Target-Triggering Multiple-Cycle Amplification Strategy for

Subscriber access provided by - Access paid by the | UCSF Library

Article

Target-Triggering Multiple Cycle Amplification Strategy for Ultrasensitive Detection of Adenosine Based on Surface Plasma Resonance Techniques Gui-Hong Yao, Ru-Ping Liang, Xiang-Dan Yu, Chun-Fang Huang, Li Zhang, and Jian-Ding Qiu Anal. Chem., Just Accepted Manuscript • Publication Date (Web): 15 Dec 2014 Downloaded from http://pubs.acs.org on December 15, 2014

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Target-Triggering Multiple Cycle Amplification Strategy for Ultrasensitive Detection of Adenosine Based on Surface Plasma Resonance Techniques Gui-Hong Yao†, Ru-Ping Liang†, Xiang-Dan Yu‡, Chun-Fang Huang†, Li Zhang†, Jian-Ding Qiu*,† †

Department of Chemistry, Nanchang University, Nanchang 330031, People’s Republic

of China ‡

School of Life Sciences, Nanchang University, Nanchang 330031, People’s Republic of

China

*Corresponding author Jian-Ding Qiu Department of Chemistry, Nanchang University, Nanchang 330031, China Tel: +86-791-83969518 ; E-mail: [email protected]

1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 30

ABSTRACT An ultrasensitive protocol for surface plasma resonance (SPR) detection of adenosine is designed with the aptamer-based target-triggering cascade multiple cycle amplification, and streptavidin-coated Au-NPs (Au NPs−SA) enhancement to enhance the SPR signals. The cascade amplification process consists of the aptamer-based target-triggering nicking enzyme signaling amplification (T-NESA), the nicking enzyme signaling amplification (NESA) and the hybridization chain reaction (HCR), the whole circle amplification process is triggered by the target recognition of adenosine. Upon recognition of the aptamer to target adenosine, DNA s1 is released from the aptamer and then hybridizes with hairpin DNA (HP1). The DNA s1 can be dissociated from HP1 under the reaction of nicking endonuclease to initiate the next hybridization and cleavage process. Moreover, the products of the upstream cycle (T-NESA) (DNA s2 and s3) could act as the “DNA trigger” of the downstream cycle (NESA and HCR) to generate further signal amplification, resulting in the immobilization of abundant Au NPs-SA on the gold substrate, and thus significant SPR enhancement is achieved due to the electronic coupling interaction between the localized surface plasma of Au NPs and the surface plasma wave. This detection method exhibits excellent specificity and sensitivity towards adenosine with a detection limit of 4 fM. The high sensitivity and specificity make this method a great potential for detecting biomolecules with trace amounts in bioanalysis and clinical biomedicine.

2


Page 3 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Developing sensitive and accurate method for biomolecular detection is not only an important mission but also a growing demand in bioanalysis since biomolecules have been largely disclosed to be directly correlated with the occurrence and development of some severe diseases such as cancers.1,2 It has been generally recognized that, in the early stage of diseases, the concentrations of relevant biomarkers are usually on a relatively low level. Thus, various efforts have been devoted to the design of signal amplification strategies for sensitively detecting target analytes to meet the requirements of clinical diagnosis and medical treatment of diseases.3-6 Over years of development, signal amplification was generally performed by increased loading of signal molecules on nanocarriers for labeling the recognition molecules.7,8 The signal molecules include enzymes9-11 or nanoparticles (NPs).12,13 The abundant enzyme molecules assembled on a sensor surface can efficiently catalyze related reactions to produce active molecular for target detection.14 While, functional nanomaterials with highly catalytic activity, good conductivity and good biocompatibility are able to accelerate the signal transduction, leading to improved detection limits on one hand. On the other hand, they can be used to amplify recognition events by increasing the loading density of signal tags, leading to a highly sensitive detection. For example, Bakalova et al. demonstrated that utility of quantum dot (QD) label brought about significantly improved sensitivity in western blots for protein detection, which could elucidate information from low-abundant proteins in proteomic studies.15 Recently, target DNA recycling as an isothermal signal amplification 3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 30

strategy has attracted considerable attention owing to its striking improvement for the detection sensitivity toward target analytes.16,17 The target DNA cycling methods usually operated on various nucleases of endonuclease,18,19 polymerase,20 and exonuclease21-24 for indirectly amplifying the amounts of target analytes. Thus, this strategy holds a great promise to produce strong detectable signals for the analysis of trace levels of targets. Recently, DNA nicking endonuclease has attracted increasing interest for applications in biological detection due to its strong recognition for DNA sequences.25 It is notable that the target can be reused through repeated cycles of hybridization, cleavage and dissociation, resulting in exponentially amplification of the signal.25,26 Additionally, taking advantage of the nicking enzyme, reactions can be performed in an isothermal condition without specialized instrumentation which hold the potential for routine analysis.27 However, the sensitivity of nicking enzyme signaling amplification (NESA) is much lower than that of the polymerase chain reaction (PCR); thus, an additional amplification step is required for improving the detection sensitivity of biological samples.28 For example, an ultrasensitive surface-enhanced Raman scattering detection system with a combination of the nicking endonuclease and polymerases and rolling circle amplification (RCA) amplification was designed for DNA detection with a detection limit down to 0.2 fM.29 As an advanced DNA amplification technique, hybridization chain reaction (HCR) can achieve a great signal amplification via a cascade of hybridization events which is triggered by an initiator and leads to the polymerization of oligonucleotides into a long nicked double-stranded DNA (dsDNA) structure. Besides, 4


Page 5 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the HCR can be operated under mild conditions. These advantages make HCR a fascinating strategy for nucleic acid amplification, especially in complex biosamples.30 Surface plasmon resonance (SPR) measurements of biomolecular interactions on the surface of thin gold films have emerged as one of the leading techniques for the fast, in situ detection of a wide range of biological targets.31,32 A key advantage of SPR is that the target biomolecule can be directly detected in real-time without prior fluorescent or enzymatic labeling.33 The use of the SPR method is, however, hindered by the fact that the changes in the refractive index as a result of binding processes are often small, and so the systems display limited sensitivities.34 Different methods to enhance the sensitivities in SPR analyses have included the association of latex particles,35 liposomes,36 or secondary proteins37 as amplifying labels. In addition, various nanomaterials including metal NPs,38,39 magnetic NPs,32 core-shell Fe3O4@Au NPs,40 graphene,41 carbon nanotube42 were also shown to strongly enhance the refractive index changes which, for instance, allowed decreasing the limit of detection for Hg2+ to the femtomolar level.43 Specially, the metallic NPs, mainly Au NPs, usually have been used as labels for SPR amplification, which originated from the coupling between the localized surface plasmon associated with the NPs and the surface plasmon wave. However, to the best of our knowledge, a SPR detection system combining NESA, HCR and Au NPs with SPR technology has not been reported yet. Adenosine, an endogenous nucleoside with potent vasodilator and antiarrhythmic activities, performs extremely crucial signaling functions in both the peripheral and 5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 30

central nervous system. It is also the core of the cell’s energy-containing compound, ATP. Direct monitoring of adenosine fluctuations under physiological conditions would be of utility in further characterizing the role of this purine in brain function and behavior. In the present study, adenosine is chosen as the model analyte of interest, a novel cascade cycle amplified device combined with metallic nanoparticles-based SPR assay has been designed for adenosine detection for the first time. The cascade multiple DNA cycle amplification device involves aptamer-based target-triggering NESA (T-NESA), NESA and HCR. In the presence of adenosine, DNA s1 is released from the aptamer by the target recognition of adenosine, initiating the upstream NESA reaction. In addition, the upstream products act as the “DNA trigger” of the downstream cycle (NESA reaction and HCR reaction), leading to the formation of dsDNA polymers on the sensing surface. Numerous Streptavidin-coated Au-NPs (Au NPs−SA) thus can be captured on the SPR chip, generating a significant change of SPR signal due to the electronic coupling interaction between the localized surface plasma of Au NPs and surface plasma wave. Additionally, high specificity of aptamers to target much favors for the selectivity improvement of the SPR assay. Thus, this flexible SPR biosensing system exhibits high sensitivity and specificity toward adenosine versus other non-targeted nucleosides. The present approach provides a versatile means in detecting biomolecules with trace amounts in bioanalysis and clinical biomedicine.

EXPERIMENTAL SECTION 6


Page 7 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Chemicals and Reagents. Adenosine, uridine, cytidine, guanosine, streptavidin, mercaptohexanol

(MCH)

and

1,4-dithiothreitol

(DTT)

were

purchased

from

Sigma-Aldrich (St. Louis, USA). Trisodium citrate and hydrogen tetrachloroaurate (III) (HAuCl4) were obtained from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). The nicking enzyme (Nt.AlwI, 10000 U/mL) and 10×NEB buffer (500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, and 10 mM dithiothreitol, pH 7.9) were purchased from the NEW ENGLAND Biolabs (NEB). 5×TBE buffer (90 mM Tris−HCl, 90 mM boric acid, and 2 mM EDTA, pH 8.3), 20% TBE gel and all synthetic oligonucleotides were ordered from Invitrogen Biotech Co., Ltd. (Shanghai, China), and the sequences were listed in Table 1. Each hairpin DNA (HP) was heated to 90 oC for 10 min and slowly cooled down to room temperature before use. All the thiolated DNA sequences were treated with DTT for 2.5 h and then separated using a Nap-5 column prior to use. All other chemicals were of analytical reagent grade and were used without further purification. Ultrapure water obtained from a Millipore water purification system (18 MΩ·cm resistivity) was used throughout the experiments. Table 1. Sequences of the used oligonucleotides probe Aptamer s1 HP1 HP2 CP Ap1 AP2

sequence (5’-3’) AGA GAACCTGGGGGAGTATTGCGGAGGAAGGT GGGTTCCCAGGTTCTCTGATCC TTATCCCGTGTTAGTGCTGGGATCAGAG↓AACCCACGGGATCC GATCAGAGGGATCCCGT↓GGGTTCCCAGGTTCTCTGATCC SH-AACACGGGATAA biotin-TACTCCCCCAGGTGCCTCTGATCCCAGCACT biotin-GCACCTGGGGGAGTA AGTGCTGGGATCAGAG

The portions underlined in the hairpin DNA (HP) indicate the recognition site of the nicking enzyme 7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 30

Nt.AlwI, and the arrowheads show the nicking site of the nicking enzyme. The italic portions in HP l are the sequence of DNA s2, and the other portions of the HP l are the sequence of DNA s3.

Characterization. Scanning electron microscope (SEM) images were recorded using a Quanta 200 SEM (FEI, USA) with an accelerating voltage of 20 kV. The images of gel electrophoresis were scanned by the Gel Image Analysis System (Bioshine GelX1650, Shanghai, China). The SPR experiments were performed on a SPR system integrated with an electrochemical workstation (Eco Chemie B.V., The Netherlands) in the Kretschmann optical configuration. A fixed monochromatic p-polarized laser (λ=670 nm) was used as the light resource. A vibrating mirror was used to modulate the angle of incidence of the p-polarized light beam on the SPR substrate with a frequency of 76 Hz. The incidence angle (θSPR) was obtained by measuring the intensity of reflected light with a photodiode detector over a dynamic range of 4000 m◦ (4◦). The sensor chip with a 48-nm thick gold layer and a 1.5-nm titanium sub-layer as the adhesive layer on BK-7 o

glass was mounted on the hemicylindrical lens using an index-matching oil ( nd25 C = 1.518 ). An autosampler with a controllable aspirating-dispensing-mixing pipet was used to add samples into the cuvette and provide constant mixture by aspiration and dispensing during measurements. The cuvette in the Autolab SPR instrument contained a standard three-electrode system capable of simultaneous electrochemical measurements. A modified gold chip was used as the working electrode (with an area of 2.5 mm2 exposed to the solution), a platinum rod was used as the counter electrode and an Ag/AgCl wire was used as the reference. The surface properties of the modified sensor surface at each 8


Page 9 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


step were characterized by electrochemical methods. Voltammograms were recorded in 10 mM phosphate buffered solution (PBS, pH 7.4) containing 2.5 mM [Fe(CN)6]3-/4- and 0.1 M KCl by scanning the potential from −0.1 to 0.6 V at a scan rate of 50 mV s−1. The electrochemical impedance spectroscopy (EIS) measurements were performed in the presence of a 2.5 mM K3[Fe(CN)6]/K4[Fe(CN)6] (1:1) mixture in pH 7.4 PBS containing 0.1 M KCl by applying an alternating current voltage of 5 mV amplitude in a frequency range from 0.05 Hz to 104 Hz. Synthesis of Au NPs. All glassware used in the following procedures were cleaned in a bath of freshly prepared 3:1 HCl/HNO3 (aqua regia), then rinsed throughout in ultrapure water and dried prior to use. Au NPs were prepared according to the method of reduction of tetrachloroauric acid with trisodium citrate reported previously with a slight modification.44 A 50 mL of 0.01% HAuCl4 solution was heated to boiling with vigorous stirring, and then 1 mL of 5% trisodium citrate solution was added rapidly. After the color of the solution changed from gray yellow to deep red, the heating source was removed and the resulting colloidal suspension was stirred for an another 5 min to cool down to room temperature. Preparation of the Streptavidin-Gold. Streptavidin-coated Au-NPs (Au NPs−SA) were prepared via a slightly modified method.45 The conjugation process was carried out as follows: 25 µL of 1 mg mL−1 streptavidin was added to 1 mL of pH-adjusted (pH 6.4, adjusted by 0.1 M K2CO3) Au NPs suspension, followed by incubation at room temperature for 30 min. The conjugate of Au NPs−SA was centrifuged at 13 000 rpm for 9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 30

10 min, and the red precipitates were redispersed in pH 8.0 Tris buffer solution (0.01 M Tris containing mM EDTA). The addition of BSA with a final concentration of 2% allows storage of Au NPs−SA at 4 oC for several days. SPR Detection of Adenosine by DNA Machine Amplification Strategy. Adenosine aptamer and its complementary oligonucleotides 1 (DNA s1) were previously hybridized in equal proportions (20 µL, 1.0 × 10−6 M) and incubated at 37 oC for 2 h. Then, 20 µL of this solution was added to 100 µL of adenosine solution at different concentrations and incubated at 37 oC for 2 h. Single-stranded DNA s1 was released from the aptamer/DNA hybrids in the process. The DNA machine amplification analysis was performed by mixing the above DNA s1 solution (25 µL), HP1 solution (1 µM, 5 µL), HP2 solution (1 µM, 5 µL), NEB buffer (10X, 5 µL) and incubating the mixture 37 oC for 45 min. Then, 5 µL 2 U/µL Nt.AlWI was added, and allowed to incubate for 2 h at 37 oC. After incubation, the obtained mixtures were heated at 80 oC for 20 min to terminate the reaction. For SPR detection, the substrate SPR gold chip was first cleaned with piranha solution (containing sulphuric acid and hydrogen peroxide in a 70%: 30% volume ratio) for 5 min followed by rinsing with ultrapure water to eliminate any possible contamination on the surface and finally dried under nitrogen (Caution: Piranha solution reacts violently with organic solvents and should be handled with great care!). The cleaned gold chip was initially immersed into the thiolated capture DNA (CP) solution for 12 h in order to assemble the monolayer of DNA, followed by rinsing with double-distilled water. The 10


Page 11 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


gold chip was subsequently immersed in 2 mM MCH solution for 90 min to cover the nonspecific sites. Then, the above mixture (DNA s1, HP1, HP2 together with endonuclease) was pipetted to the SPR cell and incubated for 2 h. After rinsing, 50 µL of a freshly prepared DNA hybridization buffer (H-buffer; 20 mM Tris-HCl + 1 mM EDTA +100 mM NaCl, pH 7.4) containing 1 µM AP1 and 1 µM AP2 was injected into the SPR cell and incubated for 90 min to complete the long range self-assembly. After the gold chip was washed with water, the Au NPs−SA was added to the SPR cell and the SPR angle-time curve was recorded. These processes were performed with a self-edited semi-automatic program sequence and real-time monitored with the data acquisition software. Adenosine Detection in Human Serum. Human serum samples were diluted 105-fold with Tris-HCl buffer. The practical serum samples and the spiked serum samples were analyzed in a manner similar to that described above, and high-performance liquid chromatography (HPLC) was used as the standard calibration method to verify the result. Gel Electrophoresis. Gel electrophoresis was used to confirm the target-triggering cascade multiple cycle amplification strategy. In the gel electrophoresis assay, a total volume of 10 µL sample containing 2.0 µL each reacted sample, 2.0 µL 5 × loading buffer and 6.0 µL water was subjected to the 20% nondenaturing polyacrylamide gel electrophoresis (PAGE) and 1.5% agarose gel electrophoresis. The PAGE was carried out in 1×TBE at 110 V for 90 min at room temperature and the agarose gel electrophoresis was run at 110 V for 60 min. After ethidium bromide staining, gels were photographed 11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 30

by gel image system.

RESULTS AND DISCUSSION Design Principle of the Sensor. In this study, a SPR detection system is first designed to detect adenosine with a combination of DNA machine amplification and SPR technology. The SPR detection system includes dual NESA amplification, hybridization chain reaction (HCR) amplification, and Au NPs amplification of SPR signal. The fabrication principle for SPR detection of adenosine based on the DNA device cycle-amplifying technique is shown in Scheme 1. The aptamer is previously hybridized with its complementary DNA (s1) to form a duplex. In the presence of target adenosine, double-strand aptamer/DNA (s1) is dehybridized by the recognition of adenosine to the aptamer, resulting in the detachment of the DNA s1 from aptamer. The hairpin DNA (HP1) has four domains, the s1 DNA recognition sequences, the T-NEase recognition sequences, and the NESA and HCR primer region which is blocked by the hairpin stem region.

The

NEase

used

here

is

Nt.AlwI,

which

recognizes

the

sequence5’-GGATC-3’/3’-CCTAG-5’ in ds DNA and cleaves only the strand containing sequence 5’-GGATC at a distance of four base pairs towards the 3’ end from the recognition sequence.46 The released DNA s1 is complementary to the predesigned region of DNA HP1 to form double-stranded structures with full recognition sites for Nt.AlwI, which preferentially binds to the recognition sites and selectively cleaves the HP1 into two pieces DNA s2 and DNA s3. The duplex regions between s2 and s3 are 12


Page 13 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


thermally unstable. They dissociate to form two single DNA chain s2, s3. At the same time, upon Nt.AlwI cleavage, the DNA s1 dissociates from the HP1s and again hybridizes with the un-nicked HP1s to initiate the DNA s1 recycling process, which will result in the massive release of s2 and s3 from HP1. Meanwhile, the released DNA s3 can then hybridizes with DNA HP2 to form partially complementary DNA duplexes containing DNA endonuclease recognition, and Nt.AlwI further binds to the recognition sites and selectively cleaves the HP2 to recycle DNA s3 to initiate next NESA, and releases a number of s1 fragments which can be further recycled to the headstream (Scheme 1A). This dual NESA reaction will release large amounts of free DNA s2, which can act as a HCR primer to form dsDNA polymers through in situ HCR with the presence of the primer DNA s2 and two biotin labeled probes (AP1 and AP2), resulting in the intercalation of numerous Au NP-SA and generating significantly amplified SPR signals for adenosine detection. As illustrated in Scheme 1B, the proposed HCR-further amplified protocol for adenosine monitoring involves the self-assembly of SH−CP on a gold chip via the formation of Au−S bonds, surface blocking with MCH, in situ HCR formation of the dsDNA polymers upon addition of the DNA s2 obtained from the dual NESA amplification steps and two biotin labeled probes AP1 and AP2, following available for conjugation with the Au NP-SA, resulting in a huge SPR signal due to the amplification effect of Au NPs.39 Thus, it is conceivable that the detection sensitivity could be significantly improved.

13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 30

Scheme 1. Schematic illustration of dual NESA (A), HCR and Au NPs (B) signal amplification-based SPR assay for the detection of adenosine. Feasibility Study. To verify the feasibility of the proposed assay strategy, differential SPR signal obtained upon analyzing the target adenosine in the presence of nicking enzyme Nt.AlwI and those obtained in a series of control experiments are depicted in Figure 1. A high SPR signal is obtained in the presence of adenosine and Nt.AlwI (curve g). This is because numerous Au NPs-SA were immobilized on the gold chip through the multiple cycle amplification, resulting in tremendously amplified SPR signal output due to the electronic coupling interaction between the numerous captured Au NPs and the surface plasmon wave associated with the SPR gold film. Thus, a high density of nanoparticles appears on the detection substrate as indicated by SEM photos (Figure 2b). However, in the absence of target adenosine but with the presence of 10 U Nt.AlwI, the 14


Page 15 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


target-triggering NESA cannot be initiated, and the “DNA trigger s2 and s3” of the downstream cycle cannot be released into solution, so the SPR signals are very low (curve c) and the SEM image confirmed that almost no nanoparticles on the gold film surface (Figure 2a). It should be noted that the SPR response is only comparable to that in the absence of only target adenosine when the target adenosine and Nt.AlwI both or only Nt.AlwI absence for adenosine detection (curves a and b). Moreover, the improved SPR signal by the multiple amplification reaction is shown in Figure 1 (curves d-g). A 247.7 mo of SPR angle shift without the addition of AP2 probes (curve e) and a 322 mo of SPR angle shift without the addition of HP2 probes (curve f) are observed for 10 pM target adenosine detection, which both lower than that obtained by the entire cycle amplification system (curve g). This is because either HCR is not triggered without the template AP2 or the second NESA is not triggered without the template HP2. These results demonstrate that the SPR signal is further amplified by the HCR or the second NESA. Moreover, only a 183 mo SPR angle shift is observed without Au NPs amplification (curve d), which is much lower than that of 467 m◦ resulting from the proposed multiple DNA cycle and Au NP amplification strategy (curve g), showing the remarkable amplification performance of Au NPs. The experimental results indicate that the target-triggering multiple cycle system combined with NPs-based amplification can substantially amplify the SPR signal of adenosine.

15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 30

Figure 1. Series of control experiments performed by SPR, a) in the absence of adenosine and Nt.AlwI; b) in the absence of Nt.AlwI; c) in the absence of adenosine; d) in the presence of 10 pM adenosine, Nt.AlwI and all the probes but without Au NPs amplification; e) in the presence of 10 pM adenosine, Nt.AlwI and all the probes but without AP2; f) in the presence of 10 pM adenosine, Nt.AlwI and all the probes but without HP2; g) in the presence of 10 pM adenosine, Nt.AlwI and all the probes.

Figure 2. SEM images of the SPR detection system. a) In the absence of the target adenosine. b) In the presence of the target adenosine; the concentration of adenosine is 10 pM (scale bar: 1 µm). The viability of the target-triggering cascade multiple cycle amplification strategy was further investigated by PAGE (Figure S1A, supporting information), and the results were 16


Page 17 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in agreement with the proposed mechanism. The first three lanes showed the aptamer probe/s1 DNA, the hairpin probe HP1, and the hairpin probe HP2, respectively. Once target adenosine was introduced in the mixture of the aptamer probe/s1 DNA, HP1 probe and HP2 probe without Nt.AlwI, a new bright band appeared (lane 5), implying that s1 DNA was released from double-strand aptamer/s1 DNA by the recognition of target adenosine to the aptamer, then hybridized with HP1 and further unfolded HP2 to form s1 DNA/HP1/HP2 complex. In the absence of adenosine and Nt.AlwI, there were two bright bands corresponding to aptamer/s1 DNA, HP1 and HP2, only a little of s1 DNA/HP1/HP2 complex was formed (lane 4). Upon the addition of Nt.AlwI, the cleavage strand s3 of HP1 was released to form s3 DNA/HP2 complex and a little of the cleavage strand s2 DNA could be seen with background intensity (lane 6). However, once adenosine and Nt.AlwI were introduced simultaneously, two new, low molecular weight bands corresponding to s1 and the cleaved fragments s2 sequences were observed and the brightness of the hairpin DNA bands gradually decreased due to cyclic enzyme cleavage (lane 7). As be expected, the s2 band produced by cascade multiple cycle amplification reaction without HP2 probe (lane 8) was much darker than that in lane 7, indicating that more s2 DNA can be produced for further amplification in the presence of the second NESA. These PAGE results demonstrate that the target-triggering cascade multiple cycle amplification can work well. To further demonstrate the effective HCR amplification in the second step, the agarose gel electrophoresis was carried out (Figure S1B, supporting information). Lanes 17



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 30

1, 2, 3, and 4 in the 1.5 % agarose gel were loaded with AP1, AP2, a mixture of AP1 and AP2, and DNA marker, respectively. Only one band of auxiliary probes AP1 (lane 1) and AP2 (lane 2) in first two lanes was observed. Instead, the mixture of AP1 and AP2 exhibits a continuous broad band (lane 3) that demonstrates a wide distribution of dsDNA polymers. The dsDNA polymers formed with a maximum length above 500 base pairs, which was shown to be sufficient for signal amplification.47 Electrochemical Characterizations. The fabrication process of the SPR aptasensor was characterized by cyclic voltammetry (CV) and the resulting voltammograms are displayed in Figure 3A. The redox couple of [Fe(CN)6]3−/4−, which is sensitive to surface chemistry, is used to indicate the electrochemical behaviors of the sensor at different stages. A couple of quasi-reversible, well defined redox peaks of [Fe(CN)6]3−/4− are observed on a bare gold chip (curve a). Addition of the capture probe (CP) layer results in a smaller current response (curve b), mainly due to the electrostatic repulsion between the negative charges of the DNA backbone and [Fe(CN)6]3−/4−. After surface blocking with MCH, the peak current further decreases due to the passivation of the active sites of gold electrode by assembled MCH which blocks the electron communication of ferricyanide with the electrode (curve c).48 As expected, the current response decreases further (curves d and e) after binding with the DNA s1 obtained by multiple DNA cycle working modes, followed by subsequent HCR, due to introduction of more negative charges on the gold surface upon formation of the dsDNA polymers. Further conjugating with the Au NPs-SA howeve, results in increased current response (curve f), which implies that the conductive 18


Page 19 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Au NPs accelerates the electron transfer of the electrochemical probe. The stepwise reactions occurring on the surface of gold chip were also confirmed by electrochemical impedance spectroscopy. As shown in Figure 3B, the bare gold electrode exhibits a very small semicircle domain with electron transfer resistance (Ret) of about 275.1 Ω (curve a). Nevertheless, after immobilization of capture probe CP on the electrode, a big semicircle with Ret of about 2.95 KΩ is obtained (curve b), indicating the anchoring of thiolated molecules on the electrode surface. MCH treatment preduces a further increase in the electron transfer impedance (Ret=8.11 KΩ, curve c). On hybridization with HCR primer probe DNA s1 obtained by multiple DNA machine amplification in the presence of 10 pM adenosine, the diameter of the semicircle decreases again with Ret value of about 16.41 KΩ (curve d) since the DNA duplex has been formed. Following the subsequent HCR, a remarkable increase of the interfacial resistance to 26.48 KΩ is observed (curve e), mainly due to introduction of more negative charges on the gold surface upon formation of the dsDNA polymers. After further conjugating with the Au NPs-SA, the Ret obviously decreases (curve f). Both the CV and EIS results demonstrate that the sensing interface has been fabricated successfully according to Scheme 1.

19



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 30

Figure 3. (A) Cyclic voltammograms and (B) Nyquist plots of the different SPR sensor surfaces in a PBS solution (10 mM, pH 7.4) containing 5 mM [Fe(CN)6]3−/4− and 0.1 M KCl. (a) Bare gold chip, (b) CP/gold chip, (c) MCH/CP/gold chip, (d) s1/MCH/CP/gold chip (e) (AP1/AP2)n/s1/MCH/CP/gold chip and (f) Au NP-SA/(AP1/AP2)n/s1/ MCH/CP/gold chip. The inset is the equivalent circuit used to model the impedance data in the presence of the redox couple. Rs, Zw, Ret and Cdl represent the solution resistance, the Warburg diffusion resistance, the electron-transfer resistance, and the double-layer capacitance, respectively. Optimization of Experimental Conditions for Adenosine Detection. In the adenosine analysis, the cascade multiple DNA cycle amplification reaction is essential. To establish optimum conditions for the adenosine analysis, the cascade multiple DNA cycle amplification reaction conditions were systematically investigated. First, the concentration of Nt.AlwI plays an important role in the sensing process. To investigate the effect of the concentration of Nt.AlwI, the aptamer/s1 dsDNA, HP1, HP2 and adenosine were mixed with different concentrations of Nt.AlwI ranging from 0 U to 15 U, 20


Page 21 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the SPR angle shifts are plotted as a function of the NEase concentration as shown in Figure 4A. The SPR response increases with increasing the concentration of Nt.AlwI, implying enhanced release of trigger DNA s2 through the cleavage reaction. Meanwhile, it can be observed that the background signal also increases with increasing the concentration of Nt.AlwI. The results indicate that the optimum concentration of Nt.AlwI is 10 U by considering the signal-to-noise level. Second, as the sensitivity of the detection will be improved with the process of the cascade multiple DNA cycle amplification reaction, we recorded the changes of the SPR angles generated by operating the machine system at different cleavage time intervals with and without the addition of target adenosine into the system. As shown in Figure 4B, in the presence of adenosine, the SPR signal elevates at a fast rate in the initial stage and followed by a slow increase after 120 min. However, the background maintains its increase signal even after 120 min. Therefore, for best signal-to-noise level, 120 min is selected for the cleavage reaction. In order to obtain higher sensitivity, the HCR duration time was investigated. The results are shown in Figure 4C. It is clear that the SPR signal increases with the augment of the reaction duration from 0 to 90 min since more biotin labeled probe can be immobilized on SPR chip which captures more Au NP-SA, results in continuous increase in SPR signal. Therefore, 90 min is chosen as the reaction duration for HCR.

21



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 30

Figure 4. The SPR angle shifts were plotted as a function of the NEase concentration (A), the nicking time (B) and the hybridization chain reaction time (C) in the presence or in the absence of 10 pM adenosine. Analytical Performance for Adenosine Detection. The sensitivity of the fabricated SPR DNA biosensor based on cascade multiple DNA cycle amplification strategy was investigated using target adenosine with different concentrations. As shown in Figure 5A, the SPR angle shift increases when the concentration of target adenosine is increased from 0 to 50 pM, indicating that amount of Au NPs-SA captured on the SPR chip is highly dependent on the concentration of adenosine. This also confirms the working principle that the target adenosine interacts with the aptamer to trigger the cascade multiple DNA cycle amplification reaction. Figure 5B shows the SPR angle shift as a function of the concentration of the target adenosine. Under the optimal conditions, the SPR angle shift shows a good linear correlation with the target adenosine concentration ranging from 0.005 to 0.5 pM and 1 to 20 pM with a detection limit as low as 4 fM. The detection limit of this method is much lower than the structure-switching aptamer and reporter probe DNA modified Au NPs-based electrochemical method (180 pM),49 fluorescent detection with target-responsive DNA strand displacement system via toehold 22


Page 23 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mediated click chemical ligation (3.4 µM),50 fluorescent aptasensor for adenosine assay based on Exo III assisted signal amplification (1nM),51 and the aptamer and Au NPs amplification based-SPR assay (1 nM)39. The detailed comparison of our strategy with other methods is illustrated in Table S1 (Supporting Information). The results above demonstrate that this signal amplification method is efficient for ultrasensitive SPR detection of adenosine.

Figure 5. (A) SPR angle shift corresponding to the analysis of different concentrations of target adenosine. The concentrations of target adenosine for the curves (a) to (k) are: (a) 0 M, (b) 0.005 pM, (c) 0.01 pM, (d) 0.05 pM, (e) 0.1 pM, (f) 0.5 pM, (g) 1 pM, (h)5 pM, (i)5 pM, (j)10 pM, (i)20 pM and (k)50 pM. (B) Calibration curve corresponding to the SPR currents for variable concentration of target adenosine. Inset shows the linear relationship between the SPR angle shift and the concentration of the target adenosine. Application of the Sensor in Biological Samples. To explore the sensors’ potential applications in biologically relevant sample analysis, the proposed sensors were used to detect adenosine in human serum (Table 1). For comparison, HPLC was conducted for 23



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 30

the analysis of the same sample (Figure S2, the details for HPLC detection are described in the Supporting Information). The results, in comparison with those of the HPLC method, are listed in Table 1, which show good agreement with each other. After the serum sample 2 and 4 were spiked with 5 pM and 10 pM adenosine, the recoveries for three detections were 98% ± 4.1% and 94% ± 3.6% for 5 pM adenosine and 104% ± 5.4% and 98% ± 3.1% for 10 pM adenosine, respectively, indicating acceptable accuracy of the method for quantification of adenosine in complex biological fluids. Table 1. Comparisons of the Proposed Method with the HPLC Method for the Detection of Adenosine in Human Serum Sample proposed method (µM)

RSD (%)

HPLC method (µM)

RSD (%)

1

0.95

4.8

0.99

3.6

2

0.69

3.8

0.68

2.3

3

0.92

4.1

0.94

3.4

4

0.89

2.9

0.93

3.3

5

0.90

4.7

0.97

3.3

Selectivity of the Biosensor. The selectivity of the sensing system is another important parameter for a biosensor. An excellent biosensor should not only possess a good sensitivity but should also have a good selectivity. In order to detect the selectivity of the present biosensor, we chose three kinds of compounds (uridine, cytidine, and guanosine), which belong to the nucleosides family and have the structure similar to that of adenosine. The system only shows a remarkable SPR response in the presence of adenosine. Nevertheless, in the presence of three other kinds of nonspecific targets, the SPR

24


Page 25 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


response is negligible (Figure 6), demonstrating that the SPR signal is specifically triggered by the aptamer/target binding for parallel samples. These results confirm that the developed strategy has sufficient specificity and adenosine can be identified with high selectivity.

Figure 6. SPR angle shifts at 10 pM of adenosine (a), cytidine (b), guanosine (c), and uridine (d).

CONCLUSIONS This work has designed an SPR platform for ultrasensitive adenosine detection based on the cascade multiple DNA cycle amplification strategy and Au NPs amplification of SPR signal. The Nt.AlwI assisted cleavage process can produce a large number of cleaved s2 fragments with the initiation of a few target adenosines, which then act as the primers of the HCR to initiate the reaction of the HCR for realizing the capture of numerous Au NP-SA, thus induce significant enhancement of the SPR signals. By integrating multiple DNA cycle, nanobiotechnology, and SPR detection, this novel cascade multiple DNA cycle amplification can detect adenosine with the detection limit down to 4 fM with high selectivity to difference nucleosides family. The high sensitivity and selectivity of this 25



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 30

strategy might be attributed to follow factors: (1) Numerous Au NPs-SA are captured on the SPR chip through cascade multiple DNA cycle amplification and then offer a dramatically increase the sensitivity; (2) High specificity of aptamers to target much favors for the selectivity improvement of the SPR assays. This primary research opens new horizons for integrating different disciplines. Moreover, the current strategy may be extended for the detection of aptamer binding molecules and combined with other detection tools. This method provides a versatile tool in detecting biomolecules with trace amounts in bioanalysis and clinical biomedicine. ASSOCIATED CONTENT Supporting Information The gel electrophoresis characterizations of the target-triggering cascade multiple cycle amplification reaction (Figure S1A) and the HCR amplification reaction (Figure S1B), the calibration curve for the determination of adenosine with HPLC method (Figure S2), and detection performance comparison of our strategy with other methods (Table S1). This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author *E-mail: [email protected] Notes The authors declare no competing financial interest. 26


Page 27 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ACKNOWLEDGEMENTS This work was supported by grants from the National Natural Science Foundation of China (21163014 and 21265012) and the Program for New Century Excellent Talents in University (NCET-11-1002 and NCET-13-0848).

REFERENCES (1) Wood, S. L.; Knowles, M. A.; Thompson, D.; Selby, P. J.; Banks, R. E. Nat. Rev. Urology 2013, 10, 206-218. (2) Sawyers, C. L. Nature 2008, 452, 548-552. (3) Herr, J. K.; Smith, J. E.; Medley, C. D.; Shangguan, D.; Tan, W. Anal. Chem. 2006, 78, 2918-2924. (4) Li, H. X.; Rothberg, L. J. J. Am. Chem. Soc. 2004, 126, 10958-10961. (5) Song, S.; Qin, Y.; He, Y.; Huang, Q.; Fan, C.; Chen, H. Y. Chem. Soc. Rev. 2010, 39, 4234-4243. (6) Lei, J.; Ju, H. Chem. Soc. Rev. 2012, 41, 2122-2134. (7) Divsar, F.; Ju, H. Chem. Commun. 2011, 47, 9879-9881. (8) Bae, S. W.; Cho, M. S.; Hur, S.-S.; Chae, C.-B.; Chung, D. S.; Yeo, W.-S.; Hong, J.-I. Chem.-Eur. J. 2010, 16, 11572-11575. (9) Liu, G.; Wan, Y.; Gau, V.; Zhang, J.; Wang, L.; Song, S.; Fan, C. J. Am. Chem. Soc. 2008, 130, 6820-6825. (10) Li, D.; Shlyahovsky, B.; Elbaz, J.; Willner, I. J. Am. Chem. Soc. 2007, 129, 5804-5805. (11) Gao, W.; Dong, H.; Lei, J.; Ji, H.; Ju, H. Chem. Commun. 2011, 47, 5220-5222. (12) Nam, J.-M.; Thaxton, C. S.; Mirkin, C. A. Science 2003, 301, 1884-1886. (13) Zhang, S.; Zhong, H.; Ding, C. Anal. Chem. 2008, 80, 7206-7212. (14) Wu, Y.; Chen, C.; Liu, S. Anal. Chem. 2009, 81, 1600-1607. (15) Bakalova, R.; Zhelev, Z.; Ohba, H.; Baba, Y. J. Am. Chem. Soc. 2005, 127, 27



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 30

9328-9329. (16) Ji, H.; Yan, F.; Lei, J.; Ju, H. Anal. Chem. 2012, 84, 7166-7171. (17) Zhao, C. ; Wu, L. ; Ren, J. ; Qu, X. Chem. Commun. 2011, 47, 5461-5463. (18) Wang, S. ; Fu, B. ; Wang, J. ; Long, Y. ; Zhang, X. ; Peng, S. ; Guo, P. ; Tian, T. ; Zhou, X. Anal. Chem. 2014, 86, 2925-2930. (19) Huang, Y.; Chen, J.; Zhao, S.; Shi, M.; Chen, Z.-F.; Liang, H. Anal. Chem. 2013, 85, 4423-4430. (20) Connolly, A. R.; Trau, M. Angew. Chem. Int. Ed. 2010, 49, 2720-2723. (21) Liu, S.; Lin, Y.; Wang, L.; Liu, T.; Cheng, C.; Wei, W.; Tang, B. Anal. Chem. 2014, 86, 4008-4015. (22) Liu, S.; Wang, C.; Zhang, C.; Wang, Y.; Tang, B. Anal. Chem. 2013, 85, 2282-2288. (23) Freeman, R.; Liu, X.; Willner, I. Nano Lett. 2011, 11, 4456-4461. (24) Gao, Y.; Li, B. Anal. Chem. 2013, 85, 11494-11500. (25) Xu, W.; Xue, X.; Li, T.; Zeng, H.; Liu, X. Angew. Chem. Int. Ed. 2009, 48, 6849-6852. (26) Chen, J.; Zhang, J.; Li, J.; Fu, F.; Yang, H.-H.; Chen, G. Chem. Commun. 2010, 46, 5939-5941. (27) Xue, L.; Zhou, X.; Xing, D. Anal. Chem. 2012, 84, 3507-3513. (28) He, P.; Zhang, Y.; Liu, L.; Qiao, W.; Zhang, S. Chem. Eur. Jo. 2013, 19, 7452-7460. (29) Ye, S.; Yang, Y.; Xiao, J.; Zhang, S. Chem. Commun. 2012, 48, 8535-8537. (30) Huang, J.; Wu, Y.; Chen, Y.; Zhu, Z.; Yang, X.; Yang, C. J.; Wang, K.; Tan, W. Angew. Chem. Int. Ed. 2011, 50, 401-404. (31) Homola, J. Chem. Rev. 2008, 108, 462-493. (32) Wang, Y.; Dostalek, J.; Knoll, W. Anal. Chem. 2011, 83, 6202-6207. (33) Kwon, M. J.; Lee, J.; Wark, A. W.; Lee, H. J. Anal. Chem. 2012, 84, 1702-1707. (34) Zayats, M.; Pogorelova, S. P.; Kharitonov, A. B.; Lioubashevski, O.; Katz, E.; Willner, I. Chem.-Eur. J. 2003, 9, 6108-6114. 28


Page 29 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(35) Devries, E. F. A.; Schasfoort, R. B. M.; Vanderplas, J.; Greve, J. Biosens. Bioelectron. 1994, 9, 509-514. (36) Wink, T.; van Zuilen, S. J.; Bult, A.; van Bennekom, W. P. Anal. Chem. 1998, 70, 827-832. (37) Zayats, M.; Raitman, O. A.; Chegel, V. I.; Kharitonov, A. B.; Willner, I. Anal. Chem. 2002, 74, 4763-4773. (38) Lin, K. Q.; Lu, Y. H.; Chen, J. X.; Zheng, R. S.; Wang, P.; Ming, H. Opt. Express 2008, 16, 18599-18604. (39) Wang, J.; Zhou, H. S. Anal. Chem. 2008, 80, 7174-7178. (40) Liang, R. P.; Yao, G. H.; Fan, L. X.; Qiu, J. D. Anal. Chim. Acta 2012, 737, 22-28. (41) Wang, L.; Zhu, C.; Han, L.; Jin, L.; Zhou, M.; Dong, S. Chem. Commun. 2011, 47, 7794-7796. (42) Lee, E. G.; Park, K. M.; Jeong, J. Y.; Lee, S. H.; Baek, J. E.; Lee, H. W.; Jung, J. K.; Chung, B. H. Anal. Biochem. 2011, 408, 206-211. (43) Pelossof, G.; Tel-Vered, R.; Liu, X.-Q.; Willner, I. Chem-Eur. J. 2011, 17, 8904-8912. (44) Ambrosi, A.; Castaneda, M. T.; Killard, A. J.; Smyth, M. R.; Alegret, S.; Merkoci, A. Anal. Chem. 2007, 79, 5232-5240. (45) Niu, Y.; Zhao, Y.; Fan, A. Anal. Chem. 2011, 83, 7500-7506. (46) Li, F.; Feng, Y.; Liu, S.; Tang, B. Chem. Commun. 2011, 47, 6347. (47) Yang, L.; Zhang, C.; Jiang, H.; Li, G.; Wang, J.; Wang, E. Anal. Chem. 2014, 86, 4657-4662. (48) Zhang, S.; Hu, R.; Hu, P.; Wu, Z. S.; Shen, G. L.; Yu, R. Q. Nucleic Acids Res. 2010, 38, e185-e185. (49) Zhang, S.; Xia, J.; Li, X. Anal. Chem. 2008, 80, 8382-8388. (50) Oishi, M.; Nakao, S.; Kato, D. Chem. Commun. 2014, 50, 991. (51) Hu, P.; Zhu, C.; Jin, L.; Dong, S. Biosens. Bioelectron. 2012, 34, 83-87. 29



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 30

For TOC only

30


Target-Triggering Multiple-Cycle Amplification Strategy for

Recommend Documents