Temperature-Driven Precise Control of Biological Droplet's Adhesion

Subscriber access provided by EKU Libraries

Surfaces, Interfaces, and Applications

Temperature-Driven Precise Control of Biological Droplet’s Adhesion on Slippery Surface Jinhua Wang, Yu Huang, Ke You, Xian Yang, Yongjun Song, Hai Zhu, Fan Xia, and Lei Jiang ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b21088 • Publication Date (Web): 23 Jan 2019 Downloaded from http://pubs.acs.org on January 30, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Temperature-Driven Precise Control of Biological Droplet’s Adhesion on Slippery Surface Jinhua Wang,1 Yu Huang,1, 4* Ke You,2 Xian Yang,1 Yongjun Song,1 Hai Zhu,1 Fan Xia,1, 3* and Lei Jiang4, 5 1.

Engineering Research Center of Nano-Geomaterials of Ministry of Education, Faculty of Material Science and Chemistry, China University of Geosciences, Wuhan 430074, P. R. China

2.

Wuhan National Laboratory for Optoelectronics, School of Optical and Electronic Information, Huazhong University of Science and Technology, Wuhan 430074, P. R. China

3.

Hubei Key Laboratory of Bioinorganic Chemistry & Materia Medica, School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074, P. R. China

4.

Key Laboratory of Bio-inspired Materials and Interfacial Science, Technical Institute of Physics and Chemistry, Chinese Academy of Science, Beijing 100190, P. R. China

5.

Key Laboratory of Bio-Inspired Smart Interfacial Science and Technology of the Ministry of Education, School of Chemistry and Environment, Beihang University, Beijing 100191, P. R. China

E-mail addresses: [email protected] (Y. H.); [email protected] (F. X.)

KEYWORDS: controllable droplet motion, hydrophobic interaction, interfacial adhesion, slippery surface, temperature-responsive

ACS Paragon Plus Environment

1

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT

Precise control of biological droplet’s adhesive force on a liquid-repellent surface for smart anti-fouling systems is critical and fundamental to scientific research and industrial applications. Although slippery surfaces with stimuli responsive wetting behaviors have been reported, challenge still remains in designing responsive biological droplets to achieve controllable adhesion and anti-fouling property. Here, we developed a thermo-responsive biological droplet adhesion system to precisely control its adhesion on the lubricant infused slippery surface. The ssDNA in the biological droplet displays molecular configuration reversible deformation under external thermal stimuli. This property ascribes to the changing amount of exposed hydrophobic moieties of ssDNA, which strongly affects the interfacial hydrophobic interaction with the lubricant. This work may improve understanding of the principles underlying liquid-lubricant interfacial adhesion, open up opportunities for a new class of anti-fouling systems, and provide a promising system for controllable manipulating liquids’ motion in biochips and microreactor devices.


2

Page 2 of 32

Page 3 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION The manipulation of droplet wetting and motion behaviors on solid surfaces with controllable interfacial adhesion is fundamental to scientific research and industrial applications, such as antifouling,1-15 self-cleaning,16,17 anti-icing,18 liquid transport,19,20 microfluidic devices,21,22 drag reduction,23 corrosion prevention24 and so on. Among them, anti-fouling surfaces are critical in a broad range of industrial, commercial, and biomedical contexts, for examples, drug release1, biological implants25, biomolecule organization26, prevent infection in catheters and artificial blood vessels,27 and so on. Inspired by pitcher plants, lubricant-infused slippery surfaces have recently been developed as innovative strategies and prominent examples with a unique approach to surface coating, which resists adhesion under extreme temperature, pressure or humidity conditions.28,29 This system requires a liquid/liquid interface between the lubricant and the immiscible liquid to be repelled. The adhesion between the repellent liquid and lubricant determines the motion of the repellent liquid on the slippery surfaces. In these pitchers’ plants inspired systems, the relatively low interfacial adhesions contribute to their outstanding antifouling property. Recently, advanced anti-fouling materials with various functionalities based on slippery surfaces have been well developed, including inhibition of spores and cyprids,3 protein resistant,4 non-adherent pathogens,6 anti-attachment bacteria and marine organisms.9 Generally, traditional anti-fouling systems focused on developing new coating technologies of surface, such as topography, surface energy, modulus, and lubricity, but seldom attention was paid to the modification of the repellent liquid contain biomaterials. Here, we put forward a facile strategy of tunable anti-fouling system through biological droplets contained ssDNA, which could adjust its adhesion on the slippery surfaces under different temperatures.


3


Precisely controllable adhesion for the liquid on the infused slippery surfaces has attracted increasingly attention due to potential applications. In conventional techniques, the controllable and reversible adhesion switching usually relied on a stimulus-triggered switch in the solid surface morphologies or/and surface chemistry to produce a change in functional properties. The external stimuli include temperature,30-33 magnetic,34,35 electric stimuli,36 mechanical stretch37,38 and so on. Typical temperature stimuli examples include adopting paraffin, thermo-responsive phase-transition materials, as lubricant to infuse porous substrates or organogel. Through adjusting the temperature below or above paraffin’s melting temperature to tune the surface’s morphology, and finally control the droplet in high or low adhesion state, respectively.31,32 Although anti-fouling slippery surfaces with controllable and responsive adhesion have been widely reported, it still remains a challenge to develop an alternative constructive strategy through the repellent liquid phase for a tunable liquid-lubricant interfacial adhesion. Here, we designed and synthesized single stranded DNA (ssDNA) biological droplets as the repellent liquid phase for creating temperature-responsive liquid-lubricant adhesion and antifouling property on the slippery surface. In our previous report, it has been proven that the adhesion of a ssDNA biological droplet on a slippery surface can be adjusted through modulation of the ssDNA chain length, due to the various hydrophobic interaction between ssDNA and lubricant molecules.39 Based on this understanding, in this manuscript, we introduced thermoresponsive ssDNA to precisely and reversibly tune the droplet’s interfacial adhesion, which comes from the molecular configuration transformation under different temperatures. When the environmental temperature grows from 283 K to 303 K, the flexibility and mobility of the ssDNA increase, and molecular configuration of the ssDNA would change to limit the hydrophobic moieties exposure. As a result, the interaction between hydrophobic moieties and


4

Page 4 of 32

Page 5 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


oil molecules reduced, which contributes to the interfacial adhesion of biological droplet on the slippery surface reduced. Furthermore, ssDNA with different chain lengths owns various degrees of hydrophobic interactions with lubricant, results in the differences in thermo-responsive property. Therefore, through adjusting the chain length of the ssDNA and environmental temperature, precisely control of the liquid-lubricant adhesion and finely tune of the biological droplet’s motion behavior could be achieved. This work may further inspire liquid-lubricant innovations and open up opportunities for a new class of anti-fouling systems, improve understanding of the principles underlying liquid-lubricant interfacial adhesion, and provide a promising system for controllable manipulating liquids’ motion in biochips and microreactor devices. 2. EXPERIMENTAL SECTION 2.1 Preparation of Slippery Surface and Biological Droplets. The polydimethylsiloxane (PDMS) pre-polymer and its cross linker were mixed homogeneously (with weight ratio of 10:1) and degassed for 30 min under vacuum. The obtained mixture was poured over the 1.5 cm×1.5 cm glass sheet and spin-coating at 800 rpm for 30 seconds, then heated under 80 °C atmosphere for 60 min in vacuum. After that, the prepared samples were immersed into organic solvent at room temperature for 6 h until saturation to set aside. The synthesis procedure of biological droplets has been reported in our previous report,39 with various concentrations of adenosine triphosphate (ATP) and reaction time of rolling circle amplification (RCA). The adopted concentrations of ATP in our experiment were 1.72 pM, 17.2 pM, 172 pM, 1.72 nM, 17.2 nM, 172 nM, 1.72 μM, and 17.2 μM, respectively. The time of RCA was 2 h. 2.2 Materials. PDMS oligomer and cross-linker (Sylgard 184) were got from Dow Corning


5


Corp. (Midland, Michigan). Oligonucleotides, including linear ssDNA and its primer were synthesized by Takara Biotechnology Co. Ltd. (Dalian, China). ATP, adenosine monophosphate (AMP), guanosine-5’-triphosphate disodium salt (GTP), uridine triphosphate (UTP) and cytidine triphosphate (CTP) were purchased from Takara Biotech. Co. Ltd. (Dalian, China), too. T4 DNA ligase, exonuclease I (Exo I), exonuclease III (Exo III), phi29 DNA polymerase (phi-29 DNA) and deoxynucleotide solution mixture (dNTPs) were bought from Thermo Fisher Scientific Inc. (Waltham, MA, USA). The lubricating fluid used for the experiment, including n-hexadecane, ntetradecane and n-dodecane, were purchased from Aladdin Industrial Corporation. Silicon oil SD 998 with viscosity of 5cpa (298 K) were obtained from Zhongke Shangde Co. Ltd. (Beijing, China). Linear ssDNA: 5’-TCGTTTGATGTTCCTAACGTACCAACGCACACGCAGTAT TATGGACTGGTAAAAGCTTTCCGAGGTAGCCTGGAGCATAGAGGCATTGGCTG3’ Primer: 5’-TAGGAACATCAAACGACAGCCA-3’

2.3 Characterization. The sliding angle (SA) (2 μL) and surface tensions of the droplet by using the pendant droplet method were operated on an OCA20 machine (Data Physics, Germany). The temperature in the SA measurements was controlled using a programmable heater plate, which was connected to the platform of the OCA20. The 3D profile fluorescence images were measured for Z-stack imaging on the Fluoview FV1200 confocal laser scanning


6

Page 6 of 32

Page 7 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


microscope (Olympus, Japan), and then analyzed by FV10-ASW V4.0 Image (Olympus). The droplets were dyed with 4S Green Plus (10 μM) and the PDMS slippery surface was colored with 1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindodicarbocyanine, 4-Chlorobenzene sulfonate Salt (DiD) (10 μM). A 488 nm laser was chosen for the excitation of 4S Green Plus and the emission was collected at 500-550 nm. A 635 nm laser was chosen for the excitation of DiD and the emission was collected at 640-700 nm. The volume of the droplet was 0.3 μL. The lubricant was n-dodecane. 3. RESULTS AND DISCUSSION 3.1 Design of the Biological Droplets and Lubricant Infused Slippery Surfaces. To create thermo-responsive adhesion from the repellent liquid phase, both repellent liquid and the lubricant infused slippery surfaces need to be appropriately designed. In our experiment, biological droplet was adopted as the repellent liquid phase. To achieve the biological droplet, the ATP-initiate RCA process was adopted to generate of ssDNA with various chain lengths, as shown in Figure 1a and Figure S1. The concentration of the ATP plays a key role to generate various chain lengths of the as-prepared ssDNA. ATP can be found in all forms of life providing energy to drive many processes in living cells, such as nerve impulse propagation, muscle contraction, and chemical synthesis.40 With the help of ATP, T4 enzyme can ligate the initial short ssDNA to form a circular DNA, and then generate long ssDNA with matching bases. In the case of RCA droplet without ATP, T4 enzyme doesn’t work. As a result, the initial ssDNA cannot form circle DNA but digested into short fragment base by Exo Ⅰ and Exo III (Figure S1). In our group’s previous research, it has been proven that the ssDNA with short fragments (without ATP) and long chain (with ATP) can adjust the interfacial hydrophobic interaction from


7


strong to weak, due to the different amounts of exposed hydrophobic moieties.39 The interfacial adhesion between repellent liquid and lubricant infused surface is mainly determined by the water mediated hydrophobic interaction, which results in the various droplet motion behaviors. In our experiment, the concentrations of ATP were 1.72 pM, 17.2 pM, 172 pM, 1.72 nM, 17.2 nM, 172 nM, 1.72 μM, and 17.2 μM respectively. The adopted RCA procedure time is 2 h due to the obvious difference of SA before and after the RCA process, as shown in Figure S2. The ssDNA with various lengths of chain can be synthesized through adjusting the concentration of ATP during the RCA process, which strongly affects the adhesion of the biological droplet on the lubricant infused slippery surface.

Figure 1. Scheme of controllable interfacial adhesion system based on a RCA biological droplet


8

Page 8 of 32

Page 9 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and a slippery surface by n-dodecane infused PDMS gel. a) Synthesis principle of the biological droplets through ATP-initiate RCA process. b) The fabrication of lubricant infused slippery surface involves four steps: (I, II) formation of PDMS thin film through pre-polymer’s spincoating, (III) cured under 353 K atmosphere for 60 min, (IV) PDMS films immersed in lubricant. c) A RCA biological droplet displays thermo-responsive adhesion and sliding behavior on the lubricant infused slippery surface. The fabrication process of a lubricant infused slippery surface was shown in Figure 1b. Firstly, the PDMS pre-polymer and its cross linker (with weight ratio of 10:1) were mixed and degassed under vacuum for 30 min. The obtained mixture was coated onto a 1.5 cm×1.5 cm glass slide through spin-coating at 800 rpm for 30 seconds, and heated at 353 K atmosphere for 60 min to complete cure the final mixture. Then, the as-prepared PDMS film was immersed in the bath of lubricant for 6 h to reach swelling saturation. Due to the affinity of lubricant to PDMS, a certain amount of lubricant impregnated into the crosslinked network of PDMS film, resulted in the PDMS film swollen after the immersion.41 Optical photos of PDMS immersed in n-dodecane, n-tetradecane, n-hexadecane separately after 6 h were shown in Figure S3, displaying the swollen property of above lubricant. Here, PDMS and n-dodecane were chosen as typical crosslinked network and lubricant to produce a slippery surface. Actually, according to Quéré’s theory,42 this fabrication method can be expanded to other systems with different crosslinked polymers and oils as lubricant if meets the criteria: Δγ = γ2 cos θ2 – γ1 cos θ1 – γ12 > 0

[1]

Where γ1, γ2, and γ12 are the surface tensions of liquid 1, liquid 2, and interface of tension liquid 1/liquid 2, respectively. θ1, θ2 are the contact angles (CAs) of liquid 1 and liquid 2 on the


9


solid surface in the air. Using Equation [1], we were able to confirm the RCA biological droplet (liquid 1) can float on the solid surface infused by n-dodecane (liquid 2). Moreover, in our experiment, we focused on adjusting the interfacial adhesion based on the thermo-responsive property of the repellent liquid phase. So, the physical and chemical property of the lubricant and solid materials should avoid dramatic change with temperature. For example, avoid the physical property change comes from phase transition. To maintain the lubricant in liquid phase, its melting temperature should be lower than the experimental temperature. Here, the melting temperature of n-dodecane lies around 263.4 K, lower than the testing environmental temperatures (283 K, 293 K, and 303 K), avoiding the lubricant transfer from liquid to solid phase. With the well-designed RCA biological droplet and lubricant infused slippery surface, such as RCA droplets with ATP concentration range from 172 pM to 1.72 μM, the RCA droplet would display thermo-responsive motion behavior due to its adhesion changing under different temperatures, as shown in Figure 1c. 2.2. Thermo-Responsive Adhesion of the RCA Droplet. To investigate the thermoresponsive adhesion and motion of the RCA biological droplet on the slippery surface, its wetting properties and sliding behaviors under three different temperatures were carefully tested. The CAs of the RCA droplet with various ATP concentrations were collected in Table S1. Typically, when the concentration of ATP was 1.72 nM, the CAs were 48.9 ± 2.0°, 50.2 ± 0.7° and 51.1 ± 0.9°, at the temperature of 283 K, 293 K and 303 K respectively, as shown in Figure 2a-c inset. Although the CAs display little change with the temperature, the sliding behaviors on the same tilted slippery surface were significantly different. Figure 2a-c show the detailed motion behaviors of the RCA biological droplet on a tilted lubricant infused slippery surface under different temperatures (see Video S1, Supporting Information). The tilting angle of the slippery


10

Page 10 of 32

Page 11 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


surface was 28°. On this tilted slippery surface, the RCA droplet was pinned at the temperature of 283 K, indicating high interfacial adhesion. In this case, the SA was 29.8 ± 0.5° (Figure 2d). In contrast, the RCA biological droplet easily slid away on the same tilted slippery surface when the temperature grew to 293 K and 303 K, suggesting low interfacial adhesion properties. The SAs were 26.8 ± 0.5° and 19.7 ± 0.6°, corresponding to temperature of 293 K and 303 K, respectively, as shown in Figure 2e and 2f. The distinct sliding behaviors for the same RCA droplet under different temperatures demonstrated that the interfacial adhesive force changed with the temperature.

Figure 2. Exhibitions of sliding behaviors of RCA biological droplets under different temperatures: 283 K, 293 K, and 303 K. a-c) Optical images of a RCA biological droplet on a 28° tilted slippery surface, displays obvious different sliding behaviors. Insets are the CAs of the RCA biological for the responding temperature. d-f) SAs of the RCA biological droplet under


11


283 K, 293 K, and 303 K, respectively. The ATP concentration is 1.72 nM, and the droplet is 2 μL. The distinct sliding behaviors and SAs of the RCA droplet under different temperatures indicate the various adhesions existing at the interface. We systematically characterized the SAs of RCA biological droplets with eight various ATP concentrations under three different temperatures to research the adhesion and motion behaviors of the RCA droplet on the lubricant infused slippery surface (Table 1, Figure 3a). The results showed that the RCA droplets with higher ATP concentration display lower SA under the same temperature. For example, when the concentration of ATP increased from 1.72 pM to 17.2 μM, the SA decreased from 31.5 ± 0.6° to 15.7 ± 0.3° under 283 K. For other kinds of lubricant, for instance, n-tetradecane and n-hexadecane, SA decreased with ATP increase also can be observed, as shown in Figure S4, S5. On the other hand, the RCA droplets with the same ATP concentration display lower SA at higher temperature. For instance, for the RCA droplet with ATP concentration of 17.2 nM, the SAs decreased from 28.8 ± 0.9° to 17.5 ± 0.7° when the temperature grew from 283 K to 303 K, suggesting interfacial adhesion change.

Figure 3. a) Plots of SAs of RCA droplets with various ATP concentrations on the n-dodecane infused slippery surface, at temperature of 283 K (▲), 293 K (), and 303 K (■), respectively.


12

Page 12 of 32

Page 13 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The ATP concentrations are 1.72 pM, 17.2 pM, 172 pM, 1.72 nM, 17.2 nM, 172 nM, 1.72 μM, and 17.2 μM, respectively. b) Scheme displaying the force analysis of a RCA droplet sitting on a tilted slippery surface. The friction force comes from the hydrophobic interaction between the RCA droplet and the lubricant. c) ATP concentration and temperature dependence of the friction force for a 2 μL RCA biological droplet on the slippery surface. To evaluate the influence of the ATP concentration and temperature on the RCA droplets’ wetting behavior, the force analysis of a RCA droplet on a titled slippery surface was introduced in Figure 3b.43 Where mg was the gravity, with components of F// (parallel to slope) and F ⊥ (vertical component); f represented the adhesive force between the slippery surface and the RCA droplet. When F// ≥ f, the droplet could move on this tilted surface. Generally, F// was determined by tilted angle and the gravity of droplet; f was related to properties of the lubricant and liquid droplet, and also the contact area between the lubricant and liquid droplet.44 In this experiment, the surface tensions of the RCA droplet under 283 K, 293 K and 303 K are similar, which can be confirmed through the corresponding CAs (Table S1). For example, the CAs are 51.2 ± 1.6°, 49.8 ± 1.1°, and 49.9 ± 0.4° for the RCA droplet with 17.2 nM ATP under 283 K, 293 K, and 303 K respectively. So, the contact area between the lubricant and RCA droplet does not experience significant change with temperature. In our experiment, RCA biological droplet with volume of 2 µL was adopted for SAs test. The relationships between change of SAs and volume of adopted RCA droplet with and without ATP were shown in Figure S6. The difference of the SAs of droplets increases with the droplet’s volumes increase from 1µL to 2 µL, which might be attributed to the static friction between the droplet and substrate. With the volume increased from 2 µL to 4 µL, the SA decreased dramatically. Thus, the subsequent SAs testing were performed at optimal volume (2 µL).


13


Meantime, the change of lubricant’s viscosity may also weakly affect the sliding behavior of the droplet. The viscosity of n-dodecane reduces from 7.12×10-3 m2·s-1, 3.25×10-3 m2·s-1 to 1.58×10-3 m2·s-1 with the temperature grew from 283 K to 303 K, as shown in Table S2. For the cases of RCA droplets with different ATP concentrations, the changes of SAs were different when temperature increased from 283 K to 303 K. For example, the SA decreased 10.1° for RCA droplets with 1.72 nM ATP, but the SA only decreased 3.3° for RCA droplets with 1.72 pM ATP. To further prove the viscosity change with temperature was not the only reason for SA decreased with temperature, silicon oil SD 998 was adopted as lubricant. The plots of SAs of RCA droplets with various ATP concentrations on the silicon oil SD 998 infused slippery surface under 283 K, 293 K, and 303 K, respectively, were shown in Figure S7, Table S3. For the RCA droplet with the same ATP concentration, the decreases of SAs when temperature increased from 283K to 303K were obviously different. This phoneme was similar to the RCA droplet sling behaviors on n-dodecane infused slippery surface. Thus, we considered that the observed droplet mobility enhancement was not only caused by the reduction of lubricant viscosity, but also by the ssDNA transformation in the RCA biological droplet. Based on above experimental phenomena, we speculate the interfacial hydrophobic interaction between the lubricant and the ssDNA in the liquid droplet plays a key role for f, which could be well controlled by varying the ATP concentration and environmental temperature. As shown in Figure 3c, for the RCA droplet with the same temperature, the adhesive force was strengthened with the decrease of ATP concentration, displaying SA increase. In contrast, for the biological droplets with the same ATP concentration, the adhesion and SA decreased with the temperature increased.


14

Page 14 of 32

Page 15 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. SAs of the RCA droplet with various ATP concentrations on the n-dodecane infused slippery surface under different temperatures. Temperature SA

283 K

293 K

303 K

1.72 pM

31.5 ± 0.6°

29.5 ± 0.5°

28.2 ± 0.7°

17.2 pM

31.1 ± 0.7°

28.9 ± 0.8°

24.5 ± 0.5°

172 pM

30.8 ± 0.8°

28.7 ± 0.2°

23.8 ± 0.6°

1.72 nM

29.8 ± 0.5°

26.8 ± 0.5°

19.7 ± 0.6°

17.2 nM

28.8 ± 0.9°

22.7 ± 0.3°

17.5 ± 0.7°

172 nM

25.3 ± 0.3°

19.1 ± 0.5°

16.1 ± 0.9°

1.72 μM

22.7 ± 0.2°

16.7 ± 0.5°

15.2 ± 0.6°

17.2 μM

15.7 ± 0.3°

14.9 ± 0.7°

14.6 ± 0.7°

[ATP]

2.3. Mechanism Affecting the Interfacial Adhesive Force. To clarify how the ATP concentration affects the interfacial adhesive force of a RCA droplet on the n-dodecane infused slippery surface, confocal laser scanning microscopy in depth scan mode was used, as shown in Figure 4. Merged channels and top view confocal images were chosen to investigate the contact mode of the interface between the RCA biological droplet and the n-dodecane. Here, green channel represented the RCA droplet; red channel represented the n-dodecane infused surface; ngreen/nred represented the proportion of droplet and n-dodecane. The droplet/n-dodecane interface was defined as base surface (0 μm). In the case of RCA droplet without ATP, there was no RCA reaction. As a result, lots of ssDNA fragment was present in the biological droplet (Figure S1). A lump of red n-dodecane can be observed through the front view, indicating the n-dodecane was squeezed into the droplet (Figure 4a). It comes from the strong interfacial hydrophobic


15


interaction between short chain ssDNA and n-dodecane, which leads to the RCA droplet in high adhesion mode. In contrast, for the RCA droplet with ATP (17.2 μM), ssDNA with long chain was generated through RCA reaction. In this case, the interface between droplet and n-dodecane was almost horizontal, demonstrating the weak interfacial interaction existed (Figure 4b). This result is consistent with the RCA droplet with ATP in low adhesion mode. These two modes of interfacial interaction can also be confirmed through analyzing the ration of ngreen and nred in the surfaces with various heights, as shown in Figure 4c. For the case of the RCA droplet without ATP, the proportion of n-dodecane increased to 100% at the surface -40 μm below the base surface, indicating the strong interaction existed in this interfacial area. For the RCA droplet with ATP, the proportion of n-dodecane sharply increased from 0 to 89.7% as the height decreased to -10 μm from the base surface, compared to that of in droplet without ATP increased from 0 to 18.9%. This phenomenon suggests that the hydrophobic interaction was obviously weak in the RCA biological droplet with ATP, results in the droplet easily slide on the slippery surface (see Video S2, Supporting Information). In our experiment, the SAs of the droplet were adopted to demonstrate the change of the interfacial adhesion. Large SAs suggested strong interfacial adhesion between ssDNA and lubricant molecules; small SAs indicated weak interfacial adhesion. As shown in Figure 3a, with the ATP concentration decreases, the SA increases. The results demonstrated that the lower ATP concentration, the stronger interfacial adhesion. In our previous report,39 six different methods including Hill Equation, Molecular Dynamics Simulations, Adhesion Test, and so on, were adopted to verify the mechanism of the interfacial adhesion between ssDNA and lubricant caused by hydrophobic interaction. In the case of strong interfacial adhesion, the lubricant was


16

Page 16 of 32

Page 17 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


squeezed into the RCA droplet to form a curving interface, displaying large SA. As shown in the images from confocal laser scanning microscope (Figure 4a), in the case of RCA droplet with large SA and strong hydrophobic interaction, there is a curbing interface between the droplet and lubricant. Similarly, at low temperature, in the case of RCA droplet with ATP concentrations within 172 pM to 1.72 μM, their relatively large SA suggesting existed strong hydrophobic interaction and curving interface under the droplet. Based on the confocal images and ndodecane proportion analyzing, it can be confirmed that the adhesion of RCA droplet was strongly related to the hydrophobic interaction between droplet and lubricant.

Figure 4. Schematic illustration and confocal images of RCA droplets a) without ATP, and b) with 17.2 μM of ATP, displaying the hydrophobic interactions at interface. The inset was the illustration of interfaces with various heights. c) Distributions of n-dodecane at layers with various heights of the RCA droplet without and with ATP. The confocal images and n-dodecane distribution analyze demonstrate the strong and weak hydrophobic interactions for the RCA droplet without and with RCA, respectively.


17


Hydrophobic interactions, hydrogen bonding and van der Waals interaction, are the largest contributors of the interactions between DNA and interface.45 There are many factors contribute to the complex hydrophobic interaction, such as molecular configuration, molecular size, stability and so on.46 Here, we focused on the influence of the ssDNA’s molecular configuration transformed with temperatures. In our experiment, the SAs of the RCA droplet with eight various ATP concentrations (1.72 pM, 17.2 pM, 172 pM, 1.72 nM, 17.2 nM, 172 nM, 1.72 μM, and 17.2 μM) were carefully tested. Based on the experimental results, only the RCA droplets with ATP concentration from 172 pM to 1.72 μM display obviously thermo-responsive adhesion and sliding behavior (Figure 3a). We consider this property may stem from the changing of DNA’s molecular conformation in the RCA droplet, which finally affects the hydrophobic interaction and interfacial adhesive force. Figure 5 illustrates the ssDNA molecular conformation change with temperature on a n-dodecane infused slippery surface. For the RCA biological droplets with ATP concentration from 172 pM to 1.72 μM, the as-prepared ssDNA owns long chain with high flexibility. For instance, RCA droplet with ATP concentration of 1.72 nM, long oligonucleotides were generated, with high molecular weight more than 1500 bp (Figure S8). Due to the various chemical constitutions in phosphoric acid and nitrogenous bases, ssDNA was considered an amphiphilic polyelectrolyte with relatively hydrophilic phosphoric acid and relatively hydrophobic nitrogenous bases. The ssDNA is highly ﬂexible, and has the ability to expose either the phosphodiester backbone or nucleobases to balance its entropy and energy under different conditions, such as solution, surface, temperature and so on.47 In our experiment, the flexible ssDNA can transform to selectively expose either the phosphodiester backbone or nucleobases to the interface. Compared with the phosphate backbones, the aromatic rings contained nucleobases displaying obviously strong hydrophobicity, and affinity to nonpolar


18

Page 18 of 32

Page 19 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


environments.48 Therefore, at the interface of RCA droplet and n-dodecane, the phosphodiester backbones of ssDNA were preferred in RCA droplet. The exposed hydrophobic nucleobases would interact with the n-dodecane molecules, which contributed to the hydrophobic interaction. This complex hydrophobic interaction significantly influenced by exposed hydrophobic moieties of the molecules in aqueous conditions. When the temperature increased from 283 K to 303 K, the flexibility and mobility of the ssDNA further increased, and its molecular configuration would transform to limit the hydrophobic moieties exposed.49 As a result, the interaction between hydrophobic moieties and lubricant molecules reduced, which led to the interfacial adhesion reduced. This phenomenon is consistent with the RCA droplet was easier to slide on the same tiled lubricant infused slippery surface at higher temperature. For example, the RCA biological droplet with ATP concentration of 17.2 nM, SA decreased from 28.8 ± 0.9°, 22.7 ± 0.3°, to 17.5 ± 0.7°, when the temperature increased from 283 K, 293 K to 303 K, respectively.


19


Figure 5. Schematic illustration of the hydrophobic interaction at the interface of RCA droplet with ATP and n-dodecane under a) 283 K and b) 303 K. The concentration of ATP is within 172 pM to 1.72 μM. With the temperature increasing, less hydrophobic moieties were exposed to the interface and connected with the n-dodecane molecules, results in the weaker hydrophobic interaction. However, the adhesion of the RCA droplet with very low ATP concentration, for example 1.72 pM, does not display thermo-responsive property. In this case, the ssDNA with short chain was existed in the RCA droplet, as shown in Figure S9. Most of the hydrophobic moieties were exposed to the interface, displaying very strong hydrophobic interaction and hindering the liquid droplet to move. This phenomenon was similar to short ssDNA fragments’ strong hydrophobic attraction to n-dodecane molecule in the RCA droplet without ATP. Therefore, with the temperature increase to 303 K, only a small percentage of hydrophobic moieties left the droplet/lubricant interface and terminated their hydrophobic interaction with n-dodecane molecules. In this case, very modest adhesive force and SA changing with temperature variation were observed: the SA dropped from 31.5 ± 0.6°, 29.5 ± 0.5°, to 28.2 ± 0.7°, when the temperature grew from 283 K, 293 K to 303 K, respectively. In other hand, for the RCA droplet with relatively high concentration of ATP, 17.2 μM for instance, ssDNA with very long chain would be achieved in the droplet. With the length of the chain grew, the amount of exposed hydrophobic moieties dramatically decreased, and flexibility of ssDNA reduced due to the basebase stacking. Therefore, the 20 K increasing of temperature only promoted a little hydrophobic nucleobase to remove away from the interface. As a result, slight SA change with temperature was observed, from 15.7 ± 0.3°, 14.9 ± 0.7°, to 14.6 ± 0.7°, when the temperature increased from 283 K, 293 K to 303 K, respectively. Therefore, the concentration of ATP in RCA biological


20

Page 20 of 32

Page 21 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


droplets determines the chain lengths of ssDNA, which contributes to various change of hydrophobic interactions with temperature, and finally results in the differences in thermoresponsive property. Through adjusting the ATP concentration of the RCA biological droplet and environmental temperature, precisely control of the liquid-lubricant adhesion and finely tune of the biological droplet’s motion behavior could be achieved. 2.4. Repeatability and Specificity of the Tunable Adhesion. Continuously switchable interfacial adhesive force is crucial for enabling the wide application of the slippery systems. To test the repeatability of the thermal responsive property of the RCA droplet, the droplet was subject to a heating-cooling cycle between 283 K to 303 K for five times. The SA after each heating/cooling process was measured, as shown in Figure 6a. The experimental results demonstrated that the RCA droplet was able to retain its thermal response throughout multiple heating and cooling processes, contributing to the interfacial adhesion switch with good reversibility.

Figure 6. a) Multiple cycles of switching the SAs of a RCA droplet on the n-dodecane infused slippery surface with variations in temperature (283 K, 293 K, and 303 K). The volume of the


21


droplet is 2 μL. b) The sliding behaviors of the biological droplets triggered by ATP, AMP, CTP, GTP and UTP on the slippery surface at 283 K, 293 K, 303 K, respectively. Here, ΔSA is the difference between the SA of the droplet with and without the detections. ΔSA for ATP was obviously larger than that of AMP, CTP, GTP and UTP, demonstrating the ATP’s outstanding specificity towards to the slippery surface. Besides repeatability, specificity is also important. To demonstrate the specificity of ATP towards to the n-dodecane lubricant infused slippery surface at the temperature of 283 K, 293 K, and 303 K, other four ATP analogues, including AMP, GTP, UTP and CTP, were also selected as detections. Followed by RCA process, the droplets with 17.2 μM AMP, GTP, UTP and CTP were prepared separately. As shown in Figure 6b, average SAs at each temperature were presented, with more than five repetitions. ΔSA is the difference between the SA of the droplet without and with the detections. It can be observed that the ΔSA of ATP was obviously larger than that of AMP, GTP, CTP and CTP, demonstrating ATP’s outstanding specificity towards to the n-dodecane infused PDMS surfaces. Similarly, on n-tetradecane infused slippery surface, the ATP initiated RCA droplet also displays obviously specificity, as shown in Figure S8, Figure S10. 4. CONCLUSION To summarize, through design RCA biological droplet as the repellent liquid phase, our work has demonstrated the possibility to precisely control the droplet’s adhesion and motion behaviors on lubricant infused slippery surface. The ssDNA in RCA droplet experience molecular configuration transforming under different temperatures, results in different thermoresponsive adhesion and sliding behaviors. The SA of the RCA biological droplet can be


22

Page 22 of 32

Page 23 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


precisely and reversibly tuned between 14.6° and 31.5° with temperature grows from 283 K to 303 K. With temperature increase, the ssDNA become more flexible and mobile, contributing to its configuration transforming and less hydrophobic moieties exposure. As a result, the hydrophobic interaction and adhesion between biological droplet and lubricant reduced. Therefore, the RCA biological droplet was easier to slide on the slippery surface with high temperature. This thermo-responsive motion behavior regulation of biological droplet would provide new insight for the fabrication of advanced anti-fouling systems through designing the repellent liquid phase, which will be of great importance for various biomedical devices and biomedical applications. ASSOCIATED CONTENT Supporting Information. Supporting information includes RCA working principle, RCA processing time effect on droplet sliding behavior, pictures of PDMS infused lubricants, SAs of droplet with various ATP concentrations on different lubricants, gel electrophoresis image, scheme of RCA droplet with low and high ATP concentration, specificity, CAs of RCA droplet with various concentration of ATP, viscosities of lubricants under different temperature and so on. AUTHOR INFORMATION Corresponding Author Yu Huang, E-mail: [email protected]; Fan Xia, E-mail: [email protected], Tel.: (+86)-2767885201. Author Contributions


23


Y. H., F. X, L. J. conceived the concepts of the research. Y. H., F. X, supervised the work. J. W., K. Y. designed the experiments. J. W., K. Y., X. Y. performed the experiments. All the authors wrote the manuscript. Notes The authors declare no competing financial interest. ACKNOWLEDGMENTS This work is supported by the National Natural Science Foundation of China (51803194, 21525523, 21722507, 21574048, 21874121), the National Basic Research Program of China (973 Program, 2015CB932600), the National Key R&D Program of China (2017YFA0208000). Funding of Key Laboratory of Bio-inspired Materials and Interfacial Science, Technical Institute of Physics and Chemistry, Chinese Academy of Science. ABBREVIATIONS ssDNA, single stranded DNA PDMS, polydimethylsiloxane SA, sliding angle Exo I, exonuclease I Exo III, exonuclease III phi-29 DNA, phi29 DNA polymerase dNTPs, deoxynucleotide solution mixture ATP, adenosine triphosphate AMP, adenosine monophosphate GTP, guanosine-5’-triphosphate disodium salt


24

Page 24 of 32

Page 25 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


UTP, uridine triphosphate CTP, cytidine triphosphate DiD, 1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindodicarbocyanine, 4-Chlorobenzene sulfonate Salt RCA, rolling circle amplification CA, contact angle REFERENCES (1)

Howell, C.; Grinthal, A.; Sunny, S.; Aizenberg, M.; Aizenberg, J. Designing

Liquid‐Infused Surfaces for Medical Applications: A Review. Adv. Mater. 2018, 27, 1802724. (2)

Dai, X. M.; Sun, N.; Nielsen, S. O.; Stogin, B. B.; Wang, J.; Yang, S. K.; Wong, T. S.

Hydrophilic Directional Slippery Rough Surfaces for Water Harvesting. Sci. Adv. 2018, 4, eaaq0919. (3)

Xiao, L. L.; Li, J. S.; Mieszkin, S.; Fino, A. D.; Clare, A. S.; Callow, M. E.; Callow, J.

A.; Grunze, M.; Rosenhahn, A.; Levkin, P. A. Slippery Liquid-Infused Porous Surfaces Showing Marine Antibiofouling Properties. ACS Appl. Mater. Inter. 2013, 5, 10074-10080. (4)

Leslie, D. C.; Waterhouse, A.; Berthet, J. B.; Valentin, T. M.; Watters, A. L.; Jain, A.;

Kim, P.; Hatton, B. D.; Nedder, A.; Donovan, K.; Super, E. H.; Howell, C.; Johnson, C. P.; Vu, T. L., Bolgen, D. E.; Rifai, S.; Hansen, A. R.; Aizenberg, M.; Super, M.; Aizenberg, J.; Ingber, D. E. A Bioinspired Omniphobic Surface Coating on Medical Devices Prevents Thrombosis and Biofouling. Nat. Biotechnol. 2014, 32, 1134-1140. (5)

Park, K. C.; Kim, P.; Grinthal, A.; He, N.; Fox, D.; Weaver, J. C.; Aizenberg, J.

Condensation on Slippery Asymmetric Bumps. Nature 2016, 531, 78-82. (6)

Manna, U.; Raman, N.; Welsh, M. A.; Zayas-Gonzalez, Y. M.; Blackwell, H. E.; Palecek,

S. P.; Lynn, D. M. Slippery Liquid-Infused Porous Surfaces that Prevent Microbial Surface


25


Fouling and Kill Non-adherent Pathogens in Surrounding Media: A Controlled Release Approach. Adv. Funct. Mater. 2016, 26, 3599-3611. (7)

Qiu, R.; Zhang, Q.; Wang, P.; Jiang, L. N.; Hou, J.; Guo, W. M.; Zhang, H. X.

Fabrication of Slippery Liquid-Infused Porous Surface Based on Carbon Fiber with Enhanced Corrosion Inhibition Property. Colloid. Surface. A. 2014, 453,132-141. (8)

Imbrogno, J.; Williams, M. D.; Belfort, G. A New Combinatorial Method for

Synthesizing, Screening, and Discovering Antifouling Surface Chemistries. ACS Appl. Mater. Inter. 2015, 7, 2385-2392. (9)

Epsteina, A. K.; Wong, T. S.; Belisleb, R. A.; Boggsa, E. M.; Aizenberg, J. Liquid-

Infused Structured Surfaces with Exceptional Anti-Biofouling Performance. Proc. Natl. Acad. Sci. U. S. A. 2012, 109, 13182-13187. (10)

Yao, X.; Dunn, S. S.; Kim, P.; Duffy, M.; Alvarenga, J.; Aizenberg, J. Fluorogel

Elastomers with Tunable Transparency, Elasticity, Shape Memory, and Antifouling Properties. Angew. Chem. Int. Ed. 2014, 53, 1-6. (11)

Grinthal, A.; Aizenberg, J. Mobile Interfaces: Liquids as a Perfect Structural Material for

Multifunctional, Anti-fouling Surfaces. Chem. Mater. 2014, 26, 698-708. (12)

Hou, X.; Hu, Y. H.; Grinthal, A.; Khan, M.; Aizenberg, J. Liquid-Based Gating

Mechanism with Tunable Multiphase Selectivity and Antifouling Behavior. Nature 2015, 519, 70-73. (13)

Sunnya, S.; Cheng, G.; Daniel, D.; Lob, P.; Ochoab, S.; Howell, C.; Vogele, N.; Majid,

A.; Aizenberg, J. Transparent Antifouling Material for Improved Operative Field Visibility in Endoscopy. Proc. Natl. Acad. Sci. U. S. A. 2016, 113, 11676-11681.


26

Page 26 of 32

Page 27 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(14)

Elzein, T.; Bejjani, A.; Granda, M. J. G.; Coquillat, A. S.; Ramos, V.; Bonilla, A. M.;

Hernandez, J. R. Towards Cell Selective Surfaces: Cell Adhesion and Proliferation on Breath Figures with Antifouling Surface Chemistry Enrique Martinez-Campos, ACS Appl. Mater. Inter. 2016, 8, 6344-6353. (15)

Wang, P.; Zhang, D.; Lu, Z. Slippery Liquid-Infused Porous Surface Bio-inspired by

Pitcher Plant for Marine Anti-biofouling Application. Colloid. Surface. B. 2015, 136, 240-247. (16)

Lu, Y.; Sathasibam, S.; Song, J.; Crick, C. R.; Carmalt, C. J.; Parkin, I. P. Robust Self-

Cleaning Surfaces That Function When Exposed to Either Air or Oil. Science 2015, 347, 11321135. (17)

Wang, N.; Xiong, D. S.; Deng, Y. L.; Shi, Y.; Wang, K. Mechanically Robust

Superhydrophobic Steel Surface with Anti-Icing, UV-Urability, and Corrosion Resistance Properties. ACS Appl. Mater. Inter. 2015, 7, 6260-6272. (18)

Hao, C. L.; Liu, Y. H.; Chen, X. M.; Li, J.; Zhang, M.; Zhao, Y. H.; Wang, Z. K.

Bioinspired Interfacial Materials with Enhanced Drop Mobility: From Fundamentals to Multifunctional Applications. Small 2016, 12, 1825-1839. (19)

Zheng, Y.; Bai, H.; Huang, Z.; Tian, X.; Nie, F.; Zhao, Y.; Zhai, J.; Jiang, L. Directional

Water Collection on Wetted Spider Silk. Nature 2010, 463, 640-643. (20)

Lu, H. J.; Zhang, M.; Yang, Y. Y.; Huang, Q.; Fukuda, T.; Wang, Z. K.; Shen, Y. J. A

Bioinspired Multilegged Soft Millirobot That Functions in Both Dry and Wet Conditions. Nat. Commun. 2018, 9, 3944. (21)

Liu, M. J.; Zheng, Y. M.; Zhai, J.; Jiang, L. Bioinspired Super-Antiwetting Interfaces

with Special Liquid-Solid Adhesion. Accounts Chem. Res. 2010, 43, 368-377.


27


(22)

Kolle, M.; Salgard-Cunha, P. M.; Scherer, M. R. J.; Huang, F.; Vukusic, P.; Mahajan, S.;

Baumberg, J. J.; Steiner, U. Mimicking the Colorful Wing Scale Structure of the Papilio Blumei Butterfly. Nat. Nanotech. 2010, 5, 511-515. (23)

Pan, S.; Kota, A. K.; Mabry, J. M.; Tuteja, A. Superomniphobic Surfaces for Effective

Chemical Shielding. J. Am. Chem. Soc. 2013, 135, 578-581. (24)

Xiang, T. F; Han, Y.; Guo, Z. Q.; Wang, R.; Zheng, S. L.; Li, S.; Li C.; Dai, X. M.;

Fabrication of Inherent Anti-Corrosion Superhydrophobic Surfaces on Metals. ACS Sustain. Chem. Eng. 2018, 64, 5598-5606. (25)

Alves, D.; Olívia Pereira, M. Mini-Review: Antimicrobial Peptides and Enzymes as

Promising Candidates to Functionalize Biomaterial Surfaces. Biofouling 2014, 30, 483-499. (26)

Berglin, M.; Andersson, M.; Sellborn, A.; Elwing, H. The Effect of Substrate Molecular

Mobility on Surface induced Immune Complement Activation and Blood Plasma Coagulation. Biomaterials 2004, 25, 4581-4590. (27)

Vaterrodt, A.; Thallinger, B.; Daumann, K.; Koch, D.; Guebitz, G. M.; Ulbricht, M.

Antifouling and Antibacterial Multifunctional Polyzwitterion/Enzyme Coating on Silicone Catheter Material Prepared by Electrostatic Layer-by-Layer Assembly. Langmuir 2016, 32, 1347-1359. (28)

Wong, T. S.; Kang, S. H.; Tang, S. K. Y.; Smythe, E. J.; Hatton, B. D.; Grinthal, A.;

Aizenberg, J. Bioinspired Self-Repairing Slippery Surfaces with Pressure-Stable Omniphobicity. Nature 2011, 477, 443-447. (29)

Kim, Y. D.; Dordick, J. S.; Clark, D. S. Siloxane-based Biocatalytic Films and Paints for

Use as Reactive Coatings. Biotechnol. Bioeng. 2001, 72, 475-482.


28

Page 28 of 32

Page 29 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(30)

Zhao, Y. H.; Wu, Y.; Wang, L.; Zhang, M. M.; Chen, X.; Liu, M. J.; Fan, J.; Liu, J. Q.;

Zhou, F.; Wang, Z. K. Bio-Inspired Reversible Underwater Adhesive. Nat. Commun. 2017, 8, 2218. (31)

Wang, L. L.; Heng, L. P.; Jiang L. Temperature-Responsive Anisotropic Slippery Surface

for Smart Control of the Droplet Motion. ACS Appl. Mater. Inter. 2018, 10, 7442-7450. (32)

Yao, X.; Ju, J.; Yang, S.; Wang, J. J.; Jiang, L. Temperature-Driven Switching of Water

Adhesion on Organogel Surface. Adv Mater. 2014, 26, 1895-1900. (33)

Li, J.; Hou, Y. M.; Liu, Y. H.; Hao, C. L.; Li, M. F.; Chaudhury, M. K.; Yao, S. H.;

Wang, Z. K. Directional Transport of High-Temperature Janus Droplets Mediated by Structural Topography. Nat. Phys. 2016, 12, 606-612. (34)

Huang, Y.; Stogin, B. B.; Sun, N.; Wang, J.; Yang, S. K.; Wong, T. S. A Switchable

Cross‐Species Liquid Repellent Surface. Adv. Mater. 2017, 29, 1604641. (35)

Jiang, X.; Feng, J.; Huang, L.; Wu, Y.; Su, B.; Yang, W.; Mai, L.; Jiang, L. Bioinspired

1D Superparamagnetic Magnetite Arrays with Magnetic Field Perception. Adv. Mater. 2016, 28, 6952-6958. (36)

Wang, Z. B.; Liu, Y.; Guo, P.; Heng, L. P.; Jiang, L. Photoelectric Synergetic Responsive

Slippery Surfaces Based on Tailored Anisotropic Films Generated by Interfacial Directional Freezing. Adv. Funct. Mater. 2018, 1801310. (37)

Yao, X.; Hu, Y.; Grinthal, A.; Wong, T.; Mahadevan, L.; Aizenberg, J. Adaptive Fluid-

Infused Porous Films with Tunable Transparency and Wettability. Nat. Mater. 2013, 12, 529534. (38)

Zhao, Z. G.; Zhang, K. J.; Liu, Y. X.; Zhou, J. J.; Liu, M. J. Highly Stretchable, Shape

Memory Organohydrogels Using Phase-Transition Microinclusions. Adv. Mater. 2017, 29,


29


1701695. (39)

Gao, Z. F.; Liu, R.; Wang, J. H.; Dai, J.; Huang, W. H.; Liu, M. J.; Wang, S. T.; Xia, F.;

Jiang, L. Controlling Droplet Motion on an Organogel Surface by Tuning the Chain Length of DNA and Its Biosensing Application. Chem 2018, 4, 2929-2943. (40)

Huang, F. J; Chen, Y.; Wang, Y. Q.; Xia, F. Tunable Superamphiphobic Surfaces: A

Platform for Naked-Eye ATP Detection. Anal. Bioanal. Chem. 2018, DOI: 10.1007/s00216-0181443-6. (41)

Pate, S. K.; Cohen, C. Dynamic Light Scattering from Swollen Poly(dimethylsiloxane)

Networks. Macromolecules 1992, 25, 5201-5252. (42)

Lafuma, A.；Quéré, D. Slippery Pre-Suffused Surfaces. Europhys. Lett. 2011, 96, 56001.

(43)

Guo, T. Q.; Che, P. D.; Heng, L. P.; Fan, L.; Jiang, L. Anisotropic Slippery Surfaces:

Electric‐Driven Smart Control of a Drop's Slide. Adv. Mater. 2016, 28, 6999-7007. (44)

Cheng, D. F.; Urata, C.; Masheder, B.; Hozumi, A. A Physical Approach to Specifically

Improve the Mobility of Alkane Liquid Drops. J. Am. Chem. Soc. 2012, 134, 10191-10199. (45)

Melzak, K. A.; Sherwood, C. S.; Turner, R. F. B.; Haynes, C. A. Driving Forces for DNA

Adsorption to Silica in Perchlorate Solutions. J. Colloid Inter. Sci. 1996, 181, 635-644. (46)

Maheswari, P. U.; Rajendiran, V.; Palaniandavar, M.; Thomas, R.; Kulkarni, G. U. Mixed

Ligand Ruthenium (II) Complexes of 5,6-Dimethyl-1,10-Phenanthroline: The Role of Ligand Hydrophobicity on DNA Binding of the Complexes. Inorg. Chim. Acta. 2006, 359, 4601-4612. (47)

Elder, R. M.; Jayaraman A. Structure and Thermodynamics of ssDNA Oligomers Near

Hydrophobic and Hydrophilic Surfaces. Soft Matter 2013, 9, 11521-11533. (48)

Haidacher, D.; Vailaya, A.; Horváth, C. Temperature Effects in Hydrophobic Interaction

Chromatography. P. Natl. Acad. Sci. U. S. A. 1996, 93, 2290-2295.


30

Page 30 of 32

Page 31 of 32 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(49)

Monserud, J. H.; Schwartz, D. K. Effects of Molecular Size and Surface Hydrophobicity

on Oligonucleotide Interfacial Dynamics. Biomacromolecules 2012, 13, 4002-4011.


31


The table of contents entry


32

Page 32 of 32

Temperature-Driven Precise Control of Biological Droplet's Adhesion

Recommend Documents