooligomers in all three crystallins.

Table 2. Refractive Indices of Recombinant Crystallins (pH 7.6)

FLAGCrybal FLAGCrybb2 FLAG-Cryge β-casein trypsinogen BSA buffer

protein concentration (mg/mL)

refractive index; n (n = 3 average)

RI (mL/g)

3.4

1.3351

0.25

4.5

1.3352

0.21

6.3 5.0 2.0 2.0 0.0

1.3356 1.3350 1.3346 1.3345 1.3342

0.22 0.15 0.17 0.16

Table 3. Measured and Calculated RI of Recombinant Crystallins and References (pH 7.6, n = 3 average) RI (mL/g) FLAG-Crybal FLAG-Crybb2 FLAG-Cryge β-casein trypsinogen BSA buffer

measured

calculated

0.25 0.21 0.22 0.15 0.17 0.16

0.195 0.190 0.198 0.182 0.184 0.187

effect, not amino acid composition, increases the size of the induced dipoles to generate even higher refractivity in crystallin molecules. Comparison of Protein RIs under Different pH Conditions. We selected FLAG-Cryba1, the Crystallin protein with the highest refractivity, as our subject protein and conducted further experiments to observe molecular behaviors. In Figure 2, we showed that FLAG-Cryba1 forms homotetramers. Homology analyses35,36 suggest that FLAG-Cryba1 form two Greek-key motifs as its conformation, which consists of adjacent antiparallel beta-strands with their linking loops and hairpins (Figure 3a, c). It has been reported that human βB2Crystallin also consists of two Greek-key motifs37 and that when it forms a homodimer, one Greek-key motif from the first molecule interacts with the other Greek-key motif of the second molecule. For tetramers, two homodimers overlap by intermolecular interactions between the first and second Greek keys between the homodimers (Figure 4a).33 Homooligomers of other β-crystallins, including Cryba1, are highly homologous to bovine and human βB2-crystallin in that they are expected to possess a similar assembly. We have mentioned that permanent dipoles cancel under conditions where protein molecules can rotate freely, which in the other way around, when proteins cannot rotate, under such condition as network of homooligomers, permanent dipoles cannot be neglected. But Figure 4b shows that when βcrystallins form homotetramers, the permanent dipole cancels

can be calculated as the sum of specific residues divided by its number of amino acids.34 Applying this proposed method, we calculated the estimated RIs of the FLAG-tagged crystallin proteins. The calculated RI values suggest that crystallins contain more amino acids of higher contribution to the RI compared to reference proteins.21 Amino acids of higher contribution to the RI are tryptophan, phenylalanine, and tyrosine, all of which have aromatic rings. However, the measured values of FLAGcrystallins show even higher values than those that we calculated. This finding not only supports the notion that FLAG-crystallins are highly refractive as a result of their amino acids composition, but also suggests that there are structural factors that contribute to the high refractivity of FLAGcrystallins. The refractive index is proportional to the square root of the dielectric constant of the molecules in a sample, which is the sum of induced and permanent dipoles. The number of induced dipoles changes according to the external electric field, which could be either static or an induction field. In conditions under which molecules in solution can rotate freely, the permanent dipole is canceled out, and only induced dipoles affect the refractivity of the solution. The calculated RIs shown in Table 3 are based only on the induced dipoles from each residue, which indicates how easily electrons can deviate within the residue. The result that measured RIs are notably greater than calculated RIs with crystallins suggests that structural 505

DOI: 10.1021/acsbiomaterials.6b00605 ACS Biomater. Sci. Eng. 2017, 3, 502−508

Article

ACS Biomaterials Science & Engineering

Figure 3. (a) Homology analyses of bovine and human βB2-crystallin and Cryba1; secondary structures; asterisks indicate matching amino acids, characters in green indicate beta-strands, and blue indicates hairpins35,36. (b) Reported human βB2-Crystallin and higher-order structures37. (c) Corresponding Greek-key motifs.

as a whole assembly, each Greek key preserves its permanent dipole, which contributes to the state and distance of intermolecular interactions. Most of the interactions between beta-strands are hydrophobic, including π−π stacking, which allows electrons to migrate from one Greek key to another. When the intermolecular interactions are strong and the motifs are closely aligned, the homooligomer presumably induces greater dipoles than a single monomer to increase the refractivity as an assembly. Permanent dipoles are naturally affected by the pH conditions, because permanent dipoles of each Greek key are caused by a deviation of the electric charge in a domain. The isoelectric point (pI) of a protein is where the positive and negative electric charge on amino acid residues become equivalent. In other words, a protein is negatively charged under basic conditions and positively charged under acidic conditions based on the pI. The electric charge of each Greek key is essential for the permanent dipole of the domain such that if the presumption above is reasonable, we should be able to observe refractivity transitions corresponding to the external pH. To validate this hypothesis, we prepared each protein under different pH conditions and measured the refractive indices using a refractometer. The values in Table 4 are reported results38 except for FLAG-Cryba1 and the two Greek keys with asterisks. The pI of the two Greek keys in FLAG-Cryba1 are similar to the electric charge of each domain and can be considered the same.

Figure 4. (a) Homotetramer formation of bovine βB2-crystallin; the reported crystallographic analyses result of bovine βB2-crystallin33. (b) Cancelation of dipole moments with the whole homotetramer shown in the model (arrows indicate permanent dipole moments).

out as a whole oligomer to make consideration of protein network unnecessary. Although the permanent dipole cancels 506

DOI: 10.1021/acsbiomaterials.6b00605 ACS Biomater. Sci. Eng. 2017, 3, 502−508

ACS Biomaterials Science & Engineering

■

Table 4. Isoelectric Point of Proteins under Study

AUTHOR INFORMATION

Corresponding Author

pI FLAG-Cryba1 FLAG-Cryba1 (first Greek key) FLAG-Cryba1 (second Greek key) β-casein trypsinogen BSA

Article

*E-mail: [email protected].

5.94* 6.03* 5.98* 5.13 9.30 4.7−4.9

ORCID

Akiho Furuyama: 0000-0003-2916-3957 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We acknowledge support from the Photonics Center, Osaka University, under the MEXT Photonics Advanced Research Center Program. We also acknowledge Dr. Shinichiro Iwabuchi, Chiba Institute of Science, for preparing the manuscript, and financial support and understanding from Sumitomo Chemical Co. Ltd. at the start of this work. This work was supported by JSPS KAKENHI Grant Number 15H05769.

It is remarkable that the RIs of FLAG-Cryba1 solutions show higher values under acidic conditions but that the RIs of reference proteins did not change according to the pH conditions (see Figure 5). This result indicates that FLAG-

■

REFERENCES

(1) Zhang, Y.-Q. Applications of natural silk protein sericin in biomaterials. Biotechnol. Adv. 2002, 20, 91−100. (2) Hayashi, C. Y.; Lewis, R. V. Molecular Architecture and Evolution of a Modular Spider Silk Protein Gene. Science 2000, 287, 1477−1479. (3) Nova, A.; Keten, S.; Pugno, N. M.; Redaelli, A.; Buehler, M. J. Molecular and Nanostructural Mechanisms of Deformation, Strength and Toughness of Spider Silk Fibrils. Nano Lett. 2010, 10, 2626−2634. (4) Zlotnick, A. To Build a Virus Capsid: An Equilibrium Model of the Self Assembly of Polyhedral Protein Complexes. J. Mol. Biol. 1994, 241 (1), 59−67. (5) Steven, A. C.; Heymann, J. B.; Cheng, N.; Trus, B. L.; Conway, J. F. Virus maturation: dynamics and mechanism of a stabilizing structural transition that leads to infectivity. Curr. Opin. Struct. Biol. 2005, 15 (2), 227−236. (6) Boffi, A.; Favero, G.; Federico, R.; Macone, A.; Antiochia, R.; Tortolini, C.; Sanzó, G.; Mazzei, F. Amine oxidase-based biosensors for spermine and spermidine determination. Anal. Bioanal. Chem. 2015, 407 (4), 1131−1137. (7) Liu, Y.; Matharu, Z.; Howland, M. C.; Revzin, A.; Simonian, A. L. Affinity and enzyme-based biosensors: recent advances and emerging applications in cell analysis and point-of-care testing. Anal. Bioanal. Chem. 2012, 404 (4), 1181−1196. (8) Taylor, R. F.; Marenchic, I. G.; Spencer, R. H. Antibody- and receptor-based biosensors for detection and process control. Anal. Chim. Acta 1991, 249 (1), 67−70. (9) Zhang, G.; Gurtu, V.; Kain, S. R. An enhanced green fluorescent protein allows sensitive detection of gene transfer in mammalian cells. Biochem. Biophys. Res. Commun. 1996, 227 (3), 707−711. (10) Goldman, E. R.; Anderson, G. P.; Tran, P. T.; Mattoussi, H.; Charles, P. T.; Mauro, J. M. Conjugation of luminescent quantum dots with antibodies using an engineered adaptor protein to provide new reagents for fluoroimmunoassays. Anal. Chem. 2002, 74 (4), 841−847. (11) Schuhmann, W.; Ohara, T. J.; Schmidt, H. L.; Heller, A. Electron transfer between glucose oxidase and electrodes via redox mediators bound with flexible chains to the enzyme surface. J. Am. Chem. Soc. 1991, 113 (4), 1394−1397. (12) Liu, J. M.; Lin, L. P.; Wang, X. X.; Lin, S. Q.; Cai, W. L.; Zhang, L. H.; Zheng, Z. Y. Highly selective and sensitive detection of Cu2+ with lysine enhancing bovine serum albumin modified-carbon dots fluorescent probe. Analyst (Cambridge, U. K.) 2012, 137, 2637−2642. (13) Lin, X.; Gao, G.; Zheng, L.; Chi, Y.; Chen, G. Encapsulation of Strongly Fluorescent Carbon Quantum Dots in Metal-Organic Frameworks for Enhancing Chemical Sensing. Anal. Chem. 2014, 86 (2), 1223−1228. (14) Wang, F.; Liu, X.; Lu, C. H.; Willner, I. Cysteine-Mediated Aggregation of Au Nanoparticles: The Development of a H2O2 Sensor and Oxidase-Based Biosensors. ACS Nano 2013, 7 (8), 7278−7286.

Figure 5. RI measurement under different pH conditions (n = 3 average, error bar unnoticeable); this result shows a rise in FLAGCryba1 refractivity under acidic conditions, suggesting that the total induced dipole was enhanced.

Cryba1 under acidic conditions strengthens its intermolecular interactions within homooligomers to induce a larger dipole as whole assembly. β-Casein and trypsinogen do not assemble into oligomers such that their induced dipoles stay constant, despite pH transitions. BSA, which does form homooligomers, did not show transitions in the RI because their intermolecular interactions are not π−π stacking such that electrons could not easily migrate.

■

CONCLUSIONS We have conducted the first in vitro measurement of FLAGtagged Crystallin refractivity to verify that the high refractivity in the eye lens is due not only to the concentration of proteins and the amino acid composition of the proteins but also to the formation of homooligomers and the strength of its intermolecular interactions. FLAG-Cryba1, under acidic conditions, had a higher refractivity, which suggests a homotetramer assembly with stronger intermolecular interactions below its pI. This allows the migration of electrons within the homotetramer to induce a greater dipole and a higher refractivity. The eye lens is known to contain hyaluronic acid; it can thus be conceived that the eye lens is optimized and controlled by nature under acidic conditions to obtain an appropriate refractivity to concentrate light onto retina. 507

DOI: 10.1021/acsbiomaterials.6b00605 ACS Biomater. Sci. Eng. 2017, 3, 502−508

Article

ACS Biomaterials Science & Engineering (15) Kwak, K.; Kumar, S. S.; Pyo, K.; Lee, D. Ionic Liquid of a Gold Nanocluster: A Versatile Matrix for Electrochemical Biosensors. ACS Nano 2014, 8 (1), 671−679. (16) Wang, Z.; Luo, X.; Wan, Q.; Wu, K.; Yang, N. Versatile Matrix for Constructing Enzyme-Based Biosensors. ACS Appl. Mater. Interfaces 2014, 6 (19), 17296−17305. (17) Satija, J.; Karunakaran, B.; Mukherji, S. A dendrimer matrix for performance enhancement of evanescent wave absorption-based fiberoptic biosensors. RSC Adv. 2014, 4, 15841−15848. (18) Minic, J.; Grosclaude, J.; Aioun, J.; Persuy, M. A.; Gorojankina, T.; Salesse, R.; Pajot-Augy, E.; Hou, Y.; Helali, S.; Jaffrezic-Renault, N.; Bessueille, F.; Errachid, A.; Gomila, G.; Ruiz, O.; Samitier, J. Immobilization of native membrane-bound rhodopsin on biosensor surfaces. Biochim. Biophys. Acta, Gen. Subj. 2005, 1724 (3), 324−332. (19) Cohen, A. E.; Hochbaum, D. R. Measuring Membrane Voltage with Microbial Rhodopsins. Methods Mol. Biol. 2014, 1071, 97−108. (20) Vérétout, F.; Tardieu, A. The protein concentration gradient within eye lens might originate from constant osmotic pressure coupled to differential interactive properties of crystallins. Eur. Biophys. J. 1989, 17 (2), 61−68. (21) Zhao, H.; Brown, P. H.; Schuck, P. On the Distribution on Protein Refractive Index Increments. Biophys. J. 2011, 100, 2309− 2317. (22) Jonasova, K.; Kozmik, Z. Eye evolution: Lens and cornea as an upgrade of animal visual system. Semin. Cell Dev. Biol. 2008, 19, 71− 81. (23) Ueda, Y.; Duncan, M. K.; David, L. L. Lens Proteomics: The Accumulation of Crystallin Modification in the Mouse Lens with Age. Invest. Ophthalmol. Visual Sci. 2002, 43 (1), 205−215. (24) Lampi, K. J.; Shih, M.; Ueda, Y.; Shearer, T. R.; David, L. L. Lens Proteomics: Analysis of Rat Crystallin Sequences and Two Dimensional Electrophoresis Map. Invest. Ophthalmol. Visual Sci. 2002, 43 (1), 216−224. (25) Piatigorsky, J. Lens Differentiation in Vertebrates: A Review of Cellular and Molecular Features. Differentiation 1981, 19 (1−3), 134− 153. (26) Remtulla, S.; Hallett, P. E. A Schematic Eye for the Mouse, and Comparisons with the Rat. Vision Res. 1985, 25 (1), 21−31. (27) Bloemendal, H. The Vertebrate Eye Lens. Science 1977, 197, 127−138. (28) Horwitz, J. α-Crystallin can function as a molecular chaperone. Proc. Natl. Acad. Sci. U. S. A. 1992, 89, 10449−10453. (29) Zigler, J. S., Jr.; Sinha, D. βA3/A1-Crystallin: More than a lens protein. Prog. Retinal Eye Res. 2015, 44, 62−85. (30) Zhao, H.; Brown, P. H.; Magone, M. T.; Schuck, P. The Molecular Refractive Function of Lens γ-Crystallins. J. Mol. Biol. 2011, 411 (3), 680−699. (31) Mathur, R. L.; Reddy, M. C.; Yee, S.; Imbesi, R.; Groth-Vasselli, B.; Farnsworth, P. N. Investigation of lens glycolytic enzymes: species distribution and interaction with supramolecular order. Exp. Eye Res. 1992, 54 (2), 253−260. (32) Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.; Wilkins, M. R.; Appel, R. D.; Bairoch, A. Protein Identification and Analysis Tools on the ExPASy Server. The Proteomics Protocols Handbook;Walker, J. M., Ed.; Humana Press: New York, 2005; pp571−607; DOI: 10.1385/1-59259-890-0:571. (33) Bax, B.; Lapatto, R.; Nalini, V.; Driessen, H.; Lindley, P. F.; Mahadevan, D.; Blundell, T. L.; Slingsby, C. X-ray analysis of βB2Crystallin and evolution of oligomeric lens proteins. Nature 1990, 347, 776−780. (34) McMeekin, T. L.; Wilensky, M.; Groves, M. L. Refractive Indices of Proteins in Relation to Amino Acid Composition and Specific Volume. Biochem. Biophys. Res. Commun. 1962, 7 (2), 151− 156. (35) SWISS MODEL; http://swissmodel.expasy.org/interactive. (36) CLUSTALW; http://www.genome.jp/tools/clustalw/. (37) Smith, M. A.; Bateman, O. A.; Jaenicke, R.; Slingsby, C. Mutation of interfaces in domain-swapped human betaB2-Crystallin. Protein Sci. 2007, 16 (4), 615−625.

(38) Malamud, D.; Drysdale, J. W. Isoelectric points of proteins: A table. Anal. Biochem. 1978, 86 (2), 620−647.

508

DOI: 10.1021/acsbiomaterials.6b00605 ACS Biomater. Sci. Eng. 2017, 3, 502−508