Systematic Optimization of Limonene Production in Engineered

Jun 3, 2019 - (9−13) However, at least nine genes are involved in the limonene biosynthesis ... Kanamycin, streptomycin, and ampicillin at appropria...
0 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. 2019, 67, 7087−7097

Systematic Optimization of Limonene Production in Engineered Escherichia coli Jihua Wu,† Si Cheng,† Jiayu Cao,† Jianjun Qiao,†,‡ and Guang-Rong Zhao*,†,‡ †

Downloaded via UNIV OF SOUTHERN INDIANA on July 18, 2019 at 04:31:28 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

Frontier Science Center for Synthetic Biology and Key Laboratory of Systems Bioengineering (Ministry of Education), School of Chemical Engineering and Technology, Tianjin University, Yaguan Road 135, Jinnan District, Tianjin 300350, China ‡ SynBio Research Platform, Collaborative Innovation Centre of Chemical Science and Engineering (Tianjin), Tianjin University, Yaguan Road 135, Jinnan District, Tianjin 300350, China S Supporting Information *

ABSTRACT: Limonene, a cyclic monoterpene, is widely used in food and cosmetics industries as well as in agriculture. In the work described herein, employing a systematic optimization strategy, we constructed an efficient platform for producing limonene via the heterologous mevalonate pathway in Escherichia coli. By site-directed mutation of EfMvaS and tuning the initial translation of EfMvaE and EfMvaSA110G through ribosome binding site engineering, the upstream module for overproducing mevalonate was obtained. Expression of MmMK with ScPMK, ScPMD, and ScIDI under FAB80 promoter resulted in an efficient midstream module to produce 181.73 mg/L of limonene. Subsequently, coexpression of SlNPPS and MsLS in the downstream module led to a great improvement of limonene production to 694.61 mg/L. Finally, metabolically engineered strain ELIM78 produced 1.29 g/L of limonene in 84 h by fed-batch fermentation in a shake-flask. This is the first report on limonene biosynthesis in E. coli using neryl pyrophosphate synthase, which has promising potential for producing other monoterpenes. KEYWORDS: limonene, Escherichia coli, neryl diphosphate synthase, synthetic biology, metabolic engineering, MVA pathway

■

INTRODUCTION

grandis and limonene synthase (LS) from Mentha spicata in E. coli synthesized limonene.4 Enhancing the native MEP pathway by overexpressing the rate-limiting enzymes, 1-deoxyxylulose-5-phosphate synthase (DXS) and isopentenyl diphosphate isomerase (IDI), increased the production of limonene to 35.8 mg/L.5 Heterologously expressing the MVA pathway resulted in 57 mg/L of limonene.6 After the metabolic burden was alleviated by reducing the number of plasmids and the expression of key enzymes was optimized in the limonene biosynthetic pathway, engineered E. coli produced 430 mg/L of limonene.7 Further increasing the expression level of the LS gene enhanced the production of limonene up to 605 mg/L.8 Tuning expression of the metabolic pathway at transcription and translation levels was shown to be an efficient strategy to improve the titers of products.9−13 However, at least nine genes are involved in the limonene biosynthesis from acetyl-CoA, most of which are heterologously expressed and remain to be optimized. In this study, we aimed to improve the production of limonene in E. coli by systematically optimizing the metabolic flux of limonene biosynthetic pathway. Heterologous limonene biosynthetic pathway was divided into the upstream, midstream, and downstream modules (Figure 1), and in each module genes derived from bacteria, S. cerevisiae, and plants were employed. We fine-tuned the translation of EfMvaE and EFMvaS in the upstream module to enhance the biosynthesis

Limonene, a cyclic monoterpene, is a naturally occurring secondary metabolite of plants. Traditionally, limonene is widely used in the food and beverage industry for products such as baked goods, candy, ice cream, and fruit juice.1 Since it has a pleasant orange-like odor and highly volatile feature, limonene is supplemented in perfumes and household cleaning products as a fragrance ingredient. Limonene is also used as a green pesticide for insect control in agriculture due to its low oral and dermal toxicity to mammals such as birds and fish, and nonrepellency to honeybees.1 Limonene is a platform chemical that can potentially be converted into valuable products through addition, epoxidation, or dehydration reactions.2 For example, hydrogenated limonene dimer has a low freezing point and high energy density, and it could be an environment-friendly jet fuel replacement.3 Isopentenyl diphosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP) are the universal building blocks for biosynthesis of monoterpenes, sesquiterpenes, and diterpenes, whose precursors are geranyl pyrophosphate (GPP), farnesyl pyrophosphate (FPP), and geranylgeranyl pyrophosphate (GGPP), respectively. There are two pathways to biosynthesize IPP and DMAPP: the mevalonate (MVA) pathway in eukaryotes such as Saccharomyces cerevisiae, and the 2-methylD-erythritol-4-phosphate (MEP) pathway in most bacteria, including Escherichia coli. Both the MVA and the MEP pathways exist in plants. E. coli is an excellent microbial cell factory for production of terpenoids because of its high tolerance to products of interest and easy genetic manipulation. Many efforts have been devoted to microbial production of limonene. Heterologous expression of GPP synthase (GPPS) from Abies © 2019 American Chemical Society

Received: Revised: Accepted: Published: 7087

March 5, 2019 May 28, 2019 June 3, 2019 June 3, 2019 DOI: 10.1021/acs.jafc.9b01427 J. Agric. Food Chem. 2019, 67, 7087−7097

Article

Journal of Agricultural and Food Chemistry

Figure 1. Metabolic pathway in the biosynthesis of limonene from glucose in engineered E. coli. Enzymes from different organisms were depicted in the legend. Abbreviations: A-CoA, acetyl-CoA; AA-CoA, acetoacetyl-CoA; HMG-CoA, 3-hydroxy-3-methylglutaryl-CoA; Mev-P, mevalonate 5-phosphate; Mev-PP, mevalonate 5-diphosphate; IPP, isopentenyl diphosphate; DMAPP, dimethylallyl diphosphate; GPP, geranyl diphosphate; NPP; neryl pyrophosphate. Enzymes in limonene biosynthetic pathway: MvaE, acetoacetyl-coenzyme A thiolase/3-hydroxy-3-methylglutarylcoenzyme A reductase; MvaS, mevalonate synthase; MK, mevalonate kinase; PMK, phosphomevalonate kinase; PMD, diphosphomevalonate decarboxylase; IDI, IPP isomerase; GPPS, GPP synthase; NPPS, NPP synthase; LS, limonene synthase.

■

of mevalonate by designing ribosome binding site (RBS) sequences. Subsequently, the midstream model was optimized to enlarge the metabolic flux entrance from the upstream module by replacing the mevalonate kinase (MK) of S. cerevisiae (ScMK) with the MmMK of Methanosarcina mazei combined with promoter engineering. Furthermore, we used the neryl pyrophosphate synthase (NPPS) from Solanum lycopersicum (SlNPPS) and the MsLS from Mentha spicata to construct the downstream module, which increased the production of limonene up to 694.61 mg/L. Finally, the fed-batch fermentation was carried out in a shake-flask, and engineered strain ELIM78 produced 1.29 g/L of limonene in 84 h.

MATERIALS AND METHODS

Strains, Media, and Chemicals. Escherichia coli DH5α was used for cloning and plasmid construction, and E. coli BW25113 was used to engineer the limonene-producing strain. Luria−Bertani (LB) medium (per liter: 10 g tryptone, 5 g yeast extract, and 5 g NaCl) and YM9 medium (per liter: 2 g yeast extract, 6 g Na2HPO4, 3 g KH2PO4, 0.5 g NaCl, 1 g NH4Cl, 1 mM MgSO4, and 0.1 mM CaCl2) supplemented with 1% of glucose were used for cell growth and shake-flask fermentation, respectively. Kanamycin, streptomycin, and ampicillin at appropriate concentrations were added to media when needed. S-Limonene and DL-mevalonolactone standards were purchased from TCL Biotech Co., Ltd. (Shanghai, China). Plasmid preparation, gel extraction, and purification of DNA were conducted 7088

DOI: 10.1021/acs.jafc.9b01427 J. Agric. Food Chem. 2019, 67, 7087−7097

Article

Journal of Agricultural and Food Chemistry Table 1. Strains Used in This Study E. coli strain

description

references

BW25113 BW25113(DE3) EMAP12 ELIM17 EMAP27 EMAP38 EMAP39 EMAP40 EMAP41 EMAP42 EMAP45 EMAP46 EMAP47 EMAP48 EMAP49 EMAP50 EMAP51 EMAP52 EMAP53 EMAP54 EMAP55 ELIM65 ELIM84 ELIM62 ELIM59 EIPP66 ELIM78 ELIM79 ELIM80

lacIqrrnBT14ΔlacZWJ16hsdR514ΔaraBADAH33ΔrhaBADLD78 E. coli K12 BW25113 with T7 RNA polymerase gene in the chromosome BW25113(DE3) harboring plasmids pMAP1 BW25113(DE3) harboring plasmids pMAP1, pISP2, and pGLS1 BW25113(DE3) harboring plasmids pMAP2 BW25113(DE3) harboring plasmids pMAP4 BW25113(DE3) harboring plasmids pMAP9 BW25113(DE3) harboring plasmids pMAP14 BW25113(DE3) harboring plasmids pMAP15 BW25113(DE3) harboring plasmids pMAP18 BW25113(DE3) harboring plasmids pMAP3 BW25113(DE3) harboring plasmids pMAP5 BW25113(DE3) harboring plasmids pMAP6 BW25113(DE3) harboring plasmids pMAP7 BW25113(DE3) harboring plasmids pMAP8 BW25113(DE3) harboring plasmids pMAP10 BW25113(DE3) harboring plasmids pMAP11 BW25113(DE3) harboring plasmids pMAP12 BW25113(DE3) harboring plasmids pMAP13 BW25113(DE3) harboring plasmids pMAP16 BW25113(DE3) harboring plasmids pMAP17 BW25113(DE3) harboring plasmids pMAP6, pISP2, and pGLS1 BW25113(DE3) harboring plasmids pMAP6, pISP3, and pGLS1 BW25113(DE3) harboring plasmids pMAP6, pISP5, and pGLS1 BW25113(DE3) harboring plasmids pMAP6, pISP6, and pGLS1 BW25113(DE3) harboring plasmids pMAP6 and pISP6 EIPP66 harboring plasmids pNLSt1 EIPP66 harboring plasmids pNLSt2 EIPP66 harboring plasmids pNLSt3

NBRP-E. coli at NIG this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study

pGLS1 was replaced by the condon-optimized SlNPPS gene (GenBank: NM_001247704.1) from tomato (Solanum lycopersicum) with different truncated length at the N-terminus, generating plasmids pNLSt1, pNLSt2, and pNLSt3. All plasmids used in this work were verified by sequencing before transformation into E. coli BW25113(DE3). All the sequences of codon-optimized genes used in this work are listed in Table S2. In order to construct E. coli BW25113(DE3), the T7 RNA polymerase gene was integrated at the site between the ybhB and ybhC genes in the chromosome of E. coli BW25113 by using the λ Red recombination method.14 Briefly, the 500 bp upstream of the ybhB gene and the 500 bp downstream of the ybhC gene were amplified from E. coli BW25113 using primers ybhc-1-F/R and ybhb-5-F/R, respectively. The T7 RNA polymerase gene was amplified from E. coli BL21(DE3) using primers T7 RNA-2-F/R. The 5-terminal and 3-terminal fragments of the tetracycline resistance gene including the I-SceI recognition sites were amplified from plasmid pTKS/CS using primers tet-3-F/R and tet-4-F/R, respectively. Then five fragments were assembled by three rounds of overlapping extension PCR and electrotransferred into E. coli BW25113 which contained the plasmid pTKRED. The positive clones were screened by tetracycline resistance and confirmed by PCR using primers ter-3-F/ybhb-5-R. Subsequently, L-arabinose was added for inducible expression of I-SceI endonuclease to remove the tetracycline resistance gene from the chromosome, which was confirmed by PCR with primers ybhc-1-F/ ybhb-5-R. Finally, the strain was grown at 42 °C to lose plasmid pTKRED, generating E. coli BW25113(DE3). Shake-Flask Fermentation. For shake-flask experiments, limonene-producing E. coli strain was grown in LB medium overnight at 37 °C and 250 rpm, and then inoculated in YM9 medium containing 1% of glucose and appropriate antibiotics with an initial optical density (OD600) of 0.1 for fermentation at 30 °C and 250 rpm.

using kits from TransGen Biotech (Beijing, China). Genes and primers were synthesized by GENEWIZ (Suzhou, China). Construction of Plasmids and Strains. All the strains and plasmids used in this work are listed in Table 1 and Table 2, respectively. All the primers used in this work are listed in Table S1. The condon-optimized EfmvaE (GenBank: AF290092) and EfmvaS (GenBank: AF290092) from Enterococcus faecalis were inserted into pETDuet-1 at NcoI/EcoRI and NdeI/XhoI sites, respectively, generating plasmid pMAP1. A point mutation (A110G) was introduced into the Ef mvaS gene by standard mutation PCR procedure, and the EfmvaS gene on plasmid pMAP1 was replaced with the EfmvaSA110G gene, generating plasmid pMAP2. A series of designed RBSs were inserted at XagI/NcoI and NotI/NdeI sites, generating plasmids pMAP3-pMAP18. The ScMK, ScPMK, ScPMD, and ScIDI genes were cloned from S. cerevisiae S288C, and then assembled into pCDFDuet-1 using Clonexpress Ultra One Step Cloning Kit (Vazyme Biotech Co., Ltd., Nanjing, China) at the NdeI/XhoI sites, generating plasmid pISP2. The ScMK gene on plasmid pISP2 was replaced with the MmMK gene (GenBank: AAM31458) from Methanosarcina mazei, generating plasmid pISP5. The fragment was amplified using pCDFDuet-1 as the template with primers pISP6-F1/R1 that contained the FAB80 promoter and the NotI restriction site, then digested with NotI and self-ligated, generating plasmid pCDF-FAB80. The MmMK, ScPMK, ScPMD, and ScIDI genes were assembled into plasmid pCDF-FAB80 using the Clonexpress Ultra One Step Cloning Kit, generating plasmid pISP6. T7 promoter was inserted in front of the ScPMK gene on pISP2 by homologous recombination method, generating plasmid pISP3. The AgGPPS gene (GenBank: AF513112) from Abies grandis and the MsLS gene (GenBank: L13459) from Mentha spicata were condon-optimized and synthesized, and then ligated into pRSFDuet-1 at NdeI/XhoI and NcoI/HindIII sites, respectively, generating plasmid pGLS1. The AgGPPS gene on plasmid 7089

DOI: 10.1021/acs.jafc.9b01427 J. Agric. Food Chem. 2019, 67, 7087−7097

Article

Journal of Agricultural and Food Chemistry Table 2. Plasmids Used in This Study plasmids

description

pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaS pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME01 and RMS01 pMAP4 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME01 and RMS02 pMAP5 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME01 and RMS03 pMAP6 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME01 and RMS04 pMAP7 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME02 and RMS01 pMAP8 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME02 and RMS02 pMAP9 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME02 and RMS03 pMAP10 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME02 and RMS04 pMAP11 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME03 and RMS01 pMAP12 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME03 and RMS02 pMAP13 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME03 and RMS03 pMAP14 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME03 and RMS04 pMAP15 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME04 and RMS01 pMAP16 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME04 and RMS02 pMAP17 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME04 and RMS03 pMAP18 pETDuet-1, Ampr, PT7-EfmvaE-PT7-EfmvaSA110G with RME04 and RMS04 pISP2 pCDFDuet-1, Strr, PT7-ScMK-ScPMK-ScPMD-ScIDI pISP3 pCDFDuet-1, Strr, PT7-MmMK- PT7-ScPMK-ScPMDScIDI pISP5 pCDFDuet-1, Strr, PT7-MmMK-ScPMK-ScPMD-ScIDI pISP6 pCDFDuet-1, Strr, PFAB80-MmMK-ScPMK-ScPMD-ScIDI pGLS1 pRSFDuet-1, Kanr, PT7-AgGPPS-PT7-MsLS pNLSt1 pRSFDuet-1, Kanr, PT7-SlNPPSt45S−PT7-MsLS pNLSt2 pRSFDuet-1, Kanr, PT7-SlNPPSt51K−PT7-MsLS pNLSt3 pRSFDuet-1, Kanr, PT7-SlNPPSt54C−PT7-MsLS pTKS/CS p15A, Cmr, tetr, I-SceI restriction sites pTKRED temperature-sensitive replication origin, Spcr, ParaBAD-ISceI, Plac-Red pMAP1 pMAP2 pMAP3

ref this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this this this this this this 14 14

study study study study study study

When the OD600 of the culture was reached to 0.8−1.0, isopropyl β-D1-thiogalactopyranoside (IPTG) was added with the final concentration of 0.5 mM, and isopropyl myristate (10% by the culture volume) was overlaid to capture limonene. The culture was further fermented at 30 °C and 250 rpm for biosynthesis of mevalonate and limonene. The OD was detected on a UV−vis spectrometer (TU-1810, Purkinje General Co. Ltd., Beijing, China) at 600 nm. The residual glucose was measured using a glucose analyzer (SBA-90, Biology Institute of Shandong Academy of Sciences, Jinan, China). Transcriptional Analysis by Semiquantitative Reverse Transcription PCR. The total RNA was extracted from the shake-flask culture at 12 h using Fungal/Bacterial RNA MiniPrep (Tianmobio, Beijing, China). Contaminant DNA was removed by DNase I (TransGen Biotech, Beijing, China) digestion. RNA was reversely transcribed into cDNA with random primers using the First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). Semiquantitative PCR was performed using Super-Fidelity DNA polymerase (Vazyme Biotech Ltd., Nanjing, China) with cDNA as template. Primers were designed to amplify ∼500 bp of genes. PCR

Figure 2. GC-MS analysis of limonene produced from strain ELIM17 and limonene standard. (A) GC chromatogram of strain ELIM17 and limonene standard. (B, C) Mass spectra and retention times of peak 1 (B) and peak 2 (C). RT, retention time (min). products were separated through agarose gel electrophoresis (Figure S1). The 16s RNA gene was used to normalize values of PCR products. The quantification of relative intensity of PCR bands was analyzed by BG-GDSAUTO Electrophoresis Image Analysis System and densitometric analysis software (Baygene Biotech Ltd., Beijing, China). PCR primers used for transcription analysis are listed in Table S1. 7090

DOI: 10.1021/acs.jafc.9b01427 J. Agric. Food Chem. 2019, 67, 7087−7097

Journal of Agricultural and Food Chemistry

■

Article

RESULTS AND DISCUSSION

Reconstruction of Limonene Biosynthetic Pathway in E. coli. Although the native MEP pathway of E. coli is theoretically superior to the MVA pathway for higher yield of IPP from glucose, the heterologous MVA pathway has experimentally proved to be better for production of terpenes8,16,17 For biosynthesis of mevalonate from acetyl-CoA, yeast has the three different enzymes, while the Gram-positive Enterococcus faecalis uses exclusively the two enzymes EfMvaE and EfMvaS. The bifunctional enzyme EfmvaE converts acetyl-CoA to acetoacetyl-CoA and HMG-CoA to mevalonate, and EfmvaS catalyzes acetoacetyl-CoA to the formation of HMG-CoA. EfMvaE and EfMvaS were more efficient than other microbial enzymes for biosynthesis of mevalonate in E. coli.18 To construct the upstream module from acetyl-CoA to mevalonate, Ef mvaE and Ef mvaS from E. faecalis were chosen and expressed in the bicistronic plasmid pMAP1. For the midstream module from mevalonate to IPP and DMAPP, the ScMK, ScPMK, ScPMD, and ScIDI from S. cerevisiae19 were expressed under the control of T7 promoter as the monocistronic operon in plasmid pISP2. For the downstream module from IPP and DMAPP to limonene, the AgGPPS from Abies grandis and the MsLS from Mentha spicata4 were separately expressed under two T7 promoters in plasmid pGLS. Three plasmids pMAP1, pISP2, and pGLS were introduced into strain BW25113(DE3) to create strain ELIM17. When the fermentation of strain ELIM17 was finished, the isopropyl myristate layer was collected and measured by GC-MS. A major peak at 2.13 min was detected (Figure 2A), and the relative ion abundance of the molecular ion (136.1 m/z) and other abundant ions of the major peak was consistent with that of limonene standard (Figure 2B,C). Thus, the biosynthetic pathway of limonene was successfully reconstructed in E. coli, and strain ELIM17 produced 11.71 mg/L of limonene, which was employed for stepwise optimization. Optimizing the Upstream Module To Overproduce Mevalonate by Designing RBSs. Mevalonate in the upstream module is the key precursor for biosynthesis of IPP and DMAPP in the midstream module. It has been reported that 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase was the bottleneck enzyme in the mevalonate biosynthetic pathway.20 A mutant of the EfmvaS (HMG-CoA synthase) at the 110 site from alanine to glycine increased the overall reaction rate of enzyme activity21 and benefited terpene biosynthesis in E. coli.22 Thus, strain EMAP27 expressing Ef mvaE and Ef mvaSA110G was constructed. Strain EMAP27 grew normally and produced 485.99 mg/L of mevalonate at 48 h (Figure 3), a 1.7fold increase than that of strain EMAP12, indicating that

Figure 3. Mevalonate production and cell growth of strains EMAP12 and EMAP27. Strains were cultivated in 250 mL of shake-flask containing 50 mL of YM9 medium supplemented with 10 g/L glucose at 30 °C and 250 rpm. Mevalonate and biomass were measured at 48 h. Error bars represent one standard deviation from three replicates. Extraction and Analysis of Limonene and Mevalonate. For limonene analysis, when the fermentation was finished, the organic phase was collected and saturated with anhydrous Na2SO4, then 1 μL of the supernatant was analyzed by GC/MS-QP2010 Plus of Shimadzu (Japan) with a quadruple mass analyzer and a HP-5MS column (30 m × 0.25 mm, 0.25 μm film thickness). The mass scan range was 50−500 m/z. The separation conditions were an initial column temperature of 100 °C for 1 min, an increase of 10 °C/min to 270 °C, and an increase of 30 °C/min to 320 °C with 15 min hold. The inlet temperature was 250 °C with a split ratio of 20:1. The flow rate of carrier gas He was 1 mL/min. Mevalonate was determined by using an Agilent System 7820A GC equipped with a flame ionization detector (FID) and an HP-5 column (30 m × 0.25 mm, 0.25 μm film thickness). Briefly, 3 mL of fermentation broth was taken and centrifuged at 15000g for 10 min at room temperature. The supernatant was adjusted to pH 2.0 with HCl and incubated at 45 °C for 2 h to convert mevalonate to mevalonolactone. Then this solution was extracted with ethyl acetate following saturating with anhydrous Na2SO4. The ethyl acetate phase containing mevalonolactone was analyzed. The column temperature profile was 70 °C for 1 min, a ramp of 20 °C/min to 150 °C with 5 min hold, and a ramp of 30 °C/min to 300 °C with 3 min hold. The inlet temperature was 150 °C with a split ratio of 20:1. The retention time of mevalonolactone was confirmed using commercial standard 15 DL-mevalonolactone. The amount of mevalonate was calculated according to mevalonolactone measured.

Table 3. Designed RBS Sequences for Translation of EfMvaE and EfMvaSA110G in the Upstream Module gene

name

sequences

length (bp)

predicted TIR

Ef mvaE

RME01 RME02 RME03 RME04

CATATTAGCCATCCTGCAAATTAATG GGTACCGACCTAGTTGAAGCTCTGCCCGTATG AAACCTTAAACGACTTTAAATCTACATG ACTGTATTAGCCCTCTCATCTCATG

23 29 25 22

1257 2545 4336 7301

Ef mvaS

RMS01 RMS02 RMS03 RMS04

GACCTACCTGATAATCAAAAGATAATG TACGAGCGCTAGCCTTCCCAACATG GCGCTTACGTAATTCTTCTTTTAAATG GCAGTACTTACTCTCTTCTCAAAAGTAATG

24 22 24 27

1006 2034 4100 8668

a

RME: the RBS of MvaE; RMS: the RBS of MvaS. Core SD sequences are shown in bold with underline, and starting code ATG is at the end. 7091

DOI: 10.1021/acs.jafc.9b01427 J. Agric. Food Chem. 2019, 67, 7087−7097

Article

Journal of Agricultural and Food Chemistry EfmvaSA110G is more efficient than wild-type EfmvaS for streamlining mevalonate from acetyl-CoA. In bacteria, translation initiation of ribosome bound to the SD sequence at the RBS is considered as the rate-limiting step for protein translation and can significantly affect the protein biosynthesis.23,24 The biosynthetic enzymes in metabolic pathway could be optimized at the translational level by designing and screening the libraries of RBS sequences via the computational algorithm,25−28 which is an effective strategy to improve the expression of heterologous proteins and to enhance production of products.29−31 To further increase the mevalonate biosynthesis, RBS engineering strategy was employed to finetune the translation of EfmvaE and EfmvaSA110G. In order to get different values of translation initiation rate (TIR, 1000− 8000) (Table 3), four different lengths of RBS sequences were designed for EfmvaE and EfmvaSA110G, respectively, using Salis RBS calculator.13 Eight RBS sequences were crosscombined to generate 16 RBS pairs for screening appropriate RBS sequences (Figure 4A). The fermentation results showed that the combination effects of different RBS sequences on the production of mevalonate were diverse (Figure 4B), and mevalonate titers ranged from 13.55 to 1304.36 mg/L. Except for the RME02 giving the minor amount of mevalonate, whenever paired with one of RMS series, most of RBS pairs were profitable to the biosynthesis of mevalonate with the titers over 200.00 mg/L. Four RBS pairs of RME01-RMS01, RME01RMS04, RME03-RMS01, and RME03-RMS04 led to strains EMAP45, EMAP47, EMAP51, and EMAP40 more powerful than others for the production of mevalonate. Although the RBS pairs remarkably contributed to the mevalonate titers, the cell biomass of different strains was not significantly affected (Figure 4C). These results indicated that RBS pairs with appropriate TIRs were effective in balancing the enzyme expression of the upstream module. The highest yield strain EMAP47 was employed for further optimizing limonene production. Balancing Metabolic Flux by Promoter Engineering of the Midstream Module. In order to test the efficiency of the midstream module of the MVA pathway, plasmid pMAP1 in strain ELIM17 was replaced with plasmid pMAP6 containing the optimized upstream module to create strain ELIM65 (Figure 5A). With the improvement of biosynthesis of mevalonate, strain ELIM65 produced 89.38 mg/L of limonene (Figure 5B), a 6.6-fold increase compared with the starting strain ELIM17. However, a high accumulation of mevalonate (637.72 mg/L) was observed (Figure 5C), indicating that the midstream module might not be efficient to convert mevalonate into IPP and DMAPP for limonene biosynthesis of the downstream pathway. The RT-PCR analysis showed that the transcription of ScPMK was poor (Figure 5D), which might be potential bottleneck of the midstream module and limited the flux to the downstream module. A T7 promoter with a RBS was inserted in front of the ScPMK gene in plasmid pISP2; the ScMK gene and the ScPMK-ScPMD-ScIDI were separately expressed under control of each one’s promoter to create bicistronic plasmid pISP3 (Figure 5A). The resulting strain ELIM84 produced 71.89 mg/L of limonene, a slight decrease compared with strain ELIM65. The accumulation of mevalonate in strain ELIM84 was observed after 24 h and came to 229.58 mg/L at 60 h. For strain ELIM 84, additional T7 promoter increased the transcription level of ScPMK, but the transcription level of ScMK was remarkably decreased (Figure 5D), indicating that the bicistronic pattern might not be suitable for expressing the midstream module. It has been

Figure 4. Screening the appropriate RBSs for translation of EfMvaE and EfMvaSA110G to improve the production of mevalonate. (A) Schematic design of different RBS combinations. (B) Mevalonate production at 48 h. (C) Cell growth at 48 h. Strains were cultivated in 250 mL of shake-flask containing 50 mL of YM9 medium supplemented with 10 g/L glucose at 30 °C and 250 rpm. Error bars represent one standard deviation from three replicates.

reported that the enzyme efficiency (Kcat/Km) of MK from Methanosarcina mazei is approximately 5-fold higher than that derived from S. cerevisiae, and MmMK is not inhibited by DMAPP and GPP.32 Accordingly, the ScMK gene of plasmid pISP2 was replaced by the MmMK gene to create plasmid 7092

DOI: 10.1021/acs.jafc.9b01427 J. Agric. Food Chem. 2019, 67, 7087−7097

Article

Journal of Agricultural and Food Chemistry

Figure 5. Optimizing the midstream module to improve the limonene production. (A) Strategies for optimization of the midstream module to balance the MVA pathway. (B) Production of limonene. (C) Amount of mevalonate. (D) Relative transcription level of genes in the midstream module. Strains were cultivated in 250 mL of shake-flask containing 50 mL of YM9 medium supplemented with 10 g/L glucose at 30 °C and 250 rpm. The total RNA from cell culture at 12 h was extracted, and the transcription level was determined by reverse transcription PCR. Error bars represent one standard deviation from three replicates.

plasmid pISP5 was replaced by the strong constitutive FAB80 promoter37 to generate plasmid pISP6. As expected, the resulting strain ELIM59 produced 181.73 mg/L of limonene (Figure 5B), a 1-fold increase compared with strain ELIM65, and mevalonate was significantly decreased in strain ELIM59, indicating that most of the mevalonate from the upstream module was streamlined to the downstream module. Transcription levels of MmMK and ScPMK in strain ELIM59 were higher and compatible (Figure 5D). Thus, strain ELIM59 was used for the next improvement of limonene production. Improving Limonene Production by Reconstituting the Downstream Module. GPP, the universal substrate of monoterpene synthases, was used to heterologously biosynthesize monoterpenes, including limonene, pinene, sabinene, myrcene, and β-phellandrene.8,38−41 Neryl diphosphate (NPP), the isomer of GPP, is an alternative substrate of the LS42,43 and more efficient for biosynthesis of limonene in Yarrowia lipolytica and S. cerevisiae than GPP.44,45 Thus, we reconstituted the downstream module by using NPP synthase (NPPS) and

pISP5. Athough the production of limonene did not increase in strain ELIM62 containing plasmid pISP5, and accumulation of mevalonate was little (Figure 5B). It was likely that the accumulation of the intermidiate metabolites of the midstream module might impare the biosynthesis of limonene in strain ELIM62. It indicated that the MmMK gene would be employed to optimize the midstream module. Limonene was dominantly produced in 24 h by strains ELIM65 and ELIM84 (Figure 5B), and then mevalonate was continuously accumulated toward the end of the fermentation period (Figure 5C). The MmMK expression level of strain ELIM62 was low under T7 promoter (Figure 5D). Taking together, it indicated that inducible T7 promoter was not suitable to drive the expression of the midstream module. Constitutive promoters could keep constant expression levels of the heterologous genes during the fermentation, which would be benefit for producing natural products.9,19,33−36 We expected that the transcription of the midstream module driven by constitutive promoter would balance the upstream and downstream modules. The T7 promoter in 7093

DOI: 10.1021/acs.jafc.9b01427 J. Agric. Food Chem. 2019, 67, 7087−7097

Article

Journal of Agricultural and Food Chemistry investigated its efficiency on production of limonene in E. coli. According to the predicted transit peptide by Chlorop 1.1 sever, the condon-optimized SlNPPS gene from Solanum lycopersicum was truncated at three different positions (S45, K51, and C54) in the N-terminus to improve heterologous expression, and then replaced the AgGPPS gene on plasmid pGLS1 to generate plasmids pNLSt1, pNLSt2, and pNLSt3 (Figure 6A), respectively. As shown in Figure 6B, the limonene

Figure 6. Effects of different truncation positions at N-terminus of SlNPPS on production of limonene. (A) Schematic design of the truncated position of N-terminus of SlNPPS. (B) Limonene production and cell growth of strains with different truncated SlNPPSs. Strains were cultivated in 250 mL of shake-flask containing 50 mL of YM9 medium supplemented with 10 g/L glucose at 30 °C and 250 rpm. Limonene and biomass were measured at 60 h. Error bars represent one standard deviation from three replicates.

Figure 7. Optimization of the concentrations of glucose for limonene production in strain ELIM78. (A) Limonene production and biomass at 60 h. (B) Glucose consumption. Strain ELIM78 was cultivated in 250 mL of shake-flask containing 50 mL of YM9 medium supplemented with 5, 10, 15, or 20 g/L glucose at 30 °C and 250 rpm. Error bars represent one standard deviation from three replicates.

titers of strains harboring the truncated SlNPPSs were higher than that of strain ELIM59 harboring AgGPPS in the downstream module. Strain ELIM78 produced 694.61 mg/L of limonene, representing 2.9-fold increase compared with strain ELIM59. Further truncation of the N-terminus of SlNPPS decreased the production of limonene to 287.78 and 601.56 mg/L in strains ELIM79 and ELIM80, 59% and 13% declines compared to that in strain ELIM78, respectively. The suitable truncation of the transit peptide is necessary for the specific activity of NPPS as previously reported.42 Our results suggested that NPPS is more suitable than GPPS for limonene production in E. coli. Glucose Fed-Batch Fermentation for Limonene Production. Fermentation conditions of engineered strain play an important role in biosynthesis of the desired products. In order to enhance limonene production, the starting concentration of glucose was optimized. As shown in Figure 7A, the starting glucose at 5 g/L was completely consumed at 12 h, and the production of limonene was 227.74 mg/L (Figure 7B).

When the starting concentration of glucose was increased, the production of limonene remarkably increased, and the highest limonene was 871.32 mg/L at 15 g/L of glucose, which was depleted at 60 h. However, the production of limonene decreased to 758.57 mg/L at 20 g/L of glucose, which was not completely consumed at 60 h. The suitable starting concentration of glucose benefits the growth phenotype and limonene production of engineered strain. With suitable starting concentration of glucose, the fed-batch fermentation was carried out in shake-flask to further improve the productivity of optimized strain ELIM78. As shown in Figure 8, the first feeding of glucose at 48 h supported the growth of strain ELIM78 and increased titer of limonene. The secondary round of glucose feeding maintained strain ELIM78 at the stationary stage, and limonene was continuously accumulating to 1.29 g/L at 84 h after 19.92 g/L of glucose was consumed, which improved by 110-fold compared with the initial strain ELIM17. The higher specific 7094

DOI: 10.1021/acs.jafc.9b01427 J. Agric. Food Chem. 2019, 67, 7087−7097

Journal of Agricultural and Food Chemistry

■

Article

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.9b01427. Table S1, primers used in this study; Table S2, condonoptimized nucleotide sequences of Ef mvaE, Ef mvaS, MmMK, AgGPPS, SlNPPS, and MsLS; and Figure S1, relative transcription level of genes in the midstream module (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Tel.: +86-22-85356580. Fax: +8622-27403389. ORCID

Jihua Wu: 0000-0001-7626-5812 Si Cheng: 0000-0002-1548-9502 Guang-Rong Zhao: 0000-0002-6881-9042

Figure 8. Fed-batch fermentation of strain ELIM78 for limonene production. Strain ELIM78 was cultivated in 250 mL of shake-flask containing 50 mL of YM9 medium supplemented with 10 g/L glucose, and 1 mL of the feeding solution (500 g/L glucose) was added at 48 and 72 h, respectively. Error bars represent one standard deviation from three replicates.

Funding

This study was financially supported by the National Key R&D Program of China (2017YFD0201400). Notes

The authors declare no competing financial interest.

■

productivity, yield, and mass yield of strain ELIM78 were achieved (Table 4). These results indicated that the fermentation performance of strain ELIM78 was superior to that of strains using GPP as substrate (Table 4).46,47 E. coli has weak terpene biosynthetic pathway that restricts the heterologous production of monoterpenes. We reconstructed three-module metabolic pathway for limonene biosynthesis from glucose. Our results and previous works8,38,40,47 showed that the heterologous MVA pathway could be optimized translationally to synthesize sufficient mevalonate and support production of terpenes in E. coli. We rationally designed and cross-combined RBSs for fine-tuning the translation of the EfmvaE and EfmvaSA110G in the MVA pathway, and the appropriate RBS combination in the upstream module facilitated high mevalonate production. We balanced the expression of the heterologous genes involved in the midstream module by promoter engineering, and the resulting strain greatly increased limonene production. GPP precursor supply is another bottleneck for biosynthesis of limonene. Expression of heterologous GPPS gene of plant showed better production of limonene5 and carotene48 than the native GPPS (ispA) gene of E. coli. Herein, our results and previous reports44,45 show that tomato NPPS, seldom used in the plant kingdom for biosynthesis of monoterpene, is more efficient than plant GPPS in the downstream module for production of limonene in microbes. This engineered E. coli platform shows promising potential for producing other monoterpenes in the near future.

ABBREVIATIONS USED IPP, isopentenyl diphosphate; DMAPP, dimethylallyl diphosphate; GPP, geranyl pyrophosphate; FPP, farnesyl pyrophosphate; GGPP, geranylgeranyl pyrophosphate; MVA, mevalonate; MEP, 2-methyl-D-erythritol-4-phosphate; DXS, 1-deoxyxylulose-5-phosphate synthase; IDI, isopentenyl diphosphate; MK, mevalonate kinase; PMK, phosphomevaloante kinase; NPP, neryl diphosphate; TIR, translation initiation rate; RBS, ribosome binding sites

■

REFERENCES

(1) Ciriminna, R.; Lomeli-Rodriguez, M.; Cara, P. D.; LopezSanchez, J. A.; Pagliaro, M. Limonene: a versatile chemical of the bioeconomy. Chem. Commun. 2014, 50, 15288−15296. (2) Wilbon, P. A.; Chu, F. X.; Tang, C. B. Progress in renewable polymers from natural terpenes, terpenoids, and rosin. Macromol. Rapid Commun. 2013, 34, 8−37. (3) Zhang, J.; Zhao, C. A new approach for bio-jet fuel generation from palm oil and limonene in the absence of hydrogen. Chem. Commun. 2015, 51, 17249−17252. (4) Carter, O. A.; Peters, R. J.; Croteau, R. Monoterpene biosynthesis pathway construction in Escherichia coli. Phytochemistry 2003, 64, 425−433. (5) Du, F. L.; Yu, H. L.; Xu, J. H.; Li, C. X. Enhanced limonene production by optimizing the expression of limonene biosynthesis and MEP pathway genes in E. coli. Bioresour. Bioprocess. 2014, 1, 10. (6) Dunlop, M. J.; Dossani, Z. Y.; Szmidt, H. L.; Chu, H. C.; Lee, T. S.; Keasling, J. D.; Hadi, M. Z.; Mukhopadhyay, A. Engineering

Table 4. Limonene Production in This Study and Previous Studies host E. E. E. E. E.

coli coli coli coli coli

BW25113 DH1 DH1 BL21(DE3) DH10β

substrate

titer (g/L)

yield (mol/mol of glucose)

specific productivity (mg/(L·OD)

productivity (mg/(L·h))

mass yield (%)

NPP GPP GPP GPP GPP

1.29 0.60 0.43 1.35 0.23

0.085 0.080 0.057

184.42

15.36 8.40 6.04 30.00 3.20

6.48 6.05 4.36

107.21

7095

ref this study 8 7 46 27

DOI: 10.1021/acs.jafc.9b01427 J. Agric. Food Chem. 2019, 67, 7087−7097

Article

Journal of Agricultural and Food Chemistry microbial biofuel tolerance and export using efflux pumps. Mol. Syst. Biol. 2011, 7, 487. (7) Alonso-Gutierrez, J.; Chan, R.; Batth, T. S.; Adams, P. D.; Keasling, J. D.; Petzold, C. J.; Lee, T. S. Metabolic engineering of Escherichia coli for limonene and perillyl alcohol production. Metab. Eng. 2013, 19, 33−41. (8) Alonso-Gutierrez, J.; Kim, E. M.; Batth, T. S.; Cho, N.; Hu, Q.; Chan, L. J. G.; Petzold, C. J.; Hillson, N. J.; Adams, P. D.; Keasling, J. D.; Garcia Martin, H.; Lee, T. S. Principal component analysis of proteomics (PCAP) as a tool to direct metabolic engineering. Metab. Eng. 2015, 28, 123−133. (9) Ajikumar, P. K.; Xiao, W. H.; Tyo, K. E.; Wang, Y.; Simeon, F.; Leonard, E.; Mucha, O.; Phon, T. H.; Pfeifer, B.; Stephanopoulos, G. Isoprenoid pathway optimization for Taxol precursor overproduction in Escherichia coli. Science 2010, 330, 70−74. (10) Xu, P.; Gu, Q.; Wang, W. Y.; Wong, L.; Bower, A. G. W.; Collins, C. H.; Koffas, M. A. G. Modular optimization of multi-gene pathways for fatty acids production in E. coli. Nat. Commun. 2013, 4, 1409. (11) Chen, X.; Zhu, P.; Liu, L. Modular optimization of multi-gene pathways for fumarate production. Metab. Eng. 2016, 33, 76−85. (12) Keasling, J. D. Synthetic biology and the development of tools for metabolic engineering. Metab. Eng. 2012, 14, 189−195. (13) Salis, H. M.; Mirsky, E. A.; Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nat. Biotechnol. 2009, 27, 946−950. (14) Kuhlman, T. E.; Cox, E. C. Site-specific chromosomal integration of large synthetic constructs. Nucleic Acids Res. 2010, 38, e92. (15) Molyneux, R. J.; Schieberle, P. Compound identification: A Journal of Agricultural and Food Chemistry perspective. J. Agric. Food Chem. 2007, 55, 4625−4629. (16) Park, S. Y.; Binkley, R. M.; Kim, W. J.; Lee, M. H.; Lee, S. Y. Metabolic engineering of Escherichia coli for high-level astaxanthin production with high productivity. Metab. Eng. 2018, 49, 105−115. (17) Kim, E.-M.; Woo, H. M.; Tian, T.; Yilmaz, S.; Javidpour, P.; Keasling, J. D.; Lee, T. S. Autonomous control of metabolic state by a quorum sensing (QS)-mediated regulator for bisabolene production in engineered E. coli. Metab. Eng. 2017, 44, 325−336. (18) Yoon, S. H.; Lee, S. H.; Das, A.; Ryu, H. K.; Jang, H. J.; Kim, J. Y.; Oh, D. K.; Keasling, J. D.; Kim, S. W. Combinatorial expression of bacterial whole mevalonate pathway for the production of betacarotene in E. coli. J. Biotechnol. 2009, 140, 218−226. (19) Martin, V. J. J.; Pitera, D. J.; Withers, S. T.; Newman, J. D.; Keasling, J. D. Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nat. Biotechnol. 2003, 21, 796−802. (20) Tsuruta, H.; Paddon, C. J.; Eng, D.; Lenihan, J. R.; Horning, T.; Anthony, L. C.; Regentin, R.; Keasling, J. D.; Renninger, N. S.; Newman, J. D. High-level production of amorpha-4,11-diene, a precursor of the antimalarial agent artemisinin, in Escherichia coli. PLoS One 2009, 4, No. e4489. (21) Steussy, C. N.; Robison, A. D.; Tetrick, A. M.; Knight, J. T.; Rodwell, V. W.; Stauffacher, C. V.; Sutherlin, A. L. A structural limitation on enzyme activity: The case of HMG-CoA synthase. Biochemistry 2006, 45, 14407−14414. (22) Yang, J.; Xian, M.; Su, S.; Zhao, G.; Nie, Q.; Jiang, X.; Zheng, Y.; Liu, W. Enhancing production of bio-isoprene using hybrid MVA pathway and isoprene synthase in E. coli. PLoS One 2012, 7, No. e33509. (23) de Smit, M. H.; van Duin, J. Secondary structure of the ribosome binding site determines translational efficiency: a quantitative analysis. Proc. Natl. Acad. Sci. U. S. A. 1990, 87, 7668− 7672. (24) Kudla, G.; Murray, A. W.; Tollervey, D.; Plotkin, J. B. Codingsequence determinants of gene expression in Escherichia coli. Science 2009, 324, 255−258. (25) Na, D.; Lee, D. RBS Designer: software for designing synthetic ribosome binding sites that yields a desired level of protein expression. Bioinformatics 2010, 26, 2633−2634.

(26) Seo, S. W.; Yang, J.-S.; Kim, I.; Yang, J.; Min, B. E.; Kim, S.; Jung, G. Y. Predictive design of mRNA translation initiation region to control prokaryotic translation efficiency. Metab. Eng. 2013, 15, 67− 74. (27) Jervis, A. J.; Carbonell, P.; Vinaixa, M.; Dunstan, M. S.; Hollywood, K. A.; Robinson, C. J.; Rattray, N. J. W.; Yan, C.; Swainston, N.; Currin, A.; Sung, R.; Toogood, H.; Taylor, S.; Faulon, J.-L.; Breitling, R.; Takano, E.; Scrutton, N. S. Machine learning of designed translational control allows predictive pathway optimization in Escherichia coli. ACS Synth. Biol. 2019, 8, 127−136. (28) Farasat, I.; Kushwaha, M.; Collens, J.; Easterbrook, M.; Guido, M.; Salis, H. M. Efficient search, mapping, and optimization of multiprotein genetic systems in diverse bacteria. Mol. Syst. Biol. 2014, 10, 731. (29) Smanski, M. J.; Bhatia, S.; Zhao, D.; Park, Y.; Woodruff, L. B. A.; Giannoukos, G.; Ciulla, D.; Busby, M.; Calderon, J.; Nicol, R.; Gordon, D. B.; Densmore, D.; Voigt, C. A. Functional optimization of gene clusters by combinatorial design and assembly. Nat. Biotechnol. 2014, 32, 1241−1249. (30) Ng, C. Y.; Farasat, I.; Maranas, C. D.; Salis, H. M. Rational design of a synthetic Entner-Doudoroff pathway for improved and controllable NADPH regeneration. Metab. Eng. 2015, 29, 86−96. (31) Jeschek, M.; Gerngross, D.; Panke, S. Rationally reduced libraries for combinatorial pathway optimization minimizing experimental effort. Nat. Commun. 2016, 7, 11163. (32) Primak, Y. A.; Du, M.; Miller, M. C.; Wells, D. H.; Nielsen, A. T.; Weyler, W.; Beck, Z. Q. Characterization of a feedback-resistant mevalonate kinase from the archaeon Methanosarcina mazei. Appl. Environ. Microbiol. 2011, 77, 7772−7778. (33) Farmer, W. R.; Liao, J. C. Improving lycopene production in Escherichia coli by engineering metabolic control. Nat. Biotechnol. 2000, 18, 533−537. (34) Brown, S.; Clastre, M.; Courdavault, V.; O’Connor, S. E. De novo production of the plant-derived alkaloid strictosidine in yeast. Proc. Natl. Acad. Sci. U. S. A. 2015, 112, 3205−3210. (35) Zhou, L.; Ding, Q.; Jiang, G.-Z.; Liu, Z.-N.; Wang, H.-Y.; Zhao, G.-R. Chromosome engineering of Escherichia coli for constitutive production of salvianic acid A. Microb. Cell Fact. 2017, 16, 84. (36) Liu, X.; Li, X.-B.; Jiang, J.; Liu, Z.-N.; Qiao, B.; Li, F.-F.; Cheng, J.-S.; Sun, X.; Yuan, Y.-J.; Qiao, J.; Zhao, G.-R. Convergent engineering of syntrophic Escherichia coli coculture for efficient production of glycosides. Metab. Eng. 2018, 47, 243−253. (37) Kosuri, S.; Goodman, D. B.; Cambray, G.; Mutalik, V. K.; Gao, Y.; Arkin, A. P.; Endy, D.; Church, G. M. Composability of regulatory sequences controlling transcription and translation in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 2013, 110, 14024−14029. (38) Formighieri, C.; Melis, A. Carbon partitioning to the terpenoid biosynthetic pathway enables heterologous beta-phellandrene production in Escherichia coli cultures. Arch. Microbiol. 2014, 196, 853− 861. (39) Sarria, S.; Wong, B.; Martin, H. G.; Keasling, J. D.; PeraltaYahya, P. Microbial synthesis of pinene. ACS Synth. Biol. 2014, 3, 466−475. (40) Zhang, H.; Liu, Q.; Cao, Y.; Feng, X.; Zheng, Y.; Zou, H.; Liu, H.; Yang, J.; Xian, M. Microbial production of sabinene-a new terpene-based precursor of advanced biofuel. Microb. Cell Fact. 2014, 13, 20. (41) Kim, E.-M.; Eom, J.-H.; Um, Y.; Kim, Y.; Woo, H. M. Microbial synthesis of myrcene by metabolically engineered Escherichia coil. J. Agric. Food Chem. 2015, 63, 4606−4612. (42) Schilmiller, A. L.; Schauvinhold, I.; Larson, M.; Xu, R.; Charbonneau, A. L.; Schmidt, A.; Wilkerson, C.; Last, R. L.; Pichersky, E. Monoterpenes in the glandular trichomes of tomato are synthesized from a neryl diphosphate precursor rather than geranyl diphosphate. Proc. Natl. Acad. Sci. U. S. A. 2009, 106, 10865− 10870. (43) Xu, J.; Xu, J.; Ai, Y.; Farid, R. A.; Tong, L.; Yang, D. Mutational analysis and dynamic simulation of S-limonene synthase reveal the 7096

DOI: 10.1021/acs.jafc.9b01427 J. Agric. Food Chem. 2019, 67, 7087−7097

Article

Journal of Agricultural and Food Chemistry importance of Y573: Insight into the cyclization mechanism in monoterpene synthases. Arch. Biochem. Biophys. 2018, 638, 27−34. (44) Cao, X.; Lv, Y.-B.; Chen, J.; Imanaka, T.; Wei, L.-J.; Hua, Q. Metabolic engineering of oleaginous yeast Yarrowia lipolytica for limonene overproduction. Biotechnol. Biofuels 2016, 9, 214. (45) Cheng, S.; Liu, X.; Jiang, G.-Z.; Wu, J.-H.; Zhang, J.-L.; Lei, D.W.; Yuan, Y.-J.; Qiao, J.-J.; Zhao, G.-R. Orthogonal engineering of biosynthetic pathway for efficient production of limonene in Saccharomyces cerevisiae. ACS Synth. Biol. 2019, 8, 968−975. (46) Willrodt, C.; David, C.; Cornelissen, S.; Buhler, B.; Julsing, M. K.; Schmid, A. Engineering the productivity of recombinant Escherichia coli for limonene formation from glycerol in minimal media. Biotechnol. J. 2014, 9, 1000−1012. (47) Ye, L.; Zhang, C.; Bi, C.; Li, Q.; Zhang, X. Combinatory optimization of chromosomal integrated mevalonate pathway for βcarotene production in Escherichia coli. Microb. Cell Fact. 2016, 15, 202. (48) Yang, J.; Guo, L. Biosynthesis of beta-carotene in engineered E. coli using the MEP and MVA pathways. Microb. Cell Fact. 2014, 13, 160.

7097

DOI: 10.1021/acs.jafc.9b01427 J. Agric. Food Chem. 2019, 67, 7087−7097