tBHQ-Induced HO-1 Expression Is Mediated by Calcium through

Mar 28, 2011 - for 10 min. The 5. 0 and 3. 0 primers used for amplifying HO-1 were 5. 0 ... using a semidry transfer system (Fisher Scientific, Pittsb...
0 downloads 0 Views 2MB Size
Download PDF
ARTICLE pubs.acs.org/crt

tBHQ-Induced HO-1 Expression Is Mediated by Calcium through Regulation of Nrf2 Binding to Enhancer and Polymerase II to Promoter Region of HO-1 Ka Lung Cheung,† Siwang Yu,‡ Zui Pan,§ Jianjie Ma,§ Tien Yuan Wu,† and Ah-Ng Tony Kong*,‡ †

Graduate Program in Pharmaceutical Science and ‡Department of Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers, The State University of New Jersey, 160 Frelinghuysen Road, Piscataway, New Jersey 08854, United States § Department of Physiology & Biophysics, Robert Wood Johnson Medical School, Piscataway, New Jersey 08854, United States ABSTRACT: Induction of Nrf2-mediated detoxifying/antioxidant enzymes is an effective strategy for cancer chemoprevention. The goal of this study was to examine the role of calcium [Ca2þ] in regulating a well-known phenolic chemopreventive compound tertiary-butylhydroquinone (tBHQ) activation of Nrf2 and induction of Nrf2 downstream target gene heme-oxygenase (HO-1). tBHQ alone caused Nrf2 nuclear localization and induced HO-1 mRNA and protein expression in a dose-dependent manner. Using RT-PCR and Western blotting, we showed that tBHQ-induced transcription of HO-1 is Ca2þ-dependent. Chelation of [Ca2þ]ext or [Ca2þ]intra by EGTA or BAPTA attenuated tBHQ-induced HO-1. Cotreatment of tBHQ with inhibitors of [Ca2þ]-sensitive protein kinase C and camodulin kinase did not attenuate HO-1 induction. Nuclear translocation of Nrf2 induced by tBHQ was also not affected by treatment of EGTA or BAPTA. Additionally, EGTA and BAPTA treatments decreased basal nuclear phosphorylation of CREB and decreased tBHQ-induced Nrf2-CBP binding and Nrf2 binding to enhancer as well as polymerase II binding to the promoter of HO1 gene. Furthermore, tBHQ in combination with higher [Ca2þ]ext augmented HO-1 induction both in vitro and in vivo, indicating that the modulation of [Ca2þ]int could be used as an adjuvant to increase the efficacy of chemopreventive agents. Taken together, our results indicated that in addition to tBHQ-induced oxidative stress-mediated Nrf2 translocation, HO-1 induction by tBHQ also appears to be dependent on a series of Ca2þ-regulated mechanisms.

’ INTRODUCTION Numerous studies have demonstrated that phenolic antioxidants protect against chemical-induced toxicity and carcinogens.1 The cancer chemopreventive effect is typically mediated by the activation of NF-E2-related factor-2 (Nrf2) and induction of detoxifying/antioxidant genes through the antioxidant response element (ARE). Nrf2 is a prominent target for drug discovery, and Nrf2 activating agents are tested in clinical trials for chemoprevention. It is generally accepted that up-regulation of Nrf2-mediated genes is an effective strategy for cancer chemoprevention through detoxification of carcinogens,2 prevention of oxidative damage,3 and delay of the progress of inflammation-induced cancer. For example, Nrf2 is important for cellular protection against oxidative stress and chemical-induced liver damage and thus prevention of hepatocellular carcinoma.4 This increased tolerance to oxidative stress conferred by Nrf2 is consistently observed in different species, from fruit flies, mice, to humans.5 Moreover, mice lacking Nrf2 are shown to be more susceptible to dextran sulfate sodium (DSS)-induced colitis.6 It is suggested that Nrf2 regulates the expression of proinflammatory cytokines through induction of phase II detoxifying/antioxidant enzymes and thus play an important role in regulating the progress of inflammation. r 2011 American Chemical Society

tertiary-Butylhydroquinone (tBHQ) is a metabolite of butylated hydroxyanisole (BHA), and both are widely used to study the mechanisms of the chemopreventive effect of phenolic antioxidants. tBHQ is an effective compound blocking LPSinduced TNF production in macrophages and chemical-induced carcinogenesis.7 tBHQ is also shown to be effective in skin tumor prevention in vivo.8 These chemopreventive effects of tBHQ can be attributed to its strong induction of Nrf2-regulated genes, for example, HO-1 and NAD(P)H dehydrogenase quinone 1 (NQO-1). HO-1 catalyzes the degradation of heme to biliverdin and carbon monoxide (CO), both of which have been shown to exhibit antioxidative and anti-inflammatory effects.9 NQO-1 protects cells against reactive semiquinones by converting exogenous quinines into hydroquinones via single-step two-electron reduction. NQO-2, another cytosolic enzyme induced by tBHQ, catalyzes the metabolic reduction of quinones and protects against chemical carcinogenesis.10 The mechanisms of Nrf2 activation induced by tBHQ have been widely investigated. In HepG2 cells, tBHQ treatment Received: December 16, 2010 Published: March 28, 2011 670

dx.doi.org/10.1021/tx1004369 | Chem. Res. Toxicol. 2011, 24, 670–676

Chemical Research in Toxicology

ARTICLE

induced HO-1 expression through increased production and increased nuclear translocation of Nrf2.11 There are several mechanisms for the nuclear translocation of Nrf2. One possible mechanism is through Keap1-sensing mechanisms. The most recent discovery is that Keap1 possesses three distinct sensors to perceive stress caused by different endogenous signaling molecules nitric oxide, zinc, and alkenals.12 In terms of electrophile (tBHQ)-induced stress, cystein151 in Keap1 plays a major role in sensing, leading to Keap1's disassociation from Cul3 and the inability to form a functional E3 ubiquitin ligase complex, therefore inhibiting the Keap1-dependent ubiquitination of Nrf2.13 On the other hand, phosphorylation of Nrf2 can lead to its dissociation from Keap1 and nuclear translocation as well. Activated mitogen-activated protein kinases (MAPKs) including JNK, ERK, and p38 have been shown to play an important role in Nrf2 nuclear translocation in response to stress.14 Recent findings indicate that other protein kinases such as protein kinase C (PKC)15,16 and casein kinase (CKII)17 can also phosphorylate Nrf2 and lead to its nuclear translocation leading to induction of phase II/detoxifying genes. It should be noted that the regulatory feature of HO-1 is a bit different from other Nrf2-ARE-regulated genes. AREs in most Nrf2 target genes are located in proximity to the transcriptional initiation sites, whereas inducible expression of the HO-1 gene utilizes two distal enhancers, E1 and E2, which harbor multiple AREs and are located approximately 4 and 10 kb, respectively, upstream of the transcriptional initiation site.18 Increasing evidence has shown that apart from Nrf2 nuclear translocation, coactivators/suppressors play equally important roles in mediating the induction of Nrf2-regulated genes. Generally, coactivators/suppressors found to be interacting with Nrf2 include MafK/F/G,19 JUN-B/C/D,20 ATF-3/4,21,22 CREB, and CBP.23 Interaction of Nrf2 with different coactivators/suppressors often leads to different responses or outcomes, which could be induction or suppression of genes. For example, Nrf2/small Mafs complexes are shown to be associated with induction of genes, while Nrf2/JunD complex has been associated with a silencing effect. It is common to see competition between Nrf2 and other transcription factors for the limited coactivators. For example, NFκB could antagonize the Nrf2-ARE pathway through deprivation of CBP from Nrf2, which results in decrease of Nrf2 transactivity.24 Strategies for enhancing expression of Nrf2-regulated genes serve to be promising in chemoprevention. Diverse compounds that show Nrf2 activation and chemopreventive effects are potentially calcium-regulated (unpublished data). Calcium (Ca2þ) has been implicated to play important roles in inhibiting carcinogenesis. Here, we report that calcium regulates tBHQ-induced Nrf2 activation and HO-1 induction. We showed that Nrf2 nuclear translocation induced by tBHQ appears to be calcium independent while binding of Nrf2 and CBP, binding of Nrf2 to E2 enhancer, and polymerase II (Pol II) to promoter region of HO-1 is calcium-regulated. Furthermore, by increasing extracellular calcium ([Ca2þ]ext) and thus intracellular calcium ([Ca2þ]int), HO-1 induced by tBHQ can be further enhanced.

hepatoma, HepG2 cells stabilized with pARE-TI-luciferase construct for reporter assay using the FuGENE 6 method, as described previously26) cells were maintained in DMEM medium supplemented with 10% fetal bovine serum, 1.17 mg/mL sodium bicarbonate, 100 units/mL penicillin, 100 μg/mL streptomycin, 1% essential amino acids, and 0.1% insulin in a humidified atmosphere of 5% CO2 at 37 °C. The cells were seeded in six-well plates and allowed to grow up to 70% confluence before treatments. tBHQ was purchased from Sigma (St. Louis, MO) and dissolved in DMSO. Polyclonal antibodies against Nrf2 (C-20), HO-1 (C-20), GST1M1 (C-15), CREB-1 (240), pCREB-1 (Ser-133), CBP (C-20), and actin (I-19) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Measurement of [Ca2þ]int. HT-29 cells were cultured and prepared for measurement of [Ca2þ]int with fura-2AM (Invitrogen). Briefly, HT-29 cells were loaded with 10 μM fura-2AM for 45 min at 37 °C and allowed to de-esterify for 15 min at 25 °C. Cells were then harvested and resuspended in balanced salt solution (BSS) containing the following (in mM): 140 NaCl, 2.8 KCl, 2 CaCl2, 2 MgCl2, and 10 HEPES, pH 7.2. A 2.5  106 amount of cells was transferred into the cuvette system of a PTI spectrofluorometer (Photon Technology International, Princeton, NJ), and changes in [Ca2þ]int were measured as changes in the ratio of Fura-2 fluorescence at excitation wavelength of 350 (F350) and 380 nm (F380), following exposure to various compounds. For measurement in 0.5 mM ethylene glycol tetraacetic acid (EGTA), cells were centrifuged and resuspended in BSS without CaCl2, and 0.5 mM EGTA was added immediately before recordings. All experiments were conducted at 25 ( 2 °C.

RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR). Total RNA was isolated using Trizol (Invitrogen, Carlsbad, CA). Total RNA samples were converted to single-stranded cDNA by the Superscript First-Strand Synthesis System III (Invitrogen), and the resulting cDNA was amplified by the PCR supermix kit (Invitrogen). PCR conditions are as follows: 94 °C for 10 min followed by cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 45 s, extension at 72 °C for 45 s, and a final extension at 72 °C for 10 min. The 50 and 30 primers used for amplifying HO-1 were 50 AGCATGTCCCAGGATTTGTC-30 and 50 -AAGGCGGTC TTAGC CTCTTC-30 ; for GSTM1, they were 50 -AACGCCATCTTGTGCTACATTGCC-30 and 50 -TGGCTTTAGTGCAGGGAAGGGTAA-30 . Actin was used as an internal control and was amplified with the 50 and 30 primers: 50 -TGTTACCAACTGGGACGACA-30 and 50 -TCTCAGC TGTGGTGGTGAAG-30 . PCR products were resolved on 1.5% agarose gels and visualized under UV lamps. Western Blotting. After treatments, cells were washed with icecold PBS (pH 7.4) and harvested with 200 μL of a whole cell lysis buffer (pH 7.4), containing 10 mM Tris-HCl, 50 mM sodium chloride, 30 mM sodium pyrophosphate, 50 mM sodium fluoride, 100 2 M sodium orthovanadate, 2 mM iodoacetic acid, 5 mM ZnCl2, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 0.5% Triton-X 100. Cell lysates were vigorously vortexed and incubated on ice for 30 min. The homogenates were centrifuged at 13000 rpm for 10 min at 4 °C, and the supernatants were collected. After equal amounts of the samples were mixed in loading buffer, followed by heating at 95 °C for 5 min, the samples were resolved in a 10% SDSpolyacrylamide gel electrophoresis at 200 V and transferred onto polyvinylidene difluoride (PVDF) membranes (Immobilon-P, Millipore, Bedford, MA) for 2 h at 200 mA, using a semidry transfer system (Fisher Scientific, Pittsburgh, PA). The membranes were blocked with 5% nonfat dry milk in TBST buffer (0.1% Tween 20 in TBS) for 1 h at room temperature and incubated with primary antibodies in 3% nonfat dry milk of TBST (1:1,000 dilution) for polyclonal antibodies or in 3% bovine serum albumin (BSA) of TBST for phospho-specific antibodies overnight at 4 °C. After hybridization with primary antibody, membranes were washed three times with TBST and then incubated with secondary antibody conjugated with

’ MATERIALS AND METHODS Cell Culture and Reagents. pARE-TI-luciferase reporter construct containing a single copy of the 41 base pair murine GST-Ya ARE and minimal TATAInr promoter has been described previously.25 HT29 (human colon carcinoma; ATCC) and HepG2-C8 (human 671

dx.doi.org/10.1021/tx1004369 |Chem. Res. Toxicol. 2011, 24, 670–676

Chemical Research in Toxicology

ARTICLE

horseradish peroxidase for 1 h at room temperature and washed with TBST three times. Final detection was performed with enhanced chemiluminescence Western blotting reagents (Amersham Pharmacia, Piscataway, NJ), and the bands were visualized with BioRad ChemiDoc XRS system (Hercules, CA).

150 mM NaCl, 10 mM NaF, 1% Triton X-100, 1 mM Na3VO4, 5% glycerol, and the protease inhibitor cocktail]. The beads were washed with lysis buffer, and the immunoprecipitates were analyzed by immunoblotting with proper antibodies. ChIP analysis was performed according to the protocol of Millipore. Briefly, the cells were fixed by 1% formaldehyde for 5 min at room temperature. Cells were then sonicated to prepare chromatin suspensions of 3001000 bp of DNA in length. IP analysis was carried out with control rabbit IgG, anti-Nrf2 (sc-13032; Santa Cruz), and anti-RNA Pol II (sc-899; Santa Cruz) antibodies. PCRs were carried out with Taq DNA polymerase. Primers (50 to 30 ) were as follows: human HO-1 E1, GCTGCCCAAACCACTTCTGT and GCCCTTTCACCTCCCACCTA; human HO-1 E2, TCCTTTCC CGAGCCACGTG and TCCGGACTTTGCCCCAGG; and human HO-1 promoter, CCAGAAAGTGGGCATCAGCT and GTCACATT TATGCTCGGCGG.27 Five percent of the chromatin DNA was also subjected to PCR analysis and indicated as input. Mice and Treatment. C57BL/6 mice were housed in sterile filtercapped cages and provided with diet and water ad libitum. The protocol for the animal study was approved by the Rutgers University Institutional Animal Care and Use Committee. Mice were fasted overnight and orally administered with tBHQ and CaCl2, dissolved in 50% polyethylene glycol 400 and 50% H2O. Twelve hours after administration, the mice were sacrificed by CO2 inhalation, and the small and large intestines were excised, frozen down in liquid nitrogen, and stored at 80 °C until analyses. Statistical Analysis. Data were evaluated by Student's test. P values of less than 0.05 were considered to be statistically significant.

Immunoprecipitation (IP) and Chromatin Immunoprecipitation (ChIP). In IP assays, MagnaBind protein G magnetic beads

(Thermo scientific)-conjugated antibodies were incubated with 500 μg of cell lysate in ice-cold lysis buffer [50 mM TrisHCl (pH 7.5),

Figure 1. tBHQ dose dependently induced Nrf2, HO-1, and GST proteins in HT-29 cells. HT-29 cells were treated with 0, 20, 50, 100, and 200 μM tBHQ for 4 h. The protein expression of Nrf2, HO-1, and GST increased dose dependently, with a maximal induction at 200 μM.

Figure 2. [Ca2þ]int measurement upon treatment with tBHQ, CaCl2, and EGTA. HT-29 cells were loaded with fura-2AM and treated with (a) tBHQ, (b) EGTA followed by tBHQ, (c) CaCl2, and (d) CaCl2 followed by tBHQ. 672

dx.doi.org/10.1021/tx1004369 |Chem. Res. Toxicol. 2011, 24, 670–676

Chemical Research in Toxicology

ARTICLE

’ RESULTS Increased Protein Expression of Nrf2, GSTM1, and HO-1 by tBHQ. Using HT-29 cells, we found that 24 h of treatment of

tBHQ up-regulated Nrf2 and Nrf2-regulated detoxifying/antioxidant genes including HO-1 and GSTM1 (Figure 1) in a dosedependent fashion. The maximal induction of HO-1 was observed at 200 μM. [Ca2þ]int in Response to tBHQ, EGTA, and CaCl2 Treatments. Next, we examined the effect of tBHQ treatment on calcium mobilization in HT-29. tBHQ (200 μM) treatment caused a transient increase in [Ca2þ]int (Figure 2A). EGTA was known to chelate [Ca2þ]ext and [Ca2þ]int decreased almost immediately after treatment (data not shown). Treatment of tBHQ after chelation of [Ca2þ]ext by EGTA still caused a transient increase in [Ca2þ]int (Figure 2B), suggesting the increase of [Ca2þ]int induced by tBHQ was not due to calcium influx. Next, we investigated how HT-29 mobilized calcium in response to CaCl2 (2 mM) and its combinations with tBHQ. [Ca2þ]int increased almost instantaneously after the addition of CaCl2 (Figure 2C). The addition of tBHQ after CaCl2 treatment did not show any difference as compared to CaCl2 treatment alone (Figure 2D). HO-1 Induced by tBHQ Was Calcium-Dependent. We observed that treatment of either EGTA (5 mM) or 1,2-bis(oaminophenoxy)ethane-N,N,N0 ,N0 -tetraacetic acid (BAPTA, calcium chelator, 10 μM) attenuated the induction of HO-1 and GSTM1 mRNA expression by tBHQ (200 μM) in HT-29 cells (Figure 3A). HO-1 protein induced by tBHQ was also attenuated with EGTA or BAPTA treatments (Figure 3B). The same effect was observed in HepG2 cells (Western blotting data not shown). In particular, BAPTA dose dependently inhibited ARE-luciferase expression induced by tBHQ in HepG2C8 cells (Figure 3C). Nuclear Translocation of Nrf2 Induced by tBHQ Was Calcium-Independent. BAPTA (10 μM) alone caused a small amount of nuclear translocation of Nrf2. tBHQ at 200 μM induced the maximal Nrf2 translocation, which was not attenuated by BAPTA or EGTA (5 mM) (Figure 4A). Pretreatment of inhibitors of [Ca2þ]-sensitive PKC (15 μM) or CaMK (510 μM) for 1 h before tBHQ treatment did not attenuate HO-1 induction (Figure 4B). Phosphorylation of Nucleus CREB, Nrf2-CBP Binding, and Binding of Nrf2 to HO-1 Enhancer and Pol II to HO-1 Promoter Region Were Calcium-Dependent. Next, we were therefore interested to know how calcium chelating treatments decreased tBHQ-induced HO-1, if not through inhibition of nuclear translocation of Nrf2. We investigated the calciumregulated coactivators of Nrf2 including CREB, pCREB, and CBP. CBP predominantly resided in the nucleus, and its expression remained unchanged after treatments (Western blotting data not shown). Both EGTA and BAPTA decreased nuclear CREB phosphorylation at Ser-133 (Figure 5A). We next investigated whether Nrf2-CBP binding was affected by calcium chelating treatments. Using IP assays, we found that tBHQ treatment showed maximal Nrf2-CBP binding, while chelating calcium by EGTA (5 mM) or BAPTA (10 μM) pronouncedly decreased the binding (Figure 5B), correlating with the decrease of nuclear pCREB. Human HO-1 contains two enhancers, E1 and E2, located at approximately 4 and 10 kb, respectively, upstream from the transcription start site. Human HO-1 promoter is commonly considered located in close proximity to the transcriptional

Figure 3. tBHQ induction of HO-1 and GST in HT-29 cells were [Ca2þ]int dependent. (a) HT-29 cells were treated with tBHQ (200 μM) and tBHQ þ BAPTA (10 μM) for 6 h. mRNA expression levels of HO-1 and GST were compared. (b) HT-29 cells were treated with EGTA (5 mM), BAPTA (10 μM), tBHQ (200 μM), tBHQ þ EGTA, and tBHQ þ BAPTA for 24 h. Protein expression levels of HO-1 were compared. EGTA and BAPTA alone had no effect on HO-1 protein induction, but they substantially attenuated tBHQ-induced HO-1 protein. (c) HepG2-C8 cells were pretreated with 2.5, 5, and 10 μM BAPTA for 1 h before tBHQ treatment for 24 h. BAPTA pretreatment dose dependently attenuated tBHQ-induced ARE-lucifearase in HepG2-C8 cells.

initiation site (400 to þ1).28 The primers used to amplify HO-1 promoter flanked the transcriptional initiation site and produced a band size of ∼60 bp. Using ChIP assays, we showed that tBHQ increased the binding of Nrf2 to E2 enhancer and PolII to the promoter regions of HO-1. EGTA and BAPTA treatments abolished the binding of Nrf2 to E2 and Pol-II to promoter of HO-1 (Figure 5C). Increasing [Ca2þ]ext Augments tBHQ-Induced HO-1 in Vitro and in Vivo. Because [Ca2þ]int regulates Nrf2-CBP binding and Nrf2-HO-1 enhancer as well as Pol-II -promoter binding, we speculated that tBHQ-induced HO-1 mRNA protein would be further enhanced by an increase of [Ca2þ]int. We next showed that treatment with CaCl2 alone (2 and 10 μM) did not induce HO-1 mRNA. However, the addition of CaCl2 further enhanced the induction of HO-1 mRNA by tBHQ, with a 673

dx.doi.org/10.1021/tx1004369 |Chem. Res. Toxicol. 2011, 24, 670–676

Chemical Research in Toxicology

ARTICLE

Figure 4. [Ca2þ]int chelating by EGTA and BAPTA decreased phosphorylation of nuclear CREB but not tBHQ-induced Nrf2 translocation. (a) Four hours after treatments, nuclear proteins were extracted. BAPTA (10 μM) slightly induced the Nrf2 translocation, and tBHQ (200 μM) induced a great amount of Nrf2 nuclear translocation. [Ca2þ]int chealating by EGTA (5 mM) and BAPTA did not attenuate Nrf2 translocation induced by tBHQ. (b) Specific inhibitors of calciumactivated kinases PKC (5 μM) and camodulin-kinase (CaMK, 10 μM) had no inhibition effect on HO-1 induction, as compared to BAPTA treatment.

maximum induction at 10 μM CaCl2 (Figure 6A). More importantly, this same effect was confirmed in vivo in both large and small intestines of C57BL/6 wild type mice (samples from four mice were pooled for each group; the same experiment was repeated twice). Administration of tBHQ (100 mg/kg) with 10 mM CaCl2 showed maximal HO-1 mRNA induction after 24 h (Figure 6B).

Figure 5. Nrf2-CBP binding was affected by [Ca2þ]. (a) [Ca2þ]int chealating by EGTA and BAPTA decreased the phosphorylation of nuclear CREB at Ser-133. The level of nuclear CREB and CBP was not affected by treatments. (b) A 400 μg amount of protein lysate was immunoprecipitated using Nrf2 antibody, and the level of CBP was determined by Western blot. [Ca2þ] chelating by EGTA (5 mM) and BAPTA (10 μM) disrupted Nrf2-CBP binding as shown in tBHQ treatment. (c) Nrf2 binds to the enhancer E1 and E2 regions of HO-1 and the Pol-II to promoter region of HO-1 after tBHQ treatment, but the binding of Nrf2 to E1 enhancer and Pol-II to promoter of HO-1 gene was attenuated by EGTA and BAPTA.

’ DISCUSSION tBHQ activates Nrf2 and induces HO-1 in many cell types. However, the potential of Nrf2 activation by tBHQ has not been studied in colon cells. We treated HT-29 cells with tBHQ and showed a dose-dependent increase in HO-1. In agreement with the results obtained in HepG2 cells,11 showing that tBHQ induced Nrf2 expression level as well as its nuclear translocation. Calcium has been shown to have an important role in cell growth and apoptosis and is greatly implicated in cancer development.29 It has been shown that activation of Nrf2 genes can up-regulate the expression of calcium-binding proteins,30 therefore studying the potential cross-talk between Nrf2 and calcium would be warranted. We postulate that [Ca2þ]ext and [Ca2þ]int levels may fine-tune the Nrf2-ARE signaling pathway, using tBHQ as the model compound. In this study, we showed that tBHQ did not cause calcium influx. However, an increase in [Ca2þ]int was observed after tBHQ treatment and was not affected by pretreatment with EGTA, suggesting that tBHQ might cause [Ca2þ]int release from internal storage such as endoplasmic reticulum, since tBHQ is an Ca2þ-ATPase inhibitor. The calcium flux with different treatments of EGTA, CaCl2, tBHQ, tBHQ þ EGTA, tBHQ þ CaCl2 in HT-29 cells was also investigated, and we found that EGTA decreased [Ca]int while CaCl2 increased [Ca]int. Calcium flux profiles did not show substantial changes when comparing tBHQ

alone and tBHQ with cotreatments. Interestingly, we found that chelation of [Ca2þ]int or [Ca2þ]ext abolished induction of Nrf2regulated genes (HO-1 and GSTM1) by tBHQ. This effect was consistently found in both HepG2C8 and HT-29 cells. However, tBHQ þ EGTA/BAPTA treatments did not show a pronounced decrease in Nrf2 nuclear translocation when compared to tBHQ treatment alone, suggesting that Nrf2 translocation induced by tBHQ appears to be calcium-independent. In addition, inhibition of calcium-regulated kinases (PKC and CaMK) did not decrease tBHQ-induced HO-1. These results suggest that nuclear translocation of Nrf2 induced by tBHQ could be largely due to its electrophilic nature and through an calcium-independent pathway. We next asked the question how [Ca2þ]int could affect transcriptional activity of Nrf2 without affecting its nuclear translocation. We observed that calcium chelation led to a decrease in nuclear phosphorylation of CREB. Many studies have indicated that CREB phosphorylation is calcium-regulated and is necessary for recruitment of CBP for transcription.31 In addition, studies also indicate that CBP acts as a coactivator of Nrf2.23 Therefore, we investigated how Nrf2-CBP binding 674

dx.doi.org/10.1021/tx1004369 |Chem. Res. Toxicol. 2011, 24, 670–676

Chemical Research in Toxicology

ARTICLE

Figure 6. (a) HO-1 mRNA was synergistically induced by tBHQ þ CaCl2. An increase in [Ca2þ]ext alone had no effect on HO-1 mRNA induction, but tBHQ þ CaCl2 further induced HO-1 mRNA. Densitometry analysis was based on two independent experiments. (b) Samples from four Nrf2 WT mice for each treatment were pooled and used. The induction of HO-1 mRNA in the small and large intestines was determined. HO-1 mRNA was synergistically induced by tBHQ þ CaCl2 in both large and small intestines. Densitometry analysis was based on two independent experiments.

changes in response to different treatments. Indeed, we showed that while tBHQ substantially increased Nrf2-CBP interaction, calcium chelation by EGTA and BAPTA abrogated the interaction. Studies have shown that an increase in cytosolic calcium in HT-29 cells leads to an increase in nuclear calcium and mitochondrial serve as storage for excessive calcium.32 It is possible that the nuclear calcium affects the binding between Nrf2 and CBP. We next examined the possibility that [Ca2þ]int could affect the binding of Nrf2 to DNA, thus affecting the transcription ability of Nrf2. Using ChIP assays, we confirmed that the binding of Nrf2 to the AREs in the E2 enhancer region of HO-1 and Pol-II to the promoter region of HO-1 induced by tBHQ treatment was attenuated by EGTA and BAPTA. Furthermore, we also tested whether we could further augment HO-1 induction by tBHQ by increasing [Ca2þ]ext. Increasing [Ca2þ]ext alone did not induce HO-1, while in combination with tBHQ, CaCl2 further enhanced HO-1 induction. Importantly, an in vivo short-term mouse study showed that the combination of tBHQ and Ca2þ augmented the expression of HO-1 mRNA expression in both small and large intestines. Taken together, an understanding of how calcium and Nrf2 interact or crosstalk will enable us to devise more effective chemoprevention strategies.

Funding Sources

This work was supported in part by National Institute of Health Grant R01 CA-073674-07.

’ ACKNOWLEDGMENT We thank all of the members in Dr. Tony Kong's lab for their helpful discussion and preparation of this manuscript. ’ REFERENCES (1) Chen, C., and Kong, A. N. (2004) Dietary chemopreventive compounds and ARE/EpRE signaling. Free Radical Biol. Med. 36, 1505–1516. (2) Garg, R., Gupta, S., and Maru, G. B. (2008) Dietary curcumin modulates transcriptional regulators of phase I and phase II enzymes in benzo[a]pyrene-treated mice: Mechanism of its anti-initiating action. Carcinogenesis 29, 1022–1032. (3) Frohlich, D. A., McCabe, M. T., Arnold, R. S., and Day, M. L. (2008) The role of Nrf2 in increased reactive oxygen species and DNA damage in prostate tumorigenesis. Oncogene 27, 4353–4362. (4) Marhenke, S., Lamle, J., Buitrago-Molina, L. E., Canon, J. M., Geffers, R., Finegold, M., Sporn, M., Yamamoto, M., Manns, M. P., Grompe, M., and Vogel, A. (2008) Activation of nuclear factor E2related factor 2 in hereditary tyrosinemia type 1 and its role in survival and tumor development. Hepatology 48, 487–496. (5) Sykiotis, G. P., and Bohmann, D. (2008) Keap1/Nrf2 signaling regulates oxidative stress tolerance and lifespan in Drosophila. Dev. Cell 14, 76–85. (6) Khor, T. O., Huang, M. T., Kwon, K. H., Chan, J. Y., Reddy, B. S., and Kong, A. N. (2006) Nrf2-deficient mice have an increased

’ AUTHOR INFORMATION Corresponding Author

*Tel: 732-445-3831, ext. 228. Fax: 732-445-3134. E-mail: [email protected]. 675

dx.doi.org/10.1021/tx1004369 |Chem. Res. Toxicol. 2011, 24, 670–676

Chemical Research in Toxicology

ARTICLE

susceptibility to dextran sulfate sodium-induced colitis. Cancer Res. 66, 11580–11584. (7) Ma, Q., and Kinneer, K. (2002) Chemoprotection by phenolic antioxidants. Inhibition of tumor necrosis factor alpha induction in macrophages. J. Biol. Chem. 277, 2477–2484. (8) auf dem Keller, U., Huber, M., Beyer, T. A., Kumin, A., Siemes, C., Braun, S., Bugnon, P., Mitropoulos, V., Johnson, D. A., Johnson, J. A., Hohl, D., and Werner, S. (2006) Nrf transcription factors in keratinocytes are essential for skin tumor prevention but not for wound healing. Mol. Cell. Biol. 26, 3773–3784. (9) Abraham, N. G., and Kappas, A. (2008) Pharmacological and clinical aspects of heme oxygenase. Pharmacol. Rev. 60, 79–127. (10) Wang, W., and Jaiswal, A. K. (2006) Nuclear factor Nrf2 and antioxidant response element regulate NRH:quinone oxidoreductase 2 (NQO2) gene expression and antioxidant induction. Free Radical Biol. Med. 40, 1119–1130. (11) Keum, Y. S., Han, Y. H., Liew, C., Kim, J. H., Xu, C., Yuan, X., Shakarjian, M. P., Chong, S., and Kong, A. N. (2006) Induction of heme oxygenase-1 (HO-1) and NAD[P]H:quinone oxidoreductase 1 (NQO1) by a phenolic antioxidant, butylated hydroxyanisole (BHA) and its metabolite, tert-butylhydroquinone (tBHQ) in primary-cultured human and rat hepatocytes. Pharm. Res. 23, 2586–2594. (12) McMahon, M., Lamont, D. J., Beattie, K. A., and Hayes, J. D. (2010) Keap1 perceives stress via three sensors for the endogenous signaling molecules nitric oxide, zinc, and alkenals. Proc. Natl. Acad. Sci. U.S.A.107, 18838–18843. (13) Zhang, D. D., Lo, S. C., Cross, J. V., Templeton, D. J., and Hannink, M. (2004) Keap1 is a redox-regulated substrate adaptor protein for a Cul3-dependent ubiquitin ligase complex. Mol. Cell. Biol. 24, 10941–10953. (14) Xu, C., Yuan, X., Pan, Z., Shen, G., Kim, J. H., Yu, S., Khor, T. O., Li, W., Ma, J., and Kong, A. N. (2006) Mechanism of action of isothiocyanates: the induction of ARE-regulated genes is associated with activation of ERK and JNK and the phosphorylation and nuclear translocation of Nrf2. Mol. Cancer Ther. 5, 1918–1926. (15) Numazawa, S., Ishikawa, M., Yoshida, A., Tanaka, S., and Yoshida, T. (2003) Atypical protein kinase C mediates activation of NF-E2-related factor 2 in response to oxidative stress. Am. J. Physiol. Cell Physiol. 285, C334–C342. (16) Bloom, D. A., and Jaiswal, A. K. (2003) Phosphorylation of Nrf2 at Ser40 by protein kinase C in response to antioxidants leads to the release of Nrf2 from INrf2, but is not required for Nrf2 stabilization/ accumulation in the nucleus and transcriptional activation of antioxidant response element-mediated NAD(P)H:quinone oxidoreductase-1 gene expression. J. Biol. Chem. 278, 44675–44682. (17) Apopa, P. L., He, X., and Ma, Q. (2008) Phosphorylation of Nrf2 in the transcription activation domain by casein kinase 2 (CK2) is critical for the nuclear translocation and transcription activation function of Nrf2 in IMR-32 neuroblastoma cells. J. Biochem. Mol. Toxicol. 22, 63–76. (18) Alam, J., and Cook, J. L. (2003) Transcriptional regulation of the heme oxygenase-1 gene via the stress response element pathway. Curr. Pharm. Des. 9, 2499–2511. (19) Li, W., Yu, S., Liu, T., Kim, J. H., Blank, V., Li, H., and Kong, A. N. (2008) Heterodimerization with small Maf proteins enhances nuclear retention of Nrf2 via masking the NESzip motif. Biochim. Biophys. Acta 1783, 1847–1856. (20) Venugopal, R., and Jaiswal, A. K. (1998) Nrf2 and Nrf1 in association with Jun proteins regulate antioxidant response elementmediated expression and coordinated induction of genes encoding detoxifying enzymes. Oncogene 17, 3145–3156. (21) Brown, S. L., Sekhar, K. R., Rachakonda, G., Sasi, S., and Freeman, M. L. (2008) Activating transcription factor 3 is a novel repressor of the nuclear factor erythroid-derived 2-related factor 2 (Nrf2)-regulated stress pathway. Cancer Res. 68, 364–368. (22) He, C. H., Gong, P., Hu, B., Stewart, D., Choi, M. E., Choi, A. M., and Alam, J. (2001) Identification of activating transcription factor 4 (ATF4) as an Nrf2-interacting protein. Implication for heme oxygenase-1 gene regulation. J. Biol. Chem. 276, 20858–20865.

(23) Katoh, Y., Itoh, K., Yoshida, E., Miyagishi, M., Fukamizu, A., and Yamamoto, M. (2001) Two domains of Nrf2 cooperatively bind CBP, a CREB binding protein, and synergistically activate transcription. Genes Cells 6, 857–868. (24) Liu, G. H., Qu, J., and Shen, X. (2008) NF-kappaB/p65 antagonizes Nrf2-ARE pathway by depriving CBP from Nrf2 and facilitating recruitment of HDAC3 to MafK. Biochim. Biophys. Acta 1783, 713–727. (25) Wasserman, W. W., and Fahl, W. E. (1997) Functional antioxidant responsive elements. Proc. Natl. Acad. Sci. U.S.A. 94, 5361–5366. (26) Yu, R., Mandlekar, S., Lei, W., Fahl, W. E., Tan, T. H., and Kong, A. N. (2000) p38 mitogen-activated protein kinase negatively regulates the induction of phase II drug-metabolizing enzymes that detoxify carcinogens. J. Biol. Chem. 275, 2322–2327. (27) Zhang, J., Ohta, T., Maruyama, A., Hosoya, T., Nishikawa, K., Maher, J. M., Shibahara, S., Itoh, K., and Yamamoto, M. (2006) BRG1 interacts with Nrf2 to selectively mediate HO-1 induction in response to oxidative stress. Mol. Cell. Biol. 26, 7942–7952. (28) Exner, M., Minar, E., Wagner, O., and Schillinger, M. (2004) The role of heme oxygenase-1 promoter polymorphisms in human disease. Free Radical Biol. Med. 37, 1097–1104. (29) Roderick, H. L., and Cook, S. J. (2008) Ca2þ signalling checkpoints in cancer: Remodelling Ca2þ for cancer cell proliferation and survival. Nat. Rev. Cancer 8, 361–375. (30) Lesniak, W., Szczepanska, A., and Kuznicki, J. (2005) Calcyclin (S100A6) expression is stimulated by agents evoking oxidative stress via the antioxidant response element. Biochim. Biophys. Acta 1744, 29–37. (31) Johannessen, M., Delghandi, M. P., and Moens, U. (2004) What turns CREB on?. Cell Signalling 16, 1211–1227. (32) Ricken, S., Leipziger, J., Greger, R., and Nitschke, R. (1998) Simultaneous measurements of cytosolic and mitochondrial Ca2þ transients in HT29 cells. J. Biol. Chem. 273, 34961–34969.

676

dx.doi.org/10.1021/tx1004369 |Chem. Res. Toxicol. 2011, 24, 670–676