Technical and Biological Issues Relevant to Cell Typing with Aptamers

Mar 9, 2009 - A number of aptamers have been selected against cell surface biomarkers or against eukaryotic tissue culture cells themselves. To determ...
0 downloads 9 Views 4MB Size
Download PDF
Technical and Biological Issues Relevant to Cell Typing with Aptamers Na Li,† Jessica N. Ebright,† Gwendolyn M. Stovall, Xi Chen, Hong Hanh Nguyen, Amrita Singh, Angel Syrett, and Andrew D. Ellington* Department of Chemistry and Biochemistry, Institute for Cell and Molecular Biology, University of Texas at Austin, Austin, Texas 78712 Received December 5, 2008

A number of aptamers have been selected against cell surface biomarkers or against eukaryotic tissue culture cells themselves. To determine the general utility of aptamers for assessing the cell surface proteome, we developed a standardized flow cytometry assay and carried out a comprehensive study with 7 different aptamers and 14 different cell lines. By examining how aptamers performed with a variety of cell lines, we identified difficulties in using aptamers for cell typing. While there are some aptamers that show excellent correlation between cell surface binding and the expression of a biomarker on the cell surface, other aptamers showed nonspecific binding by flow cytometry. For example, it has recently been claimed that an anti-PTK7 (protein tyrosine kinase 7) aptamer identified a new biomarker for leukemia cells, but data with the additional cell lines shows that it is possible that the aptamer instead identifies a propensity for adherence. Better understanding and controlling for the role of background and nonspecific binding to cells should open the way to using arrays of aptamers for describing and quantifying the cell surface proteome. Keywords: aptamer • in vitro selection • SELEX • biomarker • cancer • array • adherence

Introduction Being able to identify biomarkers on tumors, or to otherwise develop prognostic indicators for different tumors, would greatly impact cancer diagnosis and treatment. In this regard, the search for such tumor biomarkers is the focus of many current studies.1,2 Researchers have recently been aggressively seeking more diagnostic tumor markers through proteomics screens. It is also hoped that proteomics approaches will yield a combination of biomarkers that may be more diagnostic than a single tumor marker. Antibodies have historically been the predominant reagent of choice for protein biomarker detection, and their adaptation to microarrays is proceeding rapidly.3,4 Recently, however, selected nucleic acid binding species (aptamers) have proven useful as reagents for identifying and labeling cell surface markers.5 It has even been suggested that aptamers capable of binding cell surface proteins may be useful for typing cells.6 Aptamer arrays might be as readily constructed as gene expression microarrays, and thus could potentially be useful for proteomics research.7 This prompted us to question whether aptamers against cell surface proteins were in general useful reagents for labeling cells or for examining the expression of the cell surface proteome. While it is true that aptamers can be used to label cells, there are great differences in the abilities of anticell surface antigen aptamers to actually recognize proteins in the highly complex * Towhomcorrespondenceshouldbeaddressed.E-mail:andy.ellington@mail. utexas.edu. Phone: (512) 471-6445. Fax: (512) 471-7014. † These two authors contributed equally.

2438 Journal of Proteome Research 2009, 8, 2438–2448 Published on Web 03/09/2009

context of the cell surface. Just as antibodies can often prove idiosyncratic in their abilities to reliably label cells, caution must be taken when using aptamers as cell typing reagents. To better identify both the limitations and opportunities for using aptamers to explore the cell surface proteome, we carried out a comprehensive experiment with 7 aptamers and 14 cell lines. Our results suggest some simple, common sense rules for quantitatively using aptamers with cells and thereby avoiding identifying or misinterpreting background binding.

Materials and Methods Aptamers. The ssDNA aptamer sequences and the DNA templates for RNA aptamers shown in Table 1 were ordered from IDT (Integrated DNA Technologies, Coralville, IA) with an additional 24 nt sequence (5′-GAATTAAATGCCCGCCATGACCAG-3′) added to their 3′ end for labeling via hybridization. DNA templates for RNA aptamers also had a T7 promoter sequence (5′-TAATACGACTCACTATA-3′) added to their 5′ ends. 5′ Fluorescein-labeled and biotinylated complementary sequences (called a capture oligonucleotide, sequence ) 5′CTGGTCATGGCGGGCATTTAATTC-3′) were also ordered from IDT. ssDNA aptamers were diluted for use, while ssDNA templates for RNA aptamers were first PCR amplified using corresponding primers (see below) and then transcribed and gel-purified. Unmodified RNA aptamers were transcribed using an Ampliscribe kit (Epicenter, Madison, WI) and 2′-fluoropyrimidine-modified RNA aptamers were prepared using a Durascribe kit (Epicenter). 10.1021/pr801048z CCC: $40.75

 2009 American Chemical Society

research articles

Issues Relevant to Cell Typing with Aptamers Table 1. Aptamers Used in This Study name

selection target

cell assay target

A30

Human EGFR Related 3 (HER3)

MCF7

S1.3/S2.2

Mucin 1 (MUC1)

MCF7

E9P2-2

xPSM-A9

sga16

TD05 J18

a

b

Tenascin C (TNC)

Prostate Specific Membrane Antigen (PSMA) CCRF-CEM cells (binds PTK7 protein)

U251

LNCaP

CCRF-CEM

Ramos cells (binds IGHM protein)

Ramos

Epithelial Growth Factor Receptor (EGFR)

A431

Kd

composition

45 nM

0.135 nM

4 nM

5 nM

74.7 nM 7 nM

Kd determined using cells, not purified protein or peptide

b

ssDNA

GGGAGACAAGAATAAACGCTCAAGCAGTT GATCCTTTGGATACCCTGGTTCGACAGGAG GCTCACAACAGGC

20

GGGAGGACGAUGCGGUGCCCACUAUGCG UGCCGAAAAACAUUUCCCCCUCUACCCCA GACGACUCGCGCGA

21

GGGAGGACGAUGCGGACCGAAAAAGACCU GACUUCUAUACUAAGUCUACGUUCCCAGA CGACUCGCCCGA

16

TTTAAAATACCAGCTTATTCAATTAGTCACA CTTAGAGTTCTAGCTGCTGCGCCGCCGGG AAAATACTGTACGGATAGATAGTAAGTGCA ATCT

6, 27

AACACCGGGAGGATAGTTCGGTGGCTGTT CAGGGTCTCCTCCCGGTG

6, 29

RNA, 2′-Fluoro-Py

a

ssDNA

a

reference

GGGAAUUCCGCGUGUGCCAGCGAAAGUU GCGUAUGGGUCACAUCGCAGGCACAUGU CAUCUGGGCGGUCCGUUCGGGAUCCUC

RNA, 2′-Fluoro-Py

2.1 nM

sequence

RNA

ssDNA RNA

22

GGCGCUCCGACCUUAGUCUCUGCAAGAU AAACCGUGCUAUUGACCACCCUCAACACA CUUAUUUAAUGUAUUGAACGGACCUACGA ACCGUGUAGCACAGCAGA

Unpublished data.

Primers for the amplification of DNA templates are listed below, where the T7 promoter sequences are underlined and the binding sites for hybridization of fluorescein-labeled or biotinylated oligonucleotides are in italics: Anti-Her 3 (human EGFR related 3) aptamer (unmodified RNA): Forward primer: 5′-TAATACGACTCACTATAGGGAATTCC-3′ Reverse primer: 5′-CTGGTCATGGCGGGCATTTAATTCGAGGATCCCGAACGGACCGC-3′ Anti-TNC (Tenascin C) aptamer (2′-fluoropyrimidine-modified RNA): Forward primer: 5′-TAATACGACTCACTATAGGGAGGACGATGCGG-3′ Reverse primer: 5′-CTGGTCATGGCGGGCATTTAATTCTCGCGCGAGTCGTCTG-3′ Anti-PSMA (prostate specific membrane antigen) aptamer (2′-fluoropyrimidine-modified RNA): Forward primer: 5′-TAATACGACTCACTATAGGGAGGACGATGCGG-3′ Reverse primer: 5′-CTGGTCATGGCGGGCATTTAATTCTCGGGCGAGTCGTCTG-3′ Anti-EGFR (epidermal growth factor receptor) aptamer (unmodified RNA): Forward primer: 5′-TAATACGACTCACTATAGGCGCTCCGACCTTAGTCTCTG-3′ Reverse primer: 5′-CTGGTCATGGCGGGCATTTAATTCTCTGCTGTGCTACACGGTTC-3′ Aptamer Labeling. All RNAs were gel purified after transcription and quantitated by measuring the absorbance at 260 nm using a NanoDrop spectrophotometer (Thermo Scientific, Wilmington, DE). Three methods were used to label anti-EGFR aptamers with fluorophores. First, direct labeling of RNA was carried out by transcribing the double-stranded DNA template from the T7 Phi2.5 promoter using fluorescein-AMP as an initiator (Adegenix, Monrovia, CA). In detail, the DNA template

(5′-GGCGCTCCGACCTTAGTCTCTGCAAGATAAACCGTGCTATTGACCACCCTCAACACACTTATTTAATGTATTGAACGGACCTACGAACCGTGTAGCACAGCAGA-3′) was PCR amplified with a forward primer containing the T7 Phi2.5 promoter (5′- GATAATACGACTCACTATTAGGCGCTCCGACCTTAGTCTCTG-3′) and a reverse primer (5′-TCTGCTGTGCTACACGGTTC-3′). Transcription was carried out according to the recommended fluorescein-labeling conditions supplied by Adegenix.8,9 Second, for labeling through extension, an additional 24 nt sequence (5′-GAATTAAATGCCCGCCATGACCAG-3′) was added to the templates of RNA aptamers by PCR with an extended reverse primer (5′-CTGGTCATGGCGGGCATTTAATTCTCTGCTGTGCTACACGGTTC-3′). Extended double-stranded DNA was used as the template for transcription. Equal amounts of extended RNAs and 5′ fluorescein-labeled or biotinylated capture oligonucleotides were annealed by heating samples to 70 °C for 3 min and then slowly cooling them to 25 °C at the rate of 1 °C/s. RNAs annealed with fluorescein-labeled oligonucleotides were used for flow cytometry. Finally, RNAs annealed to biotinylated capture oligonucleotides were further incubated with streptavidin-phycoerythrin (SA-PE, Prozyme, San Leandro, CA) at a biotinylated capture oligonucleotide:SA-PE ratio of 2:1 for 15 min at 25 °C. This latter method was eventually used for all other aptamers. The unselected pool RNA (N62, the same pool from which the anti-EGFR aptamer was selected) was also labeled by the above three methods and used as a negative control for flow cytometry. Cell Culture. The cell lines used in this study are shown in Table 2. Cells were all purchased from ATCC (American type Culture Collection, Manassas, VA) except U251 which was obtained from the DCTD Tumor Repository, National Cancer Institute at Frederick (Frederick, MA), A4573 from the laboratory of Dr. Chris Denny at UCLA, and MDA-MB-435 from the laboratory of Dr. Konstantin Sokolov at University of Texas at Journal of Proteome Research • Vol. 8, No. 5, 2009 2439

research articles

Li et al.

Table 2. Cell Lines Used in This Study cell line

growth properties

disease

Ramos MDA-MB-435 LNCaP HL60 MCF7 A4573 CCRF-CEM KG1 K562 HeLa U251 A431 PC3 A549

Suspension Adherent Adherent Suspension Adherent Adherent Suspension Suspension Suspension Adherent Adherent Adherent Adherent Adherent

Burkitt’s lymphoma Breast ductal carcinoma Prostate carcinoma Acute promyelocytic leukemia Breast adenocarcinoma Ewing’s sarcoma Acute lymphoblastic leukemia (ALL) Acute myelogenous leukemia (AML) Chronic myelogenous leukemia (CML) Cervix adenocarcinoma Glioblastoma Epidermoid carcinoma Prostate adenocarcinoma Lung carcinoma

Austin. A549 cells were maintained at 37 °C and 5% CO2 in F-12K media supplemented with 10% FBS (Invitrogen, Carlsbad, CA). A4573, A431, and MDA-MB-435 were grown in DMEM media with 10% FBS. MCF7, U251, LNCaP, Ramos, CCRF-CEM, HeLa, PC3, HL60, KG1, and K562 were grown in RPMI 1640 media with 10% FBS. All media types were purchased from ATCC. Flow Cytometry. For adherent cell lines, cells were first washed with DPBS (Invitrogen) and then trpyinsinzed with 1 mL of 0.05% trypsin-EDTA (Invitrogen). After 2-10 min, the reaction was terminated by adding 5 mL of growth media. Cells were counted using a hemocytometer, and 5 × 106 cells were used for the flow cytometry assay. The cells were pelleted at 2000g for 10 s (or 150-200g for 5 min) and washed with 1 mL of DPBS, followed by 2 washes with 1 mL of binding buffer (DPBS with 5 mM MgCl2 (Sigma Aldrich, St. Louis, MO)). The cells were resuspended in 1 mL of binding buffer containing BSA (1 mg/mL, Sigma Aldrich) and tRNA from Brewer’s yeast (0.1 mg/mL, Roche, Indianapolis, IN), and 100 µL of aliquots were introduced into each of 10 tubes (5 × 105 cells per tube). Each tube represented a separate binding reaction, including cells alone, the biotinylated capture oligonucleotide and SAPE, the 7 different aptamers plus the biotinylated capture oligonucleotide with SA-PE, and anti-PTK7 (protein tyrosine kinase 7) antibody (anti-PTK7-PE, human, 1:20, Miltenyi Biotec, Auburn, CA). The final concentration of aptamer in the 100 µL of binding reactions was 100 nM. The aptamer:biotinylated capture oligonucleotide:SA-PE annealing reactions were carried out as described above for 30 min at 25 °C. Cells were then washed once with 100 µL of binding buffer containing BSA and tRNA, and twice with binding buffer. Cell pellets were stored on ice until they could be analyzed using a FACSCalibur (Becton Dickinson, San Jose, CA). Each pellet was resuspended in 300 µL of binding buffer immediately before the flow cytometry analysis. For each binding reaction, 10 000 events were collected and analyzed using BD CellQuest Pro software. Fluorescein-labeled samples were analyzed using the FL1-H detector and PElabeled samples were analyzed using the FL2-H detector. Flow cytometry data was gated with WinMDI 2.8 (The Scripps Research Institute, La Jolla, CA) and the delimited data sets were then exported to MATLAB (The MathWorks, Natick, MA). Intact cells were identified by using a plot of FSC-H against SSC-H. The fluorescence value for the aptamer hybridized to the biotinylated capture oligonucleotide:SA-PE was divided by the mean fluorescence background (the biotinylated capture oligonucleotide:SA-PE alone). 2440

Journal of Proteome Research • Vol. 8, No. 5, 2009

Impact of Valency on Aptamer Binding. Aptamer valency was engineered by connecting multiple aptamers either on an oligonucleotide template or via SA. The oliognucleotide template was: 5′- fluorescein -CATTTGCATTTAGGACCAACACAATTACCGATCATCACCACTTCTACTTA-3′ (fluorescein-A2tB). The anti-EGFR aptamer J18 was extended at its 3′ end with either 5′-UUGUGUUGGUCCUAAAUGCAAAUG-3′ (Aptamer J18.A′) or with5′-UAAGUAGAAGUGGUGAUGAUCGGU-3′(AptamerJ18.B′). Some 10 nM extended J18 aptamers were hybridized with an equal amount of the fluorescein-labeled template. Nucleic acids were heated to 70 °C for 3 min in binding buffer, and cooled to 25 °C at 1 °C/s. For SA-mediated multimer assembly, Aptamer J18 was extended at its 3′ end with 5′-GAAUUAAAUGCCCGCCAUGACCAG. This aptamer could then bind to a biotinylated, fluoresceinlabeled capture oligonucleotide. Following annealing, the duplex was incubated with different concentrations of SA (from 1 nM to 20 nM) at 25 °C for 10 min. The RNA complexes were applied to A431 cells and binding was analyzed by flow cytometry with the FL1-H detector (for fluorescein). Confocal Microscopy. Twenty-four hours before labeling, U251 cells were seeded into 8-chamber slides in RPMI 1640 with 10% FBS. Aptamer samples were prepared in the same manner as for flow cytometry. Cells were washed 3 times with 100 µL of binding buffer and then incubated with each aptamer in 100 µL of binding buffer at 37 °C for 30 min. After binding, the cells were washed 3 times with 100 µL of binding buffer, and then stored in 100 µL of binding buffer during imaging. Images were collected with a Leica TCS SP2 AOBS confocal microscope (Leica Microsystems, Mannheim, Germany) with 63× oil immersion optics. The laser line at 543 nm (for excitation of PE) was provided by a HeNe laser. Western Blot Analysis of PTK7 Expression. One million each of CCRF-CEM, Ramos, HL60, A4573, MDA-MB-435, and KG1 cells were used for Western blot analysis. Adherent cells were trypsinized before counting. Trypsinized cells were washed 3 times with ice-cold DPBS and then lysed with 40 µL of RIPA buffer (Pierce, Rockford, IL) on ice for 10 min. After spinning the lysate at 16 060g for 5 min, the clarified supernatant was removed and incubated with 4× loading dye (240 mM TrisHCl pH 6.8, 20% 2-mercaptoethanol, 8% SDS, 40% glycerol, and 0.2% bromophenol) at 70 °C for 10 min. Sixteen microliters of each sample was loaded onto a 4-12% NuPAGE Bis-Tris gel (Invitrogen) along with a Benchmark prestained protein ladder (Invitrogen). After running at 200 V for 1 h, the protein was transferred to a nitrocellulose membrane (Invitrogen) for 1 h at 30 V. The nitrocellulose membrane was rinsed 3 times with PBST (PBS with 0.02% Tween 20 (Sigma Aldrich)), blocked with 5% milk for 30 min at 25 °C, and incubated with anti-PTK7-PE antibody diluted 1:100 in 5% milk for 1 h at 25 °C. The blot was then washed 3 times with PBST (5 min each time), incubated with antimouse IgG (H+L), alkaline phosphatase conjugate (Promega, Madison, WI), diluted 1:3000 in 5% milk for 1 h, washed 3 times with PBST (5 min each time), and then rinsed with water twice. The color was developed by adding Western Blue Stabilized Substrate for alkaline phosphatase (Promega).

Results Optimization of Aptamer-Mediated Flow Cytometry Assay. A variety of methods have been developed for labeling aptamers for the flow cytometry assay, and different labels have

Issues Relevant to Cell Typing with Aptamers

research articles

Figure 1. Impact of extensions on secondary structure. To determine whether the extension sequences interfered with the formation of aptamer structures, the predicted secondary structures of aptamers were determined using the MFOLD algorithm with and without the pink highlighted extension sequence (but in the absence of an antisense oligonucleotide). (A) Structures of the anti-PSMA aptamer. (B) Structures of the anti-CEM/PTK7 aptamer.

previously been successfully used.6,10-13 To compare these methods, we utilized an RNA aptamer selected against EGFR, and an epidermoid carcinoma cell line (A431) known to overexpress EGFR on its surface. Aptamers were extended at their 3′ ends with a 24 nt sequence so that an identical biotinylated, antisense capture oligonucleotide could be used to label all aptamers. Another advantage of this method for these studies is that both RNA and DNA aptamers could be labeled in the same way and thus directly compared. While we previously found that the constant regions of aptamers do not greatly contribute to aptamer secondary structure,14 it was possible that on an individual basis the 3′ extensions would impede folding. To determine whether the added sequence would interfere with aptamer structure and binding, the secondary structures of the aptamers were predicted in both the presence and absence of the 3′ extension using the program MFOLD.15 The extension does not appear to interfere with the folding of some aptamers, such as the antiCEM/PTK7 aptamer, but may interfere with others, such as the anti-PSMA aptamer, and the anti-HER3 and anti-EGFR aptamers (Figure 1). This raised the interesting question of whether the capture oligonucleotide could “rescue” the aptamer and promote binding functionality. In all cases except for the antiMUC1 aptamer, the aptamer:capture oligonucleotide complexes were found to bind to their cognate cells, indicating that this method is generally useful for labeling aptamers. Next, the hybridized, biotinylated aptamers were fluorescently labeled by incubation with SA-PE (Figure 2A, bottom). This routinely gave much stronger signals than annealing the extended aptamer with a fluorescein-labeled capture oligonucleotide (Figure 2A, middle) or directly labeling aptamers via transcription initiation with fluorescein-AMP (Figure 2A, top). Cells labeled with fluorescein-labeled RNA (Figure 2B, top and middle) and with PE (Figure 2B, bottom) were analyzed by flow cytometry. Different detectors were used to optimize

responsivity with the two different reporters. The signal improvement for anti-EGFR aptamer labeling of A431 cells relative to a negative control (unselected pool RNA) was calculated using Equation 1 for each of the labeling methods: Fold signal increase ) fluorescene of aptamer labeled cells - cell auto fluorescence fluorescence of pool labeled cells - cell auto fluorescence (1)

Direct labeling of Aptamer J18 with fluorescein-AMP gave a 16-fold signal increase relative to unselected pool RNA. Labeling via capture oligonucleotide hybridization proved somewhat more effective. Labeling with the fluorescein-labeled capture oligonucleotide yielded a 50-fold signal increase, while hybridizing the extended anti-EGFR aptamer with the biotinylated capture oligonucleotide and then conjugating to SA-PE yielded a 400-fold increase. Thus, the signal due to PE-labeling increased 8- and 25-fold compared with fluorescein-labeling by hybridization and transcription, respectively. This extraordinary increase was likely due to the increased fluorescence yield of PE relative to fluorescein, and potentially to the multivalent display of the aptamer on SA. To assess the latter possibility, we have attempted to observe improvements in binding due to valency for both the antiPSMA (not shown) and anti-EGFR aptamers and have found none. In the case of the anti-EGFR aptamer, we first determined a suitable Aptamer J18 concentration for A431 cell labeling, a concentration that gave a substantial signal but was not saturating. Different ratios of Aptamer J18 and SA were mixed to form complexes with different valencies and then applied to A431 cells. No difference in binding was observed (Figure 3A). We also assembled two J18 aptamers onto a fluoresceinJournal of Proteome Research • Vol. 8, No. 5, 2009 2441

research articles

Li et al.

Figure 2. Fluorescent labeling of aptamers. (A) Different methods for labeling. (Top) Transcription with fluorescein-AMP as an initiator. Middle: hybridization to a fluorescein-labeled capture oligonucleotide. (Bottom) Hybridization to a biotinylated capture oligonucleotide followed by incubation with SA-PE. (B) Flow cytometry scans of labeled anti-EGFR aptamers bound to A431 cells. (Top and middle) Fluorescein-labeled samples (analyzed with the FL1-H detector). (Bottom) Phycoerythrin-labeled samples (analyzed with the FL2-H detector). The lines filled with blue are unlabeled cells. Green lines represent the cell population labeled by the fluorescently labeled unselected N62 pool RNA, and pink lines represent cells labeled by the fluorescently labeled anti-EGFR aptamer.

labeled DNA template. Again, the Aptamer J18 monomer and dimer constructs yielded similar signals for binding to A431 (Figure 4B). Typing Cells with Aptamers and Flow Cytometry. Labeling via the biotinylated capture oligonucleotide and SA-PE was clearly the superior method for cell typing, and had the great benefit of being equally useful for DNA, RNA, and modified RNA aptamers. We therefore attempted to determine whether this method could in fact be generalized by adapting it to the flow cytometry analysis of seven different anticell aptamers with multiple cell lines. The seven aptamers chosen for these experiments were those for which: (a) sequence data was available; (b) some evidence existed that they specifically bound a cell surface protein or a cell; and (c) flow cytometry, microscopy, or radiolabeling data confirmed binding to cells. The 2′-fluoropyrimidine-modified anti-PSMA aptamers A9 and A10 were among the first aptamers to be isolated against 2442

Journal of Proteome Research • Vol. 8, No. 5, 2009

Figure 3. Aptamers binding to HeLa cells by flow cytometry. HeLa cells were trypsinized and then incubated with anti-TNC aptamer, anti-MUC1 aptamer, anti-PSMA aptamer, anti-HER3 aptamer, anti-Ramos aptamer, anti-CEM/PTK7 aptamer, anti-EGFR aptamer, and anti-PTK7 antibody (all PE-labeled) for 30 min at 25 °C.

a known tumor marker.16 These aptamers have been shown to specifically bind to PSMA-expressing LNCaP cells but not

Issues Relevant to Cell Typing with Aptamers

research articles

Figure 4. Valency and binding. (A) Organization via SA. (Top) Anti-EGFR aptamer J18 was hybridized to an oligonucleotide that contained both fluorescein and biotin (left), and the complex was further conjugated to SA, leading to a number of different stoichiometries and possible configurations. (Bottom) Binding of Aptamer J18:SA conjugates to A431 cells, as analyzed by flow cytometry. Ten nanomolar aptamer was used with varying amounts (0-20 nM) of SA. (B) Organization by a DNA template. (Top) Aptamer J18 was extended with two different sequences (A′ and B′) hybridized to a fluorescein-labeled, organizing DNA template that contains the complementary sequences (A and B). (Bottom) Binding of Aptamer J18:DNA template conjugates to A431 cells, as analyzed by flow cytometry. Ten nanomolar labeled template was hybridized to either 10 nM A′ extension, or 10 nM B′ extension, or both.

PSMA-deficient PC3 cells. Both aptamers have also been used for cell-specific siRNA delivery.17-19 A DNA aptamer for an epithelial tumor marker, MUC1 (mucin 1), was isolated using purified protein, and has been reported to bind to the surface of MCF7 cells.20 TNC is a protein located primarily on the extracellular matrix that may play a role in tumor growth and tissue remodeling, and a modified RNA aptamer was isolated against both purified TNC and TNC-expressing U251 glioblastoma cells.21 EGFR and HER3 are members of a receptor tyrosine kinase family. Overexpression or overactivity of these two proteins has been reported in numerous cancers. RNA aptamers against EGFR and HER3 have been isolated using purified protein and have shown binding to the surface of A431 and MCF7 cells respectively (anti-EGFR aptamer data unpublished).22 Finally, whole cell aptamer selections have been used to obtain aptamers that bind selectively to the cell surface, but without foreknowledge of precisely which surface antigen is being selected against or bound. Aptamers have been isolated against Ramos and CCRF-CEM cells. The cell surface proteins the selected aptamers bound were subsequently identified as IGHM (Immunoglobin Heavy Mu Chain) for Ramos cells and PTK7 for CCRF-CEM cells.13,23 The fourteen cell lines chosen for these experiments included cell lines where aptamer binding had previously been shown and additional lines for which binding might be expected (i.e., an antigen was present), and lines for which binding might not

be expected (i.e., the antigen was absent). While we are recapitulating some known results as a positive control for our methods (e.g., binding of anti-CEM/PTK7 aptamers to CCRFCEM cells), this study represents the first attempt to comprehensively determine whether aptamers can be used for cell typing and biomarker identification, and the only attempt where results with otherwise disparate aptamers can be directly compared with one another. All 14 cell lines were labeled with all 7 aptamers and the results evaluated by flow cytometry. A PE-labeled anti-PTK7 antibody was also used as a positive control for the anti-CEM/ PTK7 aptamer. Representative results are shown with the HeLa cell line in Figure 3. The anti-EGFR aptamer bound as expected, given that HeLa cells are known to express this biomarker.24 Somewhat unexpectedly, both the anti-CEM/PTK7 aptamer, which had been touted as specific for leukemia lines, and the antibody to PTK7 bound to this cervical cancer line. All of the other aptamers tested did not show noticeable binding over background (SA-PE with the biotinylated capture oligonucleotide alone). Similar experiments were carried out against the other cell lines, and the combined results are presented in Figure 5. We have taken the quantitative flow cytometry data, and represented it in a false color or “heat map” profile. The quantitation for this profile was based on the normalized logarithmic value of the geometric mean of the FL2-H signal. The heat map can Journal of Proteome Research • Vol. 8, No. 5, 2009 2443

research articles

Li et al.

Figure 5. Cell typing by aptamers. Seven cell surface binding aptamers, one antibody, and 14 cell lines were used to determine distinct binding patterns, which are shown in a false-colored matrix. Cell typing experiments for each cell line were repeated 2 to 4 times, and the average ratio of aptamer binding to background binding for each cell type is shown here. The identities of the cell lines are shown in the column on the right and the identities of the aptamers are shown along the bottom. The color scale correlates color with the ratio of mean fluorescence signal obtained from cells treated with a given aptamer hybridized to a capture oligonucleotide:PE conjugate to that obtained from cells treated with the capture oligonucleotide:PE conjugate alone.

be used to visually ascertain how a set of aptamers can be used to type different cell lines. The different cell lines were clustered in the heat map by calculating the Pearson distances among the labeling profiles for different cell lines. Although the clustering here does not impart information beyond what is visually obvious, such analyses may prove to be especially useful as the number of aptamers against cell surfaces increases, just as statistical analyses of large microarray data sets have proven to be valuable in identifying functionally important features in gene expression experiments. That said, the small number of aptamers available for the current study did not lead to an obvious clustering of similar tissues or tumors, a finding similar to that previously observed with antibodies against tumor biomarkers, and one which again emphasizes the molecular heterogeneity and clonal evolution of cancers.25,26 Confirming Flow Cytometry Data with Confocal Microscopy. There were two aptamers that did not bind as expected to cell lines overexpressing their corresponding protein targets. One was the anti-MUC1 aptamer to MCF7 cells and the other was the anti-TNC aptamer to U251 cells. Under our assay conditions, we did not observe binding of the anti-MUC1 aptamer to adherent MCF7 cells (data not shown). However, because TNC is an extracellular matrix glycoprotein, we hypothesized that it might become disconnected from the cell surface of U251 cells during trypsinization and would be removed during wash steps. To test this hypothesis, we attempted to use the anti-TNC aptamer to label adherent cells, and visualized the results via confocal microscopy (Figure 6). The fluorescent images are shown on the left with corresponding optical images on the right. The pattern of aptamer binding to U251 cells is consistent with the flow cytometry data, with the anti-EGFR aptamer, anti-CEM/PTK7 aptamer, and anti2444

Journal of Proteome Research • Vol. 8, No. 5, 2009

PTK7 antibody showing significant binding. Although the antiTNC aptamer did not bind to U251 cells by flow cytometry, it showed very strong binding to U251 cells by microscopy. Western Blot Analysis of PTK7. The anti-CEM/PTK7 aptamer was originally reported to bind specifically to leukemia cell lines.6,27,28 However, we found that it bound to a wide range of cell lines, as did the corresponding anti-PTK7 antibody, including numerous cell lines that were not of hematopoietic origin (i.e., A431, U251, HeLa, and A4573 cells, see also Table 2). Since the presence or absence of PTK7 on cells was not wholly obvious in the literature and information about what cell lines express PTK7 was limited, we performed Western blot analyses with the anti-PTK7 antibody to rectify the reported specificity of the aptamer with our own results. Lysates were prepared from one million cells from each of 6 chosen cell lines. The CCRF-CEM cell line was of course used as it was the target for the original selection of the anti-CEM/PTK7 aptamer. Ramos cells were used as a known negative selection control. A4573 and KG1 cells were representative of adherent and suspension cell lines, respectively, that showed strong binding by flow cytometry to both the anti-PTK7 antibody and aptamer. The MDA-MB-435 and HL60 cell lines were representative of adherent and suspension cell lines that showed greatly reduced binding by flow cytometry. Anti-PTK7 antibody from mouse and alkaline phosphatase-conjugated mouse IgG were used as the primary and secondary antibodies for Western blot analyses. As shown in Figure 7, a distinct band of the expected size of 118 kDa was readily detected in the lanes containing CCRFCEM, A4573, and KG1 cell lysates, consistent with the flow cytometry data. The band was not observed in the negative control, Ramos cells. Likewise, in the lanes containing MDAMB-435 and HL60 cell lysates, a band was not clearly observed above background. Taken together, these results suggest that

research articles

Issues Relevant to Cell Typing with Aptamers

Figure 6. Imaging aptamer binding to U251 cells by confocal microscopy. Phycoerythrin-labeled aptamers and the anti-PTK7 antibody (PTK7 Ab) were incubated with U251 cells in an 8-chamber slide for 30 min at 37 °C and 5% CO2 and were imaged by confocal microscopy. Fluorescent images are on the left and optical images are on the right. (A) Anti-TNC aptamer. (B) Anti-MUC1 aptamer. (C) Anti-PSMA aptamer. (D) Anti-HER3 aptamer. (E) Anti-Ramos aptamer. (F) Anti-CEM/PTK7 aptamer. (G) Anti-EGFR aptamer. (H) Anti-PTK7 Ab. Scale bar, 20 µm.

Discussion

Figure 7. Western blot analysis of PTK7. Proteins were extracted from various cell lines, separated on a gel, and detected with the anti-PTK7 antibody. The arrow denotes the expected size of PTK7.

small amounts of protein targets cannot be reliably detected relative to background binding by aptamer conjugates with flow cytometry, and only strong, positive signals should be used for diagnostic applications. Based on a comparison of the flow cytometry and Western blot data, it would seem reasonable to suggest that a signal five- to 10-fold above background binding (see Figure 5 above) gives greater surety that a given biomarker is actually present on the surfaces of cells.

The use of aptamers as reagents in flow cytometry was introduced more than 10 years ago.12 Since then, different strategies have been developed to label aptamers with fluorophores for flow cytometry analysis. DNA aptamers targeting mammalian or bacteria cells were labeled with fluorescein, Alexa 488, and Alexa 647 either through PCR amplification with primers modified with fluorescent labels.6,10,11,29 or by direct chemical synthesis.12,13 Due to the difficulties inherent in the chemical synthesis of RNA, 5′ end modifications of RNA aptamers are often achieved by initiating RNA transcription with guanosine or adenosine derivatives.8,9 For instance, to label LNCaP cells, transcription of an anti-PSMA aptamer was initiated with fluorescein-labeled guanosine.18 While it is common practice to label nucleic acids with fluorescein, we have found that labeling aptamers with this single organic fluorophore yielded very weak signals. Phycoerythrin is one of the brightest dyes, and has been used to label both antibodies and aptamers for flow cytometry analysis.30 However, these various methods obviously lead to different labels being incorporated at different positions to different extents. This makes it difficult to directly compare the performance of one aptamer with another. Therefore, in the current study we developed a generic and simple method to label both RNA and DNA aptamers with PE. This method could also be adapted to Journal of Proteome Research • Vol. 8, No. 5, 2009 2445

research articles label the same aptamers with other oligonucleotide-conjugated fluorophores, such as SA-conjugated Alexa dyes, and thus can be used to quickly compare labels and approaches. For commercial or other high-throughput applications it may be useful to simply synthesize a minimized aptamer with a pendant biotin. By contrast, our method remains a powerful tool for initial screening of aptamers for identification of species that might further be optimized for use in high-throughput diagnostic applications. Overall these results (including negative results) emphasize several features relevant to the use of aptamers as reagents for immunohistochemical procedures: first, aptamers that function well in one assay do not always function in the same way when adapted to new analytical methods. This is of course also true for antibodies, especially different antibody preparations or mixtures. That said, since aptamers can be readily obtained as defined chemical entities (sequences), they should show good batch-to-batch reproducibility, while antibodies produced by immunization may not. Second, aptamers may not always be adaptable to new methods or applications, because the conditions under which an aptamer was selected are not always chosen with its eventual use or purpose in mind. The original selection conditions (buffer, ions) should be matched in subsequent binding studies. The context of the cognate protein marker may also be important. If an isolated protein was used for selection, there is no guarantee that the aptamer will still recognize that protein in the context of the cell surface, or in the context of a given sample preparation regime. Third, binding to the cell surface may be more readily observed by some techniques than others. For example, while TNC is not found on trypsinized cells and is not seen by flow cytometry, it is found in the matrix surrounding cells and can be seen by microscopy using nontrypsinized cells. Similarly, the anti-HER3 aptamer is reported to bind to MCF7 cells using radiolabeling techniques, but binding could not be observed here by flow cytometry.22,31 Fourth, aptamers (like most other reagents) can bind nonspecifically to cells. There were a number of small but reproducible flow cytometry signals from different cell lines that may not be indicative of specific binding, and therefore should likely be disregarded in the development of typing and diagnostic assays. For example, both the anti-TNC aptamer and anti-PSMA aptamers showed low but significant binding to MDA-MB-435 cells, even though it is unlikely that either protein is found on this line. In general, we found 2′-fluoropyrimidine-modified RNA gave higher background labeling than did unmodified RNA or DNA. The significant background binding exhibited by aptamers may also account for the apparent selection of an anti-MUC1 aptamer that does not appear to bind specifically to its target cell line. Studies of the anti-MUC1 aptamer do not generally show data comparing binding to other cell lines, and so the positive signals that have previously been observed may be nonspecific background binding.20 In addition, the antiMUC1 antibodies cannot compete with the anti-MUC1 aptamer for binding to cells, which could indicate that they are binding separate targets. Nonspecific binding might be exacerbated by the fluorophores used to observe binding, but this problem can potentially be solved by removing dead cells during FACS-based selections.32 On the basis of these observations, it seems reasonable to require that cell surface binding experiments always include at least two negative controls: first, a nonbinding sequence 2446

Journal of Proteome Research • Vol. 8, No. 5, 2009

Li et al. (such as a scrambled aptamer) or pool should be used as a control for nonspecific binding; and second, some cell line that is not expected to bind a given aptamer should be shown to be incapable of binding that aptamer. These are relatively straightforward negative controls, but are frequently not included in aptamer studies. Moreover, because of issues with nonspecific binding it is important to quantitate binding relative to a negative control, rather than describe qualitative interactions generalized “positive” or “negative”. With these caveats in mind, general features are still evident from the combined and clustered aptamer-binding data (see Figure 5). For example, some aptamers (i.e., anti-Ramos, antiPSMA, and anti-HER3) label only one or a few cell types, while other aptamers (i.e., anti-EGFR, and anti-CEM/PTK7) label a number of different cell lines. While there are often overlapping recognition patterns (compare HeLa and U251 cells), relative labeling can define cell lines. For example, A431 and MDAMB-435 cells could be distinguished from other cells based not only on strong binding of one aptamer (anti-EGFR and antiHER3, respectively), but also by ancillary binding (specific or nonspecific) of other aptamers. This supports the notion that groups of aptamers may eventually prove useful for typing cells or tumors. Beyond technical issues, there is also the question of whether cell surface selection techniques (Cell SELEX) will prove useful in discovering new biomarkers that may be useful for typing cells. The ultimate utility of Cell SELEX will depend in part upon how many different targets can be identified, and whether those targets are truly diagnostic of cell type or state. For example, while prostate-specific membrane antigen is found on the surfaces of prostate tumors, it is also found on neovasculature throughout the body.33 Similarly, the aptamer initially selected against CCRF-CEM cells was suggested to be quite specific for these cells.6 When the target of this aptamer was identified as PTK7, this was assumed to be a biomarker for some leukemias.28 Our comparative studies can potentially provide insights into this hypothesis, or whether there may be other biological alternatives. We now find that many different types of tumor cells apparently express PTK7, as confirmed by both aptamer and antibody labeling. While the generic binding of the anti-CEM/PTK7 aptamer to multiple tumor cell types may reflect a wider role in oncogenesis, this finding also prompted us to determine whether there might be another possible reason for its identification during selections against tissue culture cells.34 The majority of cell lines to which the anti-PTK7 aptamer and antibody were found to bind were adherent in their observed growth. Leukemia cell lines are generally described as growing in suspension, but CCRF-CEM has also been described as forming an adherent epitheloid monolayer in addition to the majority of cells in suspension (DSMZ, German Collection of Microorganisms and Cell Cultures, http://www.dsmz.de/ human_and_animal_cell_lines/info.php?dsmz_nr)240). We therefore tested several of the leukemia suspension lines (CCRF-CEM, Ramos, and KG1) used in this study to see if they would form an epitheloid monolayer. Cells were carried for several passages without vigorous pipetting that would disturb such a layer, and we found that a semiadherent layer did form with CCRF-CEM and KG1 cells (which express PTK7), though not Ramos cells (which do not express PTK7). Since the original cell SELEX that produced the anti-CEM/ PTK7 aptamer used CCRF-CEM cells in a positive selection step followed by Ramos cells as a negative selection step, it is

research articles

Issues Relevant to Cell Typing with Aptamers possible that what was actually being selected against was not the differences between the leukemias, but rather the differences between the propensity for adherence. This hypothesis is supported by the fact that PTK7 has been linked to roles in planar cell polarity during mammalian development, and by the role of PTK7 homologues in neuronal cell adhesion.35,36 Though the full function of PTK7 is not known, it has a defective catalytic domain, and its extracellular domain has been shown to have the greatest homology with members of the immunoglobulin superfamily whose function is often related to cell adhesion.37 An aptamer specific for adherent cell lines may have very different diagnostic implications than one selected against a biomarker for a disease state. In general, it would seem odd for primary leukemias to have adherent properties; indeed, other adherence markers, such as cadherin and CD44, are frequently lost, silenced, or cleaved from the cell surface in some leukemias.38-42 In particular, soluble PTK7 has been shown to inhibit the activation of focal adhesion kinase, a biomarker for the aggression of acute myeloid leukemia (AML), and to decrease cell motility.43,44 That said, it is unclear whether the soluble PTK7 is acting in a manner that is similar to or antagonistic to cell surface PTK7. Other studies have shown that adherence factors can be expressed in chronic myelogenous leukemias (CML), but the one CML line that we assayed (K562) showed no obvious expression of PTK7.45 Overall, aptamers selected against leukemia cell lines that show the propensity to become adherent may not be as useful for identifying biomarkers and distinguishing leukemia patient samples as aptamers selected against primary leukemia cells.24 At the least, binding to the purported biomarker in patient samples should be carefully validated with quantitative data that supports qualitative assessments and further followed up with antibody studies. The complexity and diversity of the cell surface proteome presents a considerable analytical challenge for cell-type identification, yet at the same time that very complexity provides an opportunity to use multiplex detection and pattern recognition for cell typing. By establishing a standard fluorescentlabeling and flow cytometry method, and by providing quantitative and interpretive bounds for understanding when and how to apply these assays, we have advanced the potential utility of aptamers as cell typing reagents. Understanding and controlling for the role of background and nonspecific binding to cells opens the way to using arrays of aptamers for describing and quantifying the cell surface proteome.

Acknowledgment. Funding was provided by the Welch Foundation (F1654) and the Center for Cancer Nanotechnology Excellence (17666630-33956-A). References (1) Kulasingam, V.; Diamandis, E. P. Tissue culture-based breast cancer biomarker discovery platform. Int. J. Cancer 2008, 123 (9), 2007–12. (2) Simpson, R. J.; Bernhard, O. K.; Greening, D. W.; Moritz, R. L. Proteomics-driven cancer biomarker discovery: looking to the future. Curr. Opin. Chem. Biol. 2008, 12 (1), 72–7. (3) Wingren, C.; Borrebaeck, C. A. Antibody microarrays: current status and key technological advances. Omics 2006, 10 (3), 411–27. (4) Borrebaeck, C. A.; Wingren, C. High-throughput proteomics using antibody microarrays: an update. Expert. Rev. Mol. Diagn. 2007, 7 (5), 673–86. (5) Chu, T.; Ebright, J.; Ellington, A. D. Using aptamers to identify and enter cells. Curr. Opin. Mol. Ther. 2007, 9 (2), 137–44. (6) Shangguan, D.; Li, Y.; Tang, Z.; Cao, Z. C.; Chen, H. W.; Mallikaratchy, P.; Sefah, K.; Yang, C. J.; Tan, W. Aptamers evolved from

(7) (8)

(9)

(10) (11) (12) (13) (14) (15) (16)

(17) (18)

(19)

(20)

(21)

(22)

(23)

(24) (25) (26)

(27) (28)

live cells as effective molecular probes for cancer study. Proc. Natl. Acad. Sci. U.S.A. 2006, 103 (32), 11838–43. Syrett, H. A.; Collet, J. R.; Ellington, A. D. Aptamer Microarrays. In Functional Nucleic Acids for Analytical Applications; Lu, Y., Li, Y., Eds.; Integrated Analytical Systems; Springer: New York, 2009. Huang, F.; Wang, G.; Coleman, T.; Li, N. Synthesis of adenosine derivatives as transcription initiators and preparation of 5′ fluorescein- and biotin-labeled RNA through one-step in vitro transcription. Rna 2003, 9 (12), 1562–70. Li, N.; Yu, C.; Huang, F. Novel cyanine-AMP conjugates for efficient 5′ RNA fluorescent labeling by one-step transcription and replacement of [gamma-32P]ATP in RNA structural investigation. Nucleic Acids Res. 2005, 33 (4), e37. Hamula, C. L.; Zhang, H.; Guan le, L.; Li, X. F.; Le, X. C. Selection of aptamers against live bacterial cells. Anal. Chem. 2008, 80 (20), 7812–9. Berezovski, M. V.; Lechmann, M.; Musheev, M. U.; Mak, T. W.; Krylov, S. N. Aptamer-facilitated biomarker discovery (AptaBiD). J. Am. Chem. Soc. 2008, 130 (28), 9137–43. Davis, K. A.; Abrams, B.; Lin, Y.; Jayasena, S. D. Use of a high affinity DNA ligand in flow cytometry. Nucleic Acids Res. 1996, 24 (4), 702– 6. Xiao, Z.; Shangguan, D.; Cao, Z.; Fang, X.; Tan, W. Cell-specific internalization study of an aptamer from whole cell selection. Chemistry 2008, 14 (6), 1769–75. Cowperthwaite, M. C.; Ellington, A. D. Bioinformatic analysis of the contribution of primer sequences to aptamer structures. J. Mol. Evol. 2008, 67 (1), 95–102. Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31 (13), 3406–15. Lupold, S. E.; Hicke, B. J.; Lin, Y.; Coffey, D. S. Identification and characterization of nuclease-stabilized RNA molecules that bind human prostate cancer cells via the prostate-specific membrane antigen. Cancer Res. 2002, 62 (14), 4029–33. Chu, T. C.; Twu, K. Y.; Ellington, A. D.; Levy, M. Aptamer mediated siRNA delivery. Nucleic Acids Res. 2006, 34 (10), e73. McNamara, J. O., 2nd.; Andrechek, E. R.; Wang, Y.; Viles, K. D.; Rempel, R. E.; Gilboa, E.; Sullenger, B. A.; Giangrande, P. H. Cell type-specific delivery of siRNAs with aptamer-siRNA chimeras. Nat. Biotechnol. 2006, 24 (8), 1005–15. Wullner, U.; Neef, I.; Eller, A.; Kleines, M.; Tur, M. K.; Barth, S. Cell-specific induction of apoptosis by rationally designed bivalent aptamer-siRNA transcripts silencing eukaryotic elongation factor 2. Curr. Cancer. Drug. Targets 2008, 8 (7), 554–65. Ferreira, C. S.; Matthews, C. S.; Missailidis, S. DNA aptamers that bind to MUC1 tumour marker: design and characterization of MUC1-binding single-stranded DNA aptamers. Tumour Biol. 2006, 27 (6), 289–301. Hicke, B. J.; Marion, C.; Chang, Y. F.; Gould, T.; Lynott, C. K.; Parma, D.; Schmidt, P. G.; Warren, S. Tenascin-C aptamers are generated using tumor cells and purified protein. J. Biol. Chem. 2001, 276 (52), 48644–54. Chen, C. H.; Chernis, G. A.; Hoang, V. Q.; Landgraf, R. Inhibition of heregulin signaling by an aptamer that preferentially binds to the oligomeric form of human epidermal growth factor receptor3. Proc. Natl. Acad. Sci. U.S.A. 2003, 100 (16), 9226–31. Mallikaratchy, P.; Tang, Z.; Kwame, S.; Meng, L.; Shangguan, D.; Tan, W. Aptamer directly evolved from live cells recognizes membrane bound immunoglobin heavy mu chain in Burkitt’s lymphoma cells. Mol. Cell. Proteomics 2007, 6 (12), 2230–8. Berkers, J. A.; van Bergen en Henegouwen, P. M.; Boonstra, J. Three classes of epidermal growth factor receptors on HeLa cells. J. Biol. Chem. 1991, 266 (2), 922–7. Chang, H.; Benchimol, S.; Minden, M. D.; Messner, H. A. Alterations of p53 and c-myc in the clonal evolution of malignant lymphoma. Blood 1994, 83 (2), 452–9. Tan, D.; Deeb, G.; Wang, J.; Slocum, H. K.; Winston, J.; Wiseman, S.; Beck, A.; Sait, S.; Anderson, T.; Nwogu, C.; Ramnath, N.; Loewen, G. HER-2/neu protein expression and gene alteration in stage I-IIIA non-small-cell lung cancer: a study of 140 cases using a combination of high throughput tissue microarray, immunohistochemistry, and fluorescent in situ hybridization. Diagn. Mol. Pathol. 2003, 12 (4), 201–11. Shangguan, D.; Cao, Z. C.; Li, Y.; Tan, W. Aptamers evolved from cultured cancer cells reveal molecular differences of cancer cells in patient samples. Clin. Chem. 2007, 53 (6), 1153–5. Shangguan, D.; Cao, Z.; Meng, L.; Mallikaratchy, P.; Sefah, K.; Wang, H.; Li, Y.; Tan, W. Cell-specific aptamer probes for membrane protein elucidation in cancer cells. J. Proteome Res. 2008, 7 (5), 2133–9.

Journal of Proteome Research • Vol. 8, No. 5, 2009 2447

research articles (29) Tang, Z.; Shangguan, D.; Wang, K.; Shi, H.; Sefah, K.; Mallikratchy, P.; Chen, H. W.; Li, Y.; Tan, W. Selection of aptamers for molecular recognition and characterization of cancer cells. Anal. Chem. 2007, 79 (13), 4900–7. (30) Davis, K.; Lin, Y.; Abrams, B.; Jayasena, S. D. Staining of cell surface human CD4 with 2′-F-pyrimidine-containing RNA aptamers for flow cytometry. Nucleic Acids Res. 1998, 26 (17), 3915–24. (31) Park, E.; Baron, R.; Landgraf, R. Higher-order association states of cellular ERBB3 probed with photo-cross-linkable aptamers. Biochemistry 2008, 47 (46), 11992–2005. (32) Raddatz, M. L.; Dolf, A.; Endl, E.; Knolle, P.; Famulok, M.; Mayer, G. Enrichment of cell-targeting and population-specific aptamers by fluorescence-activated cell sorting. Angew. Chem., Int. Ed. 2008, 47, 5190–3. (33) Chang, S. S.; Reuter, V. E.; Heston, W. D.; Bander, N. H.; Grauer, L. S.; Gaudin, P. B. Five different anti-prostate-specific membrane antigen (PSMA) antibodies confirm PSMA expression in tumorassociated neovasculature. Cancer Res. 1999, 59 (13), 3192–8. (34) Shin, W. S.; Maeng, Y. S.; Jung, J. W.; Min, J. K.; Kwon, Y. G.; Lee, S. T. Soluble PTK7 inhibits tube formation, migration, and invasion of endothelial cells and angiogenesis. Biochem. Biophys. Res. Commun. 2008, 371 (4), 793–8. (35) Lu, X.; Borchers, A. G.; Jolicoeur, C.; Rayburn, H.; Baker, J. C.; Tessier-Lavigne, M. PTK7/CCK-4 is a novel regulator of planar cell polarity in vertebrates. Nature (London) 2004, 430 (6995), 93–8. (36) Pulido, D.; Campuzano, S.; Koda, T.; Modolell, J.; Barbacid, M. Dtrk, a drosophila gene related to the trk family of neurtrophin receptors, encodes a novel class of neural cell adhesion molecule. EMBO J. 1992, 11, 391–404. (37) Jung, J. W.; Ji, A. R.; Lee, J.; Kim, U. J.; Lee, S. T. Organization of the human PTK7 gene encoding a receptor protein tyrosine kinaselike molecule and alternative splicing of its mRNA. Biochim. Biophys. Acta 2002, 1579 (2-3), 153–63. (38) Kremmidiotis, G.; Baker, E.; Crawford, J.; Eyre, H. J.; Nahmias, J.; Callen, D. F. Localization of human cadherin genes to chromo-

2448

Journal of Proteome Research • Vol. 8, No. 5, 2009

Li et al.

(39)

(40)

(41)

(42)

(43)

(44)

(45) (46)

some regions exhibiting cancer-related loss of heterozygosity. Genomics 1998, 49 (3), 467–71. Corn, P. G.; Smith, B. D.; Ruckdeschel, E. S.; Douglas, D.; Baylin, S. B.; Herman, J. G. E-cadherin expression is silenced by 5′ CpG island methylation in acute leukemia. Clin. Cancer Res. 2000, 6 (11), 4243–8. Shimamoto, T.; Ohyashiki, J. H.; Ohyashiki, K. Methylation of p15(INK4b) and E-cadherin genes is independently correlated with poor prognosis in acute myeloid leukemia. Leuk. Res. 2005, 29 (6), 653–9. Takubo, T.; Kanashima, H.; Terada, Y.; Aoyama, Y.; Nakamae, H.; Yamamura, R.; Shima, E.; Makita, K.; Tanaka, K.; Ohta, K.; Yamane, T.; Hino, M.; Kamitani, T.; Tatsumi, N. Clinical significance of serum E-cadherin levels in patients with haematological malignancies. Haematalogia (Budap) 2002, 31 (4), 319–25. Loeffler-Ragg, J.; Steurer, M.; Ulmer, H.; Skvortsov, S.; Kircher, B.; Herold, M.; Zwierzina, H.; Stauder, R. Elevated levels of serum CD44 and E-cadherin predict an unfavourable outcome in myelodysplastic syndromes. Leukemia 2006, 20 (11), 2064–7. Shin, W.; Maeng, Y.; Jung, J.; Min, J.; Kwon, Y.; Lee, S. Soluble PTK7 inhitbits tube formation, migration and invasion of endothelial cells and angiogenesis. Biochem. Biophys. Res. Commun. 2008, 371, 793–8. Ruidavets, J.; Cariven, P.; Demur, C.; Payrastre, B.; Laurent, G.; Racaud-Sultan, C. Expression of focal adhesion kinase in acute myeloid leukemia is associated with enhanced blast migration, increased cellularity, and poor prognosis. Cancer Res. 2004, 64, 3191–7. Pasternak, G.; Hochhaus, Schultheis, B.; Hehlmann, R. Chronic myelogenous leukemia: molecular and cellular aspects. J. Cancer Res. Clin. Oncol. 1998, 124, 643–60. Smith, J. E.; Medley, C. D.; Tang, Z.; Shangguan, C. L.; Tan, W. Aptamer-Conjugated Nanoparticles for the Collection and Detection of Multiple Cancer Cells. Anal. Chem. 2007, 79 (8), 3075–82.

PR801048Z