The Development of Highly Potent, Selective, and Cellular Active

Subscriber access provided by WEBSTER UNIV

Article

The Development of Highly Potent, Selective, and Cellular Active Triazolo[1,5-a]Pyrimidine-Based Inhibitors Targeting the DCN1-UBC12 Protein-Protein Interaction Shuai Wang, Lijie Zhao, Xiaojing Shi, Lina Ding, Linlin Yang, Zhi-Zheng Wang, Dandan Shen, Kai Tang, Xiao-Jing Li, MAA Mamun, Huiju Li, Bin Yu, Yi-Chao Zheng, Shaomeng Wang, and Hong-Min Liu J. Med. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jmedchem.9b00113 • Publication Date (Web): 25 Feb 2019 Downloaded from http://pubs.acs.org on February 26, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

The

Development

of

Highly

Triazolo[1,5-a]Pyrimidine-Based

Potent,

Selective,

Inhibitors

and

Targeting

Cellular

the

Active

DCN1-UBC12

Protein-Protein Interaction Shuai Wang a,c,d,ɸ, Lijie Zhao a,c,d,ɸ, Xiao-Jing Shi a,c,d,ɸ, Lina Ding a,c,d,ɸ, Linlin Yang e, Zhi-Zheng Wang

a,c,d,

Dandan Shen

a,c,d,

Kai Tang

a,c,d,

Xiao-Jing Li

a,c,d,

MAA

Mamun a,c,d, Huiju Li a,c,d, Bin Yu a,c,d,f,*, Yi-Chao Zheng a,c,d,*, Shaomeng Wang a, b, *, and Hong-Min Liu a,c,d, *. a

School of Pharmaceutical Sciences and Institute of Drug Discovery & Development,

Zhengzhou University, Zhengzhou 450001, China; b

Departments of Internal Medicine, Pharmacology, Medicinal Chemistry, University

of Michigan, 1600 Huron Parkway, Ann Arbor, Michigan 48109, United States; c

Co-innovation Center of Henan Province for New Drug R & D and Preclinical

Safety, Zhengzhou 450001, China; d

Key Laboratory of Advanced Technology of Drug Preparation Technologies

(Zhengzhou University), Ministry of Education of China, Zhengzhou 450001, China; e

Department of Pharmacology, School of Basic Medical Sciences, Zhengzhou

University, Zhengzhou 450001, China; f

State key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing

210023, Jiangsu, People’s Republic of China;

1 / 102

ACS Paragon Plus Environment

Journal of Medicinal Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: The cullin-RING ubiquitin ligases (CRLs) are responsible for about 20% of cellular protein degradation and regulate diverse cellular processes, the dysfunction of CRLs is implicated in human diseases. Targeting the CRLs has become an emerging strategy for the treatment of human diseases. Herein, we describe the discovery of a hit compound from our in-house library and further structure-based optimizations, which have enabled the identification of new triazolo[1,5-a]pyrimidine-based inhibitors targeting the DCN1-UBC12 interaction. Compound WS-383 blocks the DCN1-UBC12 interaction (IC50 = 11 nM) reversibly and shows selectivity over selected kinases. WS-383 exhibits cellular target engagement to DCN1 in MGC-803 cells. WS-383 inhibits Cul3/1 neddylation selectively over other cullins and also induces accumulation of p21, p27 and NRF2. Collectively, targeting the DCN1-UBC12 interaction would be a viable strategy for selective neddylation inhibition of Cul3/1 and may be therapeutically potential for disease treatment in which Cul3/1 are dysregulated.

2 / 102


Page 2 of 102

Page 3 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60




INTRODUCTION

The most prevalent class of ubiquitin ligases are cullin-RING ligases (CRLs), which degrade approximately 20% of cellular proteins through the ubiquitin-proteasome system

1, 2

and regulate diverse cellular processes (e.g. protein homeostasis),

dysfunction of CRLs has been observed in several human diseases including cancers 3.

The covalent neural precursor cell-expressed developmentally down-regulated

protein 8 (NEDD8) modification of CRLs through the ATP-dependent enzymatic cascade has played essential roles in the CRL-mediated downstream substrates’ ubiquitination modifications (Figure 1)

4-6.

To date, there are eight cullin members

(Cul1-3, Cul4A/B, and Cul5/7/9) in mammalian cells, each of which serves as the central component of each CRL and specifically modulates substrate degradation7. Therefore, pharmacological inactivation of CRLs caused by cullin neddylation inhibition has become novel therapeutics for disease treatment8-10. Among the reported NEDD8-activating enzyme (NAE) inhibitors11-17, Pevonedistat (MLN4924) is the most well characterized NAE inhibitor and is presently undergoing 25 clinical trials for the treatment of human diseases including cancer and myelofibrosis18,

19.

Mechanistically, Pevonedistat causes NAE inhibition effectively by covalently binding to NEDD8 and complete activation inhibition of all CRLs, thereby leading to accumulation of CRL substrates18.

3 / 102



Page 4 of 102

-The enzymatic cascades for protein neddylationN8 N8

N8

N8

E1

E2

Substrate

Activation

Conjugation

Ligation

E1

E2

Substrate

NAE1/UBA3

UBE2M/UBC12 UBE2F

E3

AMP + PPi N8

ATP

Substrate Deneddylation

Non-Cullins & Cullins (e.g. Cul1, Cul2, Cul3, Cul4A/B, Cul5, Cul7, Cul9)

Figure 1. The enzymatic cascades for protein neddylation. In the human genome, there are five defective in cullin neddylation (DCN) isoforms (DCN1-5)20. DCN1 is the most commonly dysregulated in many squamous cell carcinomas (SCCs) 21, 22 and is involved in the regulation of the neddylation pathway and tumorigenesis23,

24.

DCN1 overexpression is negatively correlated with

cause-specific survival and associated with anchorage-independent growth in soft agar

25.

Structurally, DCN1 interacts with both cullin 1 and UBC12 through two

separate domains – the WHB domain of cullin 1 and the acetylated N terminus of UBC12, thereby facilitating cullin neddylation26-29. Intriguingly, the interaction between DCN1 and UBC12 regulates assembly of a multiprotein complex, the interruption of this interaction can cause defective cullin neddylation25,

30.

Computational analysis of the X-ray co-crystal structure of DCN1 in complex with UBC12 indicates that five hydrophobic hotspots exist at the UBC12 peptide binding site and could be used for the development of DCN1 inhibitors

30-33.

Guy et al

reported that the piperidinyl urea-based DCN1 inhibitors NAcM-OPT and NAcM-COV (Figure 2) effectively blocked the DCN1-UBC12 interaction (IC50 = 60 nM) , selectively inhibited Cul1/3 neddylation in HCC95 cells overexpressing DCN1 and suppressed anchorage-independent growth of HCC95 cells25, 31, 34. Based 4 / 102


Page 5 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


on the 12-residue UBC12 peptide, Wang et al recently synthesized a library of peptidomimetic inhibitors that bound to DCN1 protein with high affinity (KD < 10 nM), of which DI-404 (Figure 2) effectively blocked the DCN1-UBC12 interaction, inhibited neddylation of Cul3 selectively over other cullins in both H2170 and SK-MES-1 cells, and increased expression of NRF2 protein, a cullin 3 CRL (CRL3) substrate35. The Wang group also developed DI-591 (Figure 2) that bound to human DCN1 tightly (Ki = 12 nM) , blocked cellular DCN1–UBC12 interaction in KYSE70 cells, and inhibited neddylation of Cul3 selectively over other cullins in different cells 30.

These findings have demonstrated that blocking the DCN1-UBC12 interaction may

be a viable strategy for the treatment of Cul3 dysregulated diseases36, 37. In the present work, we report the discovery of the hit compound E1 (also named as WS-291, IC50 = 5.82 μM) and further structure-based optimizations, leading to the generation of triazolo[1,5-a]pyrimidine-based DCN1 inhibitors. The shortlisted lead compound WS-383 effectively blocked interaction between DCN1 and UBC12 (IC50 = 11 nM), caused selective Cul3/1 neddylation inhibition over other cullins, and induced accumulation of p21, p27 and NRF2. Our studies demonstrate that the interaction blockage between DCN1 and UBC12 could be a feasible strategy for the treatment of Cul3/1 dysregulated diseases.

5 / 102



Page 6 of 102

CF3

Cl N

Cl

O N

N

O N

N H

N H

O N H Irreversible DCN1 inhibitor NAcM-COV TR-FRET IC50  40 nM

NAcM-OPT TR-FRET IC50 = 60 nM O H N

O N H S

O N

O

H N

O N H

O

H N

O N H S

O

O

H N

N O

N

Cl NH2

DI-591 FP Ki = 12 nM

DI-404 FP KD = 6.9 nM

Figure 2. Representative small-molecule DCN1 inhibitors. 

RESULTS AND DISCUSSION

Structure-based inhibitor design based on the identified hit compound E1. In order to identify hit compounds targeting the DCN1-UBC12 protein-protein interaction, we developed the HTRF (Homogeneous Time Resolved Fluorescence) assay based on the interaction between DCN1 PONY domain and acetylated UBC12 N-terminal (Z’ factor na0.7, Figure S1). The Eu3+ cryptate conjugated glutathione S-transferase antibody (donor beads) binds the GST-DCN1 and d2-conjugated streptavidin (acceptor beads) to recognize N-terminally acetylated UBC12. DI-591, an active control compound used in this work, strongly inhibited the DCN1-UBC12 interaction (IC50 = 19 nM), which was comparable to that reported by Wang et al. 30, indicating that the assay developed was reliable for biochemical screening against the DCN1-UBC12 protein-protein interaction.

Our compound collection was composed of ~15,000 compounds with around 5,000 distinct scaffolds, of which 10,0000 compounds were purchased from ChemDiv and 6 / 102


Page 7 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5,000 compounds synthesized in our lab. After screening our small-molecule library based on the above established method, the compounds with the inhibition rates over 50% at 50 μM were selected as hit compounds for further optimization. To our delight, four promising hit compounds were identified (the SMILES strings for some compounds and their inhibition rates are provided in the supporting information), of which compound E1 (also named as WS-291) inhibited DCN1 with an IC50 value of 5.82 μM. Given its acceptable potency, compound E1 was used as the starting point to perform further structural optimizations. Initially, we predicted the binding model of E1 within the UBC12 binding site using the recently reported DI-591/DCN1 complex (PDB ID: 5UFI) as the docking receptor

30.

As shown in Figure 3A, E1

(colored in magenta) occupied the hydrophobic pocket, partially overlapped with DI-591 (colored in cyan) within the UBC12 binding site of DCN1 (colored in green). Clearly, the phenyl ring in E1 occupied the same region with DI-591, the methyl group attached to the tetrazole moiety was directed toward a new sub-pocket formed by I83, I86 and P97, while another hydrophobic pocket occupied by the cyclohexyl group in DI-591 was adjacent to the triazole ring, installation of substituents at this site may increase the binding affinity to DCN1 by occupying this hydrophobic pocket. As shown in Figures 3B and 3C, hydrophobic effects of E1 and DI-591 drove association at the sites defined by F117, I86, F89, F109, I105, V102, and F164 on DCN1, an H-bond interaction was formed with Y181. Differently, DI-591 formed additional H-bond interactions with C115 and Q114, while the structurally rigid E1 had more hydrophobic interactions by forming π-π stacking with F117 and F164 7 / 102



residues (Figure 3D). Based on the structural analysis, we speculate that introduction of substituents to the tetrazole and triazole moieties may increase the binding affinity to DCN1 by occupying additional hydrophobic pockets, while keeping the S-tethered aromatic rings intact.

Figure 3. Structural basis of E1-DCN1 binding. (A) E1 (magenta) and DI-591 (cyan) occupied the same binding site in DCN1 (green). Protein (PDB ID: 5UFI) was shown as cartoon and small molecules were shown as sticks. The surface (white) of the binding pocket was shown in 20% transparence. (B) and (C) Interaction models of E1 and DI-591 in DCN1, respectively. For clarity, DCN1 was shown in 80% transparent cartoon. DCN1 residues interacting with E1 were shown as sticks. Hydrogen bonds 8 / 102


Page 8 of 102

Page 9 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


were shown as dashed lines. (D) 2D-view of the interactions between E1 and DCN1. Variations of substituents attached to the tetrazole ring. As shown in Figure 3A-C, the methyl group in E1 was directed to the hydrophobic pocket occupied by the N- propionyl group of DI-591, replacement of the methyl group with larger groups may better occupy this hydrophobic pocket, thereby increasing binding affinity. As shown in Figure 4, E2 bearing a phenyl group inhibited the DCN1-UBC12 interaction with an IC50 value of 15.81 μM, about 2.7-fold less potent than E1, while E3 possessing a p-hydroxyphenyl group showed about 4.1-fold increase in potency (IC50 = 3.88 μM) compared to E2. To our surprise, substitution of the methyl group in E1 with the N,N-dimethyl ethyl group gave compound E4, which exhibited significantly increased biochemical potency against DCN1 with an IC50 value of 130 nM, around 45-fold more potent than E1, indicating the importance of the N,N-dimethyl aminoethyl group for the activity. OH NH

Me

N N N N S

N N N

N E1 IC50 = 5.82  1.10 M

N N

N N

N

N N N N S

N N N N S

N N N N S

N

E2 IC50 = 15.81  4.04 M

Cl

N

N

E3 IC50 = 3.88  0.9 7M

N N N

N

E4 IC50 = 130  5 nM

Figure 4. Preliminary SARs studies based on the starting point E1 Scaffold replacement of the core structure. With compound E4 in hand, we next replaced the [1,2,4]triazolo[1,5-a]pyrimidine with several heterocyclic rings such as the pyrazolo[1,5-a]pyrimidine, thieno[3,2-d]pyrimidine, and quinazoline, yielding compounds E5, E6 and E7, which showed significantly reduced potency, compared to 9 / 102



E4

(Figure

5).

The

results

underscore

the

Page 10 of 102

importance

of

the

[1,2,4]triazolo[1,5-a]pyrimidine for the activity. However, it should be noted that the phenyl group in E4 may also be crucial for the interaction, the lack of the phenyl group in compounds E5, E6 and E7 may lead to changes of their binding models, thus causing the decreased activity. NH

Cl

N N N N S N N N E5 IC50 = 4.21  1.21 M

NH

Cl

Cl NH

N N N N S

N N N N S S

N N

O O

E6 IC50 > 50 M

O

N

N E7 IC50 > 50 M

O

Figure 5. Scaffold replacement Variations of substituents (R1) attached to the triazolopyridine ring. Inspired by the favorable potency of E4, we next replaced the phenyl ring in E4 with several aliphatic groups to further explore the structure-activity relationships (Table 1). Interestingly, replacement of the carbon (C) atom in E5 with the nitrogen (N) atom yielded E8, which effectively blocked the DCN1-UBC12 interaction with an IC50 value of 51 nM, being around 83 and 2.5-fold much more potent than E5 and E4. The data may suggest that the methyl group was preferred over the phenyl group for the activity, the replacement of the N atom in the bicyclic N-heterocycle with the C atom caused dramatic decrease of the activity possibly due to the loss of potential electrostatic interaction in E5. Compounds E9 and E10 showed reduced potency with the IC50 values of 706 and 1360 nM, respectively. Compound E11 bearing a cyclopropyl ring exhibited comparable activity (IC50 = 127 nM) with E4. 10 / 102


Page 11 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Interestingly, E8 and E12 showed favorable potency with the IC50 value of 51 and 61 nM, respectively. To conclude, the activity of E8, E9, and E10 decreased correspondingly with the increase of the steric hindrance of R1, while E4 and E11 bearing more steric R1 groups (e.g. Ph, cyclopropyl) also exhibited acceptable potency, much more potent than E9 and E10. The rationale for the activity discrepancy may be due to that E4 and E11 adopted distinct binding models in the UBC12 binding site of DCN1.

11 / 102


Journal of Medicinal Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46

Page 12 of 102

Table 1. Structures and biochemical potency of compounds E4 and E8-E12. NH N N N N S

Cl

NH N N N N S N N

N N R1

N

Cl

N

N

N

E12

E4, E8-E11

IC50 (nM) a Compound

IC50 (nM) a

R1

Compound

R1

(HTRF) E4 E8 E9 a Data

Me

(HTRF)

130 ± 5

E10

1360 ± 5

51 ± 4

E11

127 ± 3

706 ± 2

E12

are the mean ± SD. All experiments were carried out at least three times.

12 / 102


--

61 ± 1

Page 13 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Variations of substituents (R1 & R2) attached to the triazolopyridine ring. As shown in Figure 3A, the hydrophobic pocket occupied by the cyclohexyl group in DI-591 was adjacent to the triazole ring, we therefore speculated that installation of substituents to the triazole ring may occupy this hydrophobic pocket, thus increasing binding affinity to DCN1. Therefore, further SARs studies were performed based on the compound E8 by adding additional hydrophobic groups (Table 2). Generally, in comparison with compounds E8 and E12, most of the compounds in Table 2 showed decreased but acceptable potency against DCN1, only E15, E17, E18, E20, and E27 inhibited the DCN1-UBC12 interaction with the IC50 values less than 100 nM. Particularly, compound E20 effectively inhibited DCN1 with an IC50 value of 22 nM, while replacement of the methyl group in E20 with the phenyl group afforded compound E25, which exerted significantly decreased activity toward DCN1. Unexpectedly, E26 bearing an ethyl group (R1) showed 26-fold decrease of the activity compared to E20. One possible explanation for the activity discrepancy was that the R1 group was directed toward a narrow sub-pocket in DCN1, a slight increase of the size of the R1 group may cause steric hindrance and finally led to decrease of the activity. A similar trend was also observed in compounds E8-E12 (Table 1).

13 / 102



Page 14 of 102

Table 2. Structures and biochemical potency of compounds E13-E27. NH

Cl

N N N N S N N R1

N

R2 S

N


R1

R2


R1

R2

(HTRF)

(HTRF)

E13

Me

214 ± 3

E21

Me

438 ± 3

E14

Me

137 ± 3

E22

Me

532 ± 4 S

E15

Me

67 ± 1

E23

Me

4889 ± 8 Cl O

E16

Me

268 ± 2

E24

14 / 102


Me

O

309 ± 3

Page 15 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46


a Data

E17

Me

59 ± 2

E25

290 ± 2

E18

Me

58 ± 1

E26

352 ± 3

E19

Me

209 ± 2

E27

79 ± 1

E20

Me

22 ± 1


15 / 102



Variations of substituents (R2 & R3) attached to the triazolopyridine ring. Encouraged by the biochemical potency of compound E20, we next mainly focused on the molecular fine-tuning of substituents attached to the phenyl ring of E20, leading to the generation of compounds E28-E44, and the data were summarized in Table 3. As shown in Table 3, substituents attached to the phenyl ring had remarkable effect on the activity. Generally, compounds containing 2 and 3-substituted phenyl ring had significantly reduced activity compared to those with 4-substituted phenyl groups. Compounds E33 (2-Br), E34 (3-Br), E37 (2-CF3), E38 (3-CF3) and E42 (2,6-diCl) possessed relatively weak inhibitory activity with the IC50 values over 190 nM. One exception is E29 bearing a nitro group at the 2-position of the phenyl ring, which inhibited DCN1 potently (IC50 = 24 nM), comparable to those with para-substitutions on the phenyl ring. The rationale for the decreased potency of the compounds containing 2 and 3-substituted phenyl rings was that the phenyl group was inserted into a narrow sub-pocket, installation of substitutions at the 2 or 3-position of the phenyl group may cause steric hindrance, thus affecting their binding to DCN1 (as shown in Figure 7A). In contrast, the substitutions attached to the 4-position of the phenyl group were well tolerated. Compared to E20, some of these compounds showed comparable or marginally increased potency against DCN1 with the IC50 values less than 20 nM, of which E31 (also named as WS-383) showed the best potency against DCN1 with an IC50 value of 11 nM. Apart from the variations of the bicyclic N-heterocycle ring (as shown in Figure 5), further SARs studies presented in Table 3 indicated that introduction of methyl or n-pentyl group (R3) to the 16 / 102


Page 16 of 102

Page 17 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


[1,2,4]triazolo[1,5-a]pyrimidine ring was also detrimental to the activity, E44 (also known as WS-524) was found to be inactive toward the DCN1-UBC12 interaction. E43 also showed significantly decreased activity (IC50 = 3363 nM), about 306-fold less potent than WS-383. The data presented in Tables 1-3 highlighted the importance of the [1,2,4]triazolo[1,5-a]pyrimidine scaffold for the activity and also revealed essential structural elements for blocking the DCN1-UBC12 interaction.

17 / 102



Page 18 of 102

Table 3. Structures and biochemical potency of compounds E28-E44. NH N N N N S 3 R N

Cl

N N

R2 S

N


R2

R3

IC50 (nM) a R2

Compound

R3

(HTRF)

(HTRF) F F

E28

NO2

H

39 ± 1

E37

H

654 ± 3

H

1076 ± 6

H

28 ± 1

H

17 ± 1

F F

O 2N

E29 E30

F

F

H

24 ± 1

E38

H

16 ± 1

E39

E31

F

O

F Cl

H

11 ±1

E40

(WS-383)

18 / 102


Cl

Page 19 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46


Cl

E32

Br

H

15 ± 1

E41

F

H

22 ± 1

H

192 ± 2

Me

3363 ± 8

Cl

Br

E33

H

824 ± 3

E42 Cl

Br

E34

H

195 ± 2

E43 E44

E35

H

78 ± 1 (WS-524)

E36 a Data

F F F

H

186 ± 2


19 / 102


Cl

Cl

>50,000


Molecular modelling studies. To further explore the possible binding mode of compound WS-383 and WS-524 with DCN1, and explain their activity discrepancy, a molecular modelling study was performed using molecular docking and molecular dynamics (MD) simulations. The crystal structure of DI-591 bound to DCN1 (PDB code: 5UFI) was selected as the docking receptor 30. DI-591 was first re-docked into the protein to investigate the reliability of our docking simulation using the Dock module of MOE 2015.10. The RMSD value between crystal structure and docked structure of DI-591 was 1.3 Å, suggesting that our docking study had a convincing accuracy (Figure S2). Compound WS-383 and WS-524 were then docked into the hydrophobic binding pocket of DCN1. The internal reorganization of binding was considered in Figure 6. To consider internal reorganization of binding, we docked compound WS-383 with the released crystal structures of 6B5Q, 5V83, 5V86, 6BG3, 6BG5, which were complexes of DCN1 bound with ligand. As shown in Figure 6, the binding modes of these systems were consistent with the previous reports from the Wang group

35,

which suggested that the reorganization of F117 and F109 was not

necessary for the combination of our compounds and DCN1. And the other portion of DCN1 had a stronger interaction with compounds than the conformational changes at Phe109 and Phe117.

20 / 102


Page 20 of 102

Page 21 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Docking results of WS-383 with DCN1. (A) Predicted binding model of compound WS-383 (magenta) in complex with 6B5Q. (B) Predicted binding model of compound WS-383 (orange) in complex with 5V83. (C) Predicted binding model of compound WS-383 (cyan) in complex with 5V86. (D) Predicted binding model of compound WS-383 (dark pink) in complex with 6BG3. (E) Predicted binding model of compound WS-383 (green) in complex with 6BG5. The associated residues were shown in white sticks.

In this study, the docking simulation was performed with rigid (Figure 7) and induced 21 / 102



fit (Figure 8) strategies, respectively. The rigid model was chosen to analyze the binding mode. The lowest-energy docking conformations of two compounds were basically the same, except that compound WS-524 had an extra pentyl group exposed to the solvent region (Figure 7). The 4-Cl phenyl group was deeply inserted into the binding pocket and was observed to interact at the hydrophobic site defined by hydrophobic interactions with Ile86, Phe89, Val102, Ile105, Ala106, Phe109, Ala111, Phe117 and Phe164. Among these residues, 4-Cl phenyl group also had a π-π stacking with Phe89, Phe109, Phe117 and Phe164. The 5-methyl pyrimidine group was observed to interact at the hydrophobic site defined by hydrophobic interactions with Ala180, Tyr181 and Leu184. Meanwhile, Ala98 had an arene-H electrostatic interaction with the pyrimidine ring. The tetrazole ring had an arene-H electrostatic interaction with Pro97. Furthermore, the N,N-dimethyl group was observed to interact at the hydrophobic site defined by hydrophobic interactions with Ile83 and Ile86. These interactions may be responsible for the observed potency of WS-383.

22 / 102


Page 22 of 102

Page 23 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. Docking results of WS-383 and WS-524. (A) Superimposition of WS-383 (cyan) and WS-524 (orange) with DCN1. Protein (PDB code: 5UFI) was shown in surface, and hydrophobic region was shown in green. (B) Predicted binding model of compound WS-383 (cyan) in complex with DCN1. (C) Two dimensional (2D) representation of compound WS-383 in complex with DCN1; (D) Detailed views of WS-383 and interacting residues in the P1−P3 pockets.

To investigate the binding mode of compounds WS-383 and WS-524 with 5UFI, we 23 / 102



considered the induced fit strategy on docking in this study, docking results were shown in Figure 8. As for the docking results, there was little difference between rigid model and induced fit model as the binding modes and the related interactions of two systems were consistent.

Figure 8. Docking results of WS-383 and WS-524 with 5UFI. (A) Superimposition of WS-383 (cyan) and WS-524 (orange) with DCN1. Protein was shown in surface, and hydrophobic region was shown in green. Compound WS-383 and WS-524 were shown in dark cyan and dark pink sticks, respectively. (B) Predicted binding model of compound WS-383 (dark cyan) in complex with DCN1, the associated residues were shown in white sticks. As shown in Table 2, the increase of the hydrophobic properties of R2 group decreased the potency for E13-E24 (except E20), suggesting the importance of the steric effect of the group R2 in sub-pocket P1. Too bulky substituent at sub-pocket P1 could cause a steric incompatibility and lead to decreased activity. However, compounds E15, E17, E18 and E20 showed comparable inhibitory activity with E8 (IC50 = 51 nM) due to the π-π stacking. E20 effectively inhibited DCN1 with an IC50 value of 22 nM possibly because of the π-π stacking with surrounding residues. To conclude, the π-π stacking was important for the activity, and there would be a 24 / 102


Page 24 of 102

Page 25 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


balance between the steric effect and π-π stacking effect of group R2 in sub-pocket P1. This phenomenon was further observed in compounds listed in Table 3 (E28-E42). The potency decreased obviously with the increase of steric hindrance in E37, E38, E36. The activity loss of WS-524 may be due to that the hydrophobic n-pentyl group was exposed to the solvent region, which caused the complex unstable and then led to the loss of the activity. Molecular dynamic simulations were then implemented to predict the interactions of WS-383, WS-524, and DI-591 in complex with DCN1 (PDB code: 5UFI) in a constant process using Gromacs 5.1.4. The Amber99SB-ildn force field and the gaff force field was used for the protein and ligand, respectively. Each protein-ligand complex was subjected to a 20 ns MD simulation. As shown in Figure 9A, the 5UFI-DI-591 and 5UFI-WS-383 complexes stabilized quickly, and the RMSD value was about 1 Å and 1.5 Å, respectively, while the RMSD value of 5UFI-WS-524 complex was stable at around 3.8 Å after a longer time. This result indicated that 5UFI-WS-383 was more stable during the MD progress, and WS-383 bound to DCN1 more tightly than WS-524. The interactions between WS-383 and DCN1 after MD simulations was not significantly different from that of the start structure with DCN1 (Figure 9B). However, WS-524 could not bind well with DCN1 and would get out of the binding pocket after repeated 20 ns MD (5 times). The exposed methyl (E43) or pentyl (WS-524) group did not form any interactions with DCN1. One possible reason was that the steric incompatibility between WS-524 and the sub-pocket P1 pushed the ligand out of the pocket. At the same time, the change in dihedral angle 25 / 102



was also observed in WS-383. The tetrazole ring of WS-383 had a flip to get a more stable conformation as shown in Figure 9B and moved out from a hydrophobic region (see Figure 7A), while the conformation of WS-524 did not have this change. Therefore, another possible reason was that the methyl (E43) and pentyl (WS-524) groups were constraint to this flip and made the hydrophilic tetrazole ring stay at an unfavorable region for binding. Also, the exposed methyl (E43) and pentyl (WS-524) groups in the solvent region made the combination unstable. The steric incompatibility between WS-524 and the sub-pocket P1 may also push the ligand out of the pocket, no flip in WS-524 was observed in this case. The steric incompatibility only or together with the flip made WS-524 move out from the binding pocket after MD simulations (Figure 9C) and thus causing a decreased potency. Interactions between WS-524 and surrounding residues after the 20 ns MD simulations were shown in Figure 9D.

26 / 102


Page 26 of 102

Page 27 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 9. (A) RMSD plot of the studied complexes during MD simulations. (B) Superimposition of the start structure (cyan) and that (yellow) after MD of compound WS-383 with DCN1. Protein (PDB code: 5UFI) was shown in white surface. (C) Superimposition of the start structure (orange) and that (pink) after MD of compound WS-524 with DCN1. Protein was shown in white surface. (D) Interactions between compound WS-524 and surrounding residues after the 20 ns MD simulations.

The MM-PBSA method was utilized to calculate the binding free energy using 38. The ΔEbinding of compound DI-591, WS-383 and WS-524 with DCN1 were -266.143 kJ/mol, -278.381 kJ/mol and -64.658 kJ/mol, respectively, suggesting that WS-383 had a similar binding affinity with DI-591 and a better bioactivity than WS-524 (Table 4). The ΔEelec plays a crucial role in the binding affinity, and the ΔEvdw also has an important influence on the activity. Because of the poor contact with protein, WS-524 exhibited a low ΔEbinding. The decreased potency of E43 and WS-524 27 / 102



Page 28 of 102

implied that the exposed nonpolar group was unfavorable for the bioactivity and the small change in dihedral angle might be important for the activity. This conclusion could help us in the further drug design and optimization. Table 4. The binding free energy of two systems. All energies are in kJ/mol. ΔEvdw

ΔEnonpolar

ΔEbinding

-251.756 -259.791 256.759

-11.355

-266.143

5UFI-WS-383 -182.696 -206.778 129.767

-18.764

-278.381

5UFI-WS-524

-0.083

-64.658

5UFI-DI-591

-50.001

ΔEelec

-18.486

ΔEpolar

3.983

WS-383 inhibits DCN1-UBC12 interaction selectively and reversibly. WS-383 (Figure 10A), the most potent compound, inactivated the DCN1-UBC12 interaction with an IC50 of 11 nM (Figure 10C). Besides, the structurally similar compound WS-524 (Figure 10B) was found to be devoid of the inhibitory activity against the DCN1-UBC12 interaction (Figure 10C) and therefore used as the negatively inactive control. As some of small-molecule kinase inhibitors (e.g. Osimertinib) approved by FDA structurally feature the heteroatom-tethered aromatic system

39,

our shortlisted

compound WS-383 also possessed the similar structural features, namely the S-tethered tetrazole and [1,2,4]triazolo[1,5-a]pyrimidine ring. We therefore examined the inhibitory activity of WS-383 against a panel of kinases such as BTK, CDKs and EGFR [L858R] using staurosporine and afatinib as the positive controls. As shown in Figure 10D, WS-383 showed weak inhibitory activity at 10.0 μM, highlighting its selectivity to the DCN1-UBC12 interaction over the selected kinases. The IC50 values of staurosporine against BTK, CDK1, CDK2, CDK4, CDK6, CDK7, and CDK9 were 28 / 102


Page 29 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


100, 2.4, 1.0, 27, 133, 72 and 17 nM, respectively. The IC50 value of afatinib against EGFR [L858R] was 0.85 nM.

It has been reported that the thiol group in glutathione can react with 3-benzyl-7-(2-benzoxazolyl)thio-1,2,3-triazolo[4,5-d]pyrimidine (VAS2870), thereby causing off-target effects through covalent modifications 40. The first covalent DCN1 inhibitor NAcM-COV (TR-FRET IC50 = 28 nM) has been rationally designed through covalent linkage to the targeted Cys115 in the binding site of UBC12

25.

In

this work, a dilution assay was used to test the reversibility of WS-383 for DCN1, DI-591 was used as a control. The results revealed that 80-fold dilution of the DCN1/WS-383 and DCN1/DI-591 mixture resulted in the recovery of the activity, suggesting the reversible inhibition of WS-383 and DI-591 toward DCN1 (Figure 10E). Ultrafiltration experiment was also performed against assay buffer after incubation of DCN1 with high concentration of WS-383 (500 nM). After the ultracentrifuge, the activity can also be restored (Figure 10F), which further confirmed the reversible binding of WS-383 and DI-591 to DCN1. Hence, all the data indicate that WS-383 inhibited the DCN1-UBC12 interaction selectively and reversibly.

29 / 102



Figure 10. WS-383 inhibited the DCN1-UBC12 interaction selectively and reversibly. (A) Structure of WS-383; (B) Structure of WS-524; (C) Inactivation curve of WS-383, WS-524 and DI-591 against the DCN1-UBC12 interaction performed by the HTRF assay; (D) Inhibitory activity of WS-383 (10 μM) against a panel of kinases; (E & F) The reversibility of WS-383 to DCN1 was determined by the HTRF based dilution assay with a starting concentration at 500 nM following 80-fold dilution (E) and ultrafiltration experiment starting concentration at 500 nM following six round centrifuge (F) DI-591 was used as a control with a starting concentration at 800 nM. Data are the mean ± SD. P < 0.01 was considered statistically significant. All experiments were carried out at least three times. UBC12 and DCN1 are overexpressed in several gastric cancer cells. As an oncogene, DCN1 is highly expressed in several human tumors. It has been reported that DCN1 mRNA is overexpressed in 21 of 44 (48%) primary lung, 16 of 45 (36%) 30 / 102


Page 30 of 102

Page 31 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


head and neck, and 4 of 9 (44%) cervical carcinomas

41-43,

and the expression of

DCN1 is significant higher in prostate cancer compared to adjacent normal tissue 44. Nevertheless, the expression and neddylation of DCN1 have not been reported in gastric cancer cell yet. Hence, the protein expression and mRNA levels of UBC12 and DCN1 in four gastric cancer cell lines (MGC-803, SGC-7901, HGC-27 and BGC-823) and gastric epithelial cell line GES-1 were investigated. As shown in Figure 11, relative to HGC-27 and GES-1, not only in protein level (Figure 11A & B), but also in mRNA level (Figure 11C), UBC12 was overexpressed in the poor differentiated gastric cancer cell lines MGC-803 and BGC-823, and moderate differentiated gastric cancer cell lines SGC-7901. Besides, there was no significant difference for the DCN1 expression in both protein (Figure 11A) and mRNA levels (Figure 11D) in these cell lines. However, relative to HGC-27, BGC-823, and GES-1 cell lines, DCN1 appeared to be over modified in both MGC-803 and SGC-7901 cells (Figure 11A, the upper band). However, it remains unclear how the DCN1 protein was modified in cells. The DCN1 protein could be possibly modified with NEDD8 or ubiquitin. To date, modification of DCN1 with ubiquitin has been reported45, no NEDD8 modification on DCN1 has been reported. Hence, MGC-803 was chosen for our following cellular studies due to its overexpression of UBC12 and DCN1 neddylation.

31 / 102



Figure 11. Protein and mRNA levels of UBC12 and DCN1 in the five gastric cell lines (MGC-803, SGC-7901, HGC-27, BGC-823, and GES-1). (A & B) Expression of UBC12, DCN1 and neddylated/ubiquitinated DCN1 (N8/Ub-DCN1) in the five indicated gastric cell lines; (C & D) Relative amount of UBC12 (C) and DCN1 (D) mRNA in the five gastric cell lines were quantified with RT-qPCR. GAPDH was used as the loading control. Data are the mean ± SD. P < 0.01 was considered statistically significant. All experiments were carried out at three times.

We next employed the cellular thermal shift assay (CETSA) to assess the target engagement of WS-383 in MGC-803 cells using the well characterized DI-591 as the control. Clearly, the DCN1 protein in MGC-803 cells was denatured at 53 °C with DMSO treatment (Figure 12), while both treatment with WS-383 and DI-591 for 1 h dose-dependently enhanced the cellular thermal stability of DCN1 (Figure 12A and 32 / 102


Page 32 of 102

Page 33 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


B). WS-383 enhanced the thermal stability of cellular DCN1 protein even at 1.0 μM, indicating cellular target engagement of WS-383 in MGC-803 cells.

Figure 12. Enhancement of thermal stability of DCN1 protein by WS-383 and DI-591 treatment in MGC-803 cells. (A & B) Protein levels of DCN1 in MGC-803 cells treated with WS-383 (A) and DI-591 (B) at the indicated concentrations for 1 h, followed by heating at 53 °C for 3 min were analyzed by western blot, GAPDH was used as a loading control.

WS-383 inactivates cullin1 and cullin3 neddylation and accumulates CRL substrates p21, p27, NRF2 in cells. MLN4924, the most well characterized NEDD8-activating enzyme (NAE) inhibitor, has been reported to inhibit neddylation of all cullins in many cancers46-48. Before examining the cellular activity of WS-383, the effect of MLN4924 on cullin neddylation was initially investigated in human gastric cell line MGC-803, of which UBC12 and DCN1 were overactivated. The results showed that treatment of MGC-803 cells for 24 h with MLN4924 at 1.0 µM caused broad neddylation inhibition of cullins (Figure 13A). The cellular effect of 33 / 102



WS-383 on cullin neddylation in MGC-803 cells was also examined using WS-524 as the negative control. After 24 h treatment, the neddylation status of cullin substrates was examined, showing that WS-383 blocked Cul3 neddylation at 3 µM and also had certain inhibition of Cul1 neddylation at 10 µM, but was not effective in inhibiting neddylation of other cullin members (Figure 13A). On the other hand, WS-524, the negative control, failed to inhibit neddylation of all cullin substrates (Figure 13A). To further confirm the neddylation inhibitory activity of WS-383 in cellular levels, KYSE70, the same cell line used in previous publication 30, was treated with WS-383 for 24 h. As shown in Figure 13B, in KYSE70 cells, WS-383 blocked Cul3 neddylation dose dependently and also decreased Cul1 neddylation at 10 µM slightly, while no impact on neddylation inhibition of other cullin members was observed. To make a side-by-side comparison between WS-383 and DI-591, the cellular deneddylation activity of DI-591 on cullin neddylation in MGC-803 cells was also examined. As indicated in Figure 13C, DI-591 blocked Cul3 neddylation in a dose dependent manner, but was not effective in inhibiting neddylation of other cullin members, which was consistent with the previous findings in KYSE70 and THLE2 cell lines 30. Taken together, WS-383 exerted selective neddylation inhibition of Cul1 and Cul3. The results were consistent with previous findings reported by Schulman et al.

25, 31, 34.

Although WS-383 and DI-591 bound to the same UBC12 binding site in

DCN1, the different cellular effects of WS-383 and DI-591 on cullin neddylation may be due to their different binding models. DI-591 occupied five sub-pockets in DCN1, while WS-383 only occupied three of these sub-pockets (Figure 7). The binding 34 / 102


Page 34 of 102

Page 35 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


difference of both compounds may induce distinct conformational changes, thus affecting biological functions of DCN1.

As stated above, WS-383 can block neddylation of Cul1 and Cul3. So the expression levels of Cul1 and Cul3 substrates were also evaluated after treatment of MGC-803 and KYSE70 cells with WS-383 for 24 h. Cul1 together with Skp1 (adaptor protein), F-box protein and RBX1/RBX2 RING protein form SCF E3 complex. Cyclin dependent kinase inhibitor 1A (p21) and cyclin dependent kinase inhibitor 1B (p27), two well characterized substrates for the ubiquitin ligase activity of SCF complex49-53, were dose-dependently accumulated after treatment with WS-383 for 24 h in MGC-803 (Figure 13D) and KYSE70 (Figure 13B) cells. And, the expression of NRF2, the best characterized substrate of CRL354-56, also increased in a dose-dependent manner in both of these two cells (Figure 13B & D). MLN4924, an NAE inhibitor, induced accumulation of p21, p27 and NRF2 in MGC-803 cells (Figure 13E). On the other hand, DI-591 only induced accumulation of NRF2 as it only decreased Cul3 neddylation (Figure 13C). However, compared with MLN4924, DI-591, and NAcM-OPT, WS-383 exerted cellular effects on cullin neddylation and downstream substrates p21, p27 and NRF2 at relatively high concentration (10 μM) in MGC-803 and KYSE70 cells. This is possibly attributed to the solubility or permeability issues of WS-383.

35 / 102



Figure 13. Cellular effects of WS-383, DI-591 and MLN4924 on cullin neddylation and CRL substrates. (A) Deneddylation effects of MLN4924, WS-383 and WS-524 36 / 102


Page 36 of 102

Page 37 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


on cullin1-5 at indicated concentrations for 24 h treatment in MGC-803 cells; (B) Deneddylation effects on cullin1-5 and CRL substrates accumulation in KYSE70 cells with 24 h treatment of WS-383 at indicated concentrations; (C) Deneddylation effects on cullin1-5 and CRL substrates accumulation in MGC-803 cells with 24 h treatment of DI-591 at indicated concentrations; (D & E) The expressions of p21, p27 and NRF2 in MGC-803 cells after 24 h treatment of WS-383 (D) and MLN4924 (E). GAPDH was used as the loading control. All experiments were carried out three times.

NRF2 is an important transcription factor that could mediate antioxidant protection. In view of the observed cellular effect of WS-383 on NRF2 activation, we also examined its effects on the ROS generation in MGC-803 cells using WS-524 (inactive), NAcM-OPT and DI-591 as the controls, respectively. The cellular ROS levels were detected by the DCFH-DA staining. As shown in Figure 14, like previously reported DCN1 inhibitors NAcM-OPT and DI-591, WS-383 and WS-524 had no remarkable effect on ROS generation in MGC-803 cells, showing the ROS-independent NRF2 activation by WS-383. To conclude, WS-383 inhibited Cul3 neddylation and then activated NRF2 by blocking the DCN1-UBC12 interaction, not elevating cellular ROS levels.

37 / 102



Figure 14. The effect on ROS generation in MGC-803 cells. MGC-803 cells were treated with indicated concentrations of WS-383, WS-524, NAcM-OPT or DI-591 for 24 h. The levels of ROS were detected by flow cytometry.

In view of the validated cellular effects of WS-383, we next examined the metabolic stability of WS-383 in human, rat and dog liver microsomes. Unfortunately, WS-383 metabolized quickly (T1/2 < 5 min) and had high clearance (Clint > 347.66 (human), 496.74 (rat), and 691.00 (dog) mL/min/kg, respectively). However, because of the interesting cellular effects of WS-383 on cullin neddylation and downstream proteins p21, p27 and NRF2 in MGC-803 and KYSE70 cells, WS-383 could be potentially used as a tool compound to examine the function of the DCN1–UBC12 interaction in 38 / 102


Page 38 of 102

Page 39 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


modulating neddylation pathway in cells. The data also suggest that the aryl thioethers are metabolically instable in different species. The results may provide direction for further optimization so as to improve the metabolic stability. 

CHEMISTRY

The synthetic routes for the synthesis of compounds E1-E44. As shown in Scheme 1A, 4H-1,2,4-triazol-3-amine reacted with diverse β-ketoesters to give compounds C1-C5, chlorination of C1-C5 in POCl3 yielded D1-D5, followed by reactions with substituted 5-mercapto tetrazole, affording E1-E4, and E8-E11 (obtained in HCl form).

Similarly,

treatment

of

methyl

2-cyclopentanonecarboxylate

with

4H-1,2,4-triazol-3-amine in AcOH gave C6, which was then subjected to chlorination and substitution reactions following above described routes, yielding E12 (Scheme 1B). Following the route for the synthesis of E12, E5 was obtained efficiently from 1H-Pyrazol-5-amine

and

ethyl

acetoacetate

(Scheme

1C).

5-Amino-4H-1,2,4-triazole-3-thiol reacted with diverse alkyl halides to form B1-B27, followed by reactions with β-ketoesters, generating C8-C39. Subsequent chlorination of

C8-C39

in

POCl3

afforded

D8-D39,

which

then

reacted

with

1-[2-(dimethylamino)ethyl]-1H-tetrazole-5-thiol in EtOH to give the title compounds E13-E44 (Scheme 1D). Besides, 1-[2-(dimethylamino)ethyl]-1H-tetrazole-5-thiol reacted

with

commercially

available

4-chlorothieno[3,2-d]pyrimidine

and

4-chloro-6,7-bis(2-methoxyethoxy)quinazoline, respectively to form E6 and E7 (Scheme 2).

39 / 102



(A) H2N

O

H N

O

O

R1

N N N

N N

b

N N H C1-C5 Yield: 66%-83%

R1

a

N N

N

Cl N N

OEt

Page 40 of 102

R

1

R N N N N S

SH

N N

c

N

N

R

N R1 N E1-E4 or E8-E11 Yield: 63%-92%

D1-D5

Cl NH O

(B)

H N

H 2N

N

O

O

Cl N N

O a

N N

N N N N SH

N H C6

N N

b

N

N N

c

N

N

N N E12

D6 N

(C)

H N

H 2N

O

O

O

N a

N N

b

N H C7

(D)

H 2N

SH

R2Cl

H 2N

d

N N

H N

R3 R

1

N N

R2 S

N

N D8-D39

R3

a

N

N N N N S R3

c

N

O

O R3

N N N N SH

E5

O

R1

R2 S

Yield: 56%-87%

b

N N

D7

N N B1-B27

Cl

HN Cl N N N N S

c

N

O H N

N N N N SH

Cl N N

OEt

N N N N S

R1 N H

N H

R2 S

N

C8-C39 Yield: 61%-85%

Cl

N N

N N

R2 S

N N E13-E44 Yield: 62%-93%

R1

Scheme 1. Synthesis of compounds E1-E5 and E8-E44. Reagents and conditions: (a) Acetic acid, 120 oC, 2-15 h, reflux. (b) POCl3, 90 oC, 3-5h, reflux; (c) EtOH, rt, 5 h; (d) Na2CO3, acetone, 60 oC, 3-5 h, reflux.

40 / 102


Page 41 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cl S

N N N

N

N N N N SH

Cl

O

N N

E6 N H

N N N N S

a O

Cl

S

N

a

O O

N H

N N N N S

O O

O O

Cl

N E7

N

Scheme 2. Synthesis of compounds E6 and E7. Reagents and conditions: (a) EtOH, r.t., 5 h. 

Conclusions

Starting from the hit compound E1 identified from our molecular library, we performed further structure-based optimizations, leading to the generation of a series of triazolo[1,5-a]pyrimidine-based DCN1 inhibitors. The SARs studies revealed that relative to other heterocycles (as shown in Figure 5), the triazolopyridine is a privileged scaffold for the development of small-molecule DCN1 inhibitors. Generally, the less steric group (R1) is preferred over other bulky groups. The R2 group is presumably inserted into a deep sub-pocket of DCN1, bulky groups or introduction of substitutions at the ortho and meta-position of phenyl ring could cause drastic activity decrease (Tables 2 & 3). The R3 group is exposed to the solvent region, introduction of hydrophobic group (e.g. WS-524) could cause the complex unstable and lead to the loss of the activity. Among these compounds, WS-383 effectively blocked the DCN1-UBC12 interaction (IC50 = 11 nM) in a reversible manner and showed certain selectivity over BTK，CDK and EGFR kinases. Docking 41 / 102



studies were performed to reveal the binding models of WS-383 in the binding site of UBC12 and to explain the activity discrepancy of WS-383 and WS-524. The CETSA assay suggested cellular target engagement of WS-383 to DCN1 in MGC-803 cells overexpressing DCN1 and UBC12. In MGC-803 cells, MLN4924 caused broad neddylation inhibition of cullin substrates, while WS-383 showed selective neddylation inhibition of Cul3/1 over other cullin members and also induced accumulation of downstream proteins p21, p27 and NRF2 in both MGC-803 and KYSE70 cells. The NRF2 activation by WS-383 was ROS-independent. However, WS-383 metabolized quickly (T1/2 < 5 min) and had high clearance in human, rat and dog liver microsomes. Compared with previously reported MLN4924, DI-591, and NAcM-OPT, WS-383 represents a new potent and specific small-molecule DCN1 inhibitor and therefore could be used as a tool compound to examine the function of the DCN1–UBC12 interaction in modulating neddylation pathway in cells. The discovery of WS-383 makes the triazolo[1,5-a]pyrimidine a promising scaffold for the development of new small-molecule DCN1 inhibitors. To conclude, targeting the interaction of DCN1 with UBC12 would be a feasible strategy for the treatment of diseases, in which Cul3/1 were dysregulated. 

EXPERIMENTAL SECTION

Chemistry. General Information. Reagents and solvents were purchased for direct use without further purification. Thin-layer chromatography (TLC) was carried out on glass plates coated with silica gel (Qingdao Haiyang Chemical Co., G60F-254) and visualized by UV light (254 nm). The products were purified by column 42 / 102


Page 42 of 102

Page 43 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


chromatography over silica gel (Qingdao Haiyang Chemical Co., 200–300 mesh). Melting points were determined on an X-5 micromelting apparatus and are uncorrected. All the NMR spectra were recorded with a Bruker DPX 400 MHz spectrometer with TMS as internal standard in CDCl3 or DMSO-d6. Chemical shifts are given as δ ppm values relative to TMS. High-resolution mass spectra (HRMS) were recorded on a Waters Micromass Q-T of Micromass spectrometer by electrospray ionization (ESI). The purity of E1-E44 was determined by Waters e2695 HPLC, all the compounds were >95% pure (Phenomenex column, C-18, 5.0 μm, 4.6 mm × 250 mm). The signal was monitored at 296 nm with a UV detector. Compounds E1-E7, E9-E26, E28 and E31-E44 were detected by the condition of a mobile phase of acetonitrile in H2O (50:50, v/v) with a flow rate of 1.0 mL/min. Compound E8 was treated with a mobile phase of acetonitrile in H2O (15:85, v/v), while compound E27 was subjected to the condition of acetonitrile in H2O (30:70, v/v). Besides, compounds E29-E30 were also determined by the condition of acetonitrile in H2O (40:60, v/v). General method for the synthesis of B1-B27. Compounds B1-B27 were prepared following

the

previously

reported

method

56.

To

a

solution

of

3-amino-5-mercapto-1,2,4-triazole (1.0 g, 8.61 mmol) in acetone (30 mL) were added sodium carbonate (1.37 g, 12.92 mmol), sodium iodide (129.06 mg, 0.861 mmol) and alkyl halide (9.47 mmol). The reaction mixture was stirred at 60 oC for 3-6 h before cooling to room temperature. Na2CO3 and NaI were removed via filtration. The residue was concentrated under vacuum and then dissolved in EtOAc. The organic 43 / 102



layer was washed with water (2 × 10 mL) and saturated brine (2 × 20 mL) and then dried over anhydrous MgSO4. After removal of the solvent, the resulting residue was subjected to column chromatography, giving the corresponding product B1-B27. 5-(Propylthio)-4H-1,2,4-triazol-3-amine (B1), white solid, yield: 74 ％ . 1H NMR (400 MHz, DMSO-d6) δ 11.86 (s, 1H), 6.01 (s, 2H), 2.91 (t, J = 7.1 Hz, 2H), 1.69 – 1.55 (m, 2H), 0.93 (t, J = 7.3 Hz, 3H). 13C NMR (100 MHz, DMSO-d6) δ 157.3 (-C-), 156.0 (-C-), 32.8 (-CH2-), 22.8 (-CH2-), 13.1 (-CH3). HRMS (ESI): m/z calcd for C5H9N4S (M-H)-, 157.0547; found, 157.0544. 5-(Allylthio)-4H-1,2,4-triazol-3-amine (B2), white solid, yield: 72％. 1H NMR (400 MHz, DMSO-d6) δ 11.92 (s, 1H), 6.03 (s, 2H), 5.91 (m, 1H), 5.20 (m, 1H), 5.04 (m, 1H), 3.62 (d, J = 6.8 Hz, 2H). 13C NMR (100 MHz, DMSO-d6) δ 157.4 (-C-), 155.4 (-C-), 134.4 (-C-), 117.2 (-CH-), 33.6 (-CH2-). HRMS (ESI): m/z calcd for C5H7N4S (M-H)-, 155.0391; found, 155.0387. 5-(Prop-2-yn-1-ylthio)-4H-1,2,4-triazol-3-amine (B3), white solid, yield: 81％. 1H NMR (400 MHz, DMSO-d6) δ 11.99 (s, 1H), 6.09 (s, 2H), 3.78 (d, J = 2.5 Hz, 2H), 3.10 (t, J = 2.5 Hz, 1H). 13C NMR (100 MHz, DMSO-d6) δ 157.4 (-C-), 154.5 (-C-), 80.5 (-C-), 73.3 (-CH-), 19.0 (-CH2-). HRMS (ESI): m/z calcd for C5H5N4S (M-H)-, 153.0234; found, 153.0231. 5-(Isopropylthio)-4H-1,2,4-triazol-3-amine (B4), white solid, yield: 70%. 1H NMR (400 MHz, DMSO-d6) δ 11.91 (s, 1H), 6.01 (s, 2H), 3.51 (m, 1H), 1.28 (d, J = 6.8 Hz, 6H).

13C

NMR (100 MHz, DMSO-d6) δ 157.7 (-C-), 156.1 (-C-), 36.5 (-CH-), 23.9

(-CH3). HRMS (ESI): m/z calcd for C5H11N4S (M+H)-, 159.0704; found, 159.0695. 44 / 102


Page 44 of 102

Page 45 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5-((Cyclopropylmethyl)thio)-4H-1,2,4-triazol-3-amine (B5), white solid, yield: 74%. 1H NMR (400 MHz, DMSO-d6) δ 11.87 (s, 1H), 6.00 (s, 2H), 2.90 (d, J = 7.1 Hz, 2H), 1.17 – 0.95 (m, 1H), 0.58 – 0.42 (m, 2H), 0.23 (m, 2H). 13C NMR (400 MHz, DMSO-d6) δ 157.7 (-C-), 156.7 (-C-), 36.7 (-CH2-), 11.7 (-CH-), 5.9 (-CH2-). HRMS (ESI): m/z calcd for C6H11N4S (M+H)-, 171.0704; found, 171.0694. 5-((Cyclohexylmethyl)thio)-4H-1,2,4-triazol-3-amine (B6), white solid, yield: 63%. 1H

NMR (400 MHz, DMSO-d6) δ 11.84 (s, 1H), 6.00 (s, 2H), 2.85 (d, J = 6.7 Hz, 2H),

1.78 (d, J = 12.7 Hz, 2H), 1.71 – 1.44 (m, 4H), 1.24 – 1.04 (m, 3H), 1.01 – 0.87 (m, 2H). 13C NMR (100 MHz, DMSO-d6) δ 157.7 (-C-), 156.8 (-C-), 38.2 (-CH2-), 37.9 (-CH-), 32.4 (-CH2-), 26.4 (-CH2-), 26.0 (-CH2-). HRMS (ESI): m/z calcd for C9H17N4S (M+H)-, 213.1173; found, 213.1162. 5-((Naphthalen-2-ylmethyl)thio)-4H-1,2,4-triazol-3-amine (B7), white solid, yield: 78%. 1H NMR (400 MHz, DMSO-d6) δ 12.05 (s, 1H), 8.15 (d, J = 8.2 Hz, 1H), 7.95 (d, J = 7.7 Hz, 1H), 7.85 (d, J = 8.2 Hz, 1H), 7.64 – 7.49 (m, 3H), 7.42 (t, J = 7.6 Hz, 1H), 6.08 (s, 2H), 4.73 (s, 2H). 13C NMR (100 MHz, DMSO-d6) δ 134.1 (-C-), 134.0 (-C-), 131.5 (-C-), 129.1 (-C-), 128.4 (-C-), 127.7 (-CH-), 126.7 (-CH-), 126.4 (-CH-), 125.9 (-CH-), 124.4 (-CH-), 33.4 (-CH2-). HRMS (ESI): m/z calcd for C13H13N4S (M+H)-, 257.0860; found, 257.0849. 5-(Benzylthio)-4H-1,2,4-triazol-3-amine (B8), white solid, yield: 73 ％ . 1H NMR (400 MHz, DMSO-d6) δ 7.41-7.18 (m, 5H), 4.34 (s, 2H).

13C

NMR (100 MHz,

DMSO-d6) δ 152.2 (-C-), 147.1 (-C-), 136.6 (-C-), 128.8 (-CH-), 128.4 (-CH-), 127.5 (-CH-), 35.4 (-CH2-). HRMS (ESI): m/z calcd for C9H9N4S (M-H)-, 205.0547; found, 45 / 102



Page 46 of 102

205.0548. 5-(Phenethylthio)-4H-1,2,4-triazol-3-amine (B9), white solid, yield: 78％. 1H NMR (400 MHz, DMSO-d6) δ 11.92 (s, 1H), 7.33 – 7.26 (m, 2H), 7.22 (m, 3H), 6.05 (s, 2H), 3.18 (m, 2H), 2.96 – 2.87 (m, 2H). 13C NMR (100MHz, DMSO-d6) δ 157.8 (-C-), 156.3 (-C-), 152.7 (-C-), 140.8 (-CH-), 129.0 (-CH-), 128.8 (-CH-), 126.7 (-CH-), 36.0 (-CH2-), 32.5 (-CH2-). HRMS (ESI): m/z calcd for C10H13N4S (M+H)-, 221.0860; found, 221.0852. 5-((3-Phenylpropyl)thio)-4H-1,2,4-triazol-3-amine (B10), white solid, yield: 75％. 1H

NMR (400 MHz, DMSO-d6) δ 7.27 (m, 2H), 7.22 – 7.13 (m, 3H), 6.02 (s, 2H),

2.93 (t, J = 7.2 Hz, 2H), 2.73 – 2.62 (m, 2H), 2.01 – 1.83 (m, 2H).

13C

NMR (100

MHz, DMSO-d6) δ 157.5 (-C-), 156.2 (-C-), 141.3 (-C-), 128.3 (-CH-), 128.3 (-CH-), 125.8 (-CH-), 34.0 (-CH2-), 31.1 (-CH2-), 30.3 (-CH2-). HRMS (ESI): m/z calcd for C11H13N4S (M-H)-, 233.0860; found, 233.0863. 5-(((5-Chlorobenzo[b]thiophen-3-yl)methyl)thio)-4H-1,2,4-triazol-3-amine (B11), white solid, yield: 64%. 1H NMR (400 MHz, DMSO-d6) δ 8.02 (d, J = 8.6 Hz, 1H), 7.98 (d, J = 1.9 Hz, 1H), 7.70 (s, 1H), 7.41 (m, 1H), 6.10 (s, 2H), 4.50 (s, 2H).

13C

NMR (100 MHz, DMSO-d6) δ 139.2 (-C-), 138.2 (-C-), 132.1 (-C-), 129.4 (-C-), 127.5 (-CH-), 124.7 (-CH-), 124.5 (-CH-), 121.6 (-CH-), 28.2 (-CH2-). HRMS (ESI): m/z calcd for C11H10ClN4S2 (M+H)-, 297.0035; found, 297.0024. 4-(((5-Amino-4H-1,2,4-triazol-3-yl)thio)methyl)-2H-benzo[h]chromen-2-one (B12), white solid, yield: 56%. 1H NMR (400 MHz, DMSO-d6) δ 8.40 – 8.32 (m, 1H), 8.10 – 8.01 (m, 1H), 7.90 (m, 2H), 7.78 – 7.67 (m, 2H), 6.53 (s, 1H), 6.15 (s, 2H), 46 / 102


Page 47 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4.52 (s, 2H). 13C NMR (100 MHz, DMSO-d6) δ 159.5 (-C-), 150.2 (-C-), 134.3 (-C-), 128.8 (-C-), 128.0 (-C-), 127.5 (-C-), 124.0 (-CH-), 122.3 (-CH-), 121.6 (-C-), 121.1 (-CH-), 113.9 (-C-), 113.6 (-CH-), 31.6 (-CH2-). HRMS (ESI): m/z calcd for C16H13N4O2S (M+H)-, 325.0759; found, 325.0747. 5-((4-Nitrobenzyl)thio)-4H-1,2,4-triazol-3-amine (B13), white solid, yield: 65%. 1H NMR (400 MHz, DMSO-d6) δ 11.99 (s, 1H), 8.16 (d, J = 8.7 Hz, 2H), 7.64 (d, J = 8.7 Hz, 2H), 6.10 (s, 2H), 4.35 (s, 2H). 13C NMR (100MHz, DMSO-d6) δ 157.5 (-C-), 155.5 (-C-), 138.4 (-C-), 131.2 (-C-), 131.0 (-CH-), 120.1 (-CH-), 34.1 (-CH2-). HRMS (ESI): m/z calcd for C9H10N5O2S (M+H)-, 252.0555; found, 205.0544. 5-((2-Nitrobenzyl)thio)-4H-1,2,4-triazol-3-amine (B14), white solid, yield: 68 %. 1H

NMR (400 MHz, DMSO-d6) δ 11.97 (s, 1H), 8.01 (d, J = 8.1 Hz, 1H), 7.66 (m,

2H), 7.56 – 7.49 (m, 1H), 6.07 (s, 2H), 4.50 (s, 2H). 13C NMR (100 MHz, DMSO-d6) δ 157.9 (-C-), 155.6 (-C-), 148.7 (-C-), 134.3 (-C-), 134.0 (-CH-), 132.6 (-CH-), 129.1 (-CH-), 125.3 (-CH-), 32.4 (-CH2-). HRMS (ESI): m/z calcd for C9H10N5O2S (M+H)-, 252.0555; found, 252.0543. 5-((4-Fluorobenzyl)thio)-4H-1,2,4-triazol-3-amine (B15), white solid, yield: 78%. 1H

NMR (400 MHz, DMSO-d6) δ 11.98 (s, 1H), 7.40 (m, 2H), 7.11 (t, J = 8.8 Hz,

2H), 6.06 (s, 2H), 4.21 (s, 2H). 13C NMR (100MHz, DMSO-d6) δ 162.9 (-C-), 160.5 (-C-), 157.9 (-C-), 135.3 (-C-), 131.14 (-CH-), 131.06 (-CH-), 115.6 (-CH-), 115.4 (-CH-), 34.5 (-CH2-). HRMS (ESI): m/z calcd for C9H10FN4S (M+H)-, 225.0610; found, 225.0598.

47 / 102



5-((4-Chlorobenzyl)thio)-4H-1,2,4-triazol-3-amine (B16), white solid, yield: 76%. 1H

NMR (400 MHz, DMSO-d6) δ 11.98 (s, 1H), 7.45 – 7.30 (m, 4H), 6.08 (s, 2H),

4.21 (s, 2H). 13C NMR (100 MHz, DMSO-d6) δ 157.4 (-C-), 155.4 (-C-), 138.3 (-C-), 131.1 (-C-), 130.9 (-CH-), 120.0 (-CH-), 34.0 (-CH2-). HRMS (ESI): m/z calcd for C9H10ClN4S (M+H)-, 241.0314; found, 241.0305. 5-((4-Bromobenzyl)thio)-4H-1,2,4-triazol-3-amine (B17), white solid, yield: 72%. 1H

NMR (400 MHz, DMSO-d6) δ 11.95 (s, 1H), 7.48 (d, J = 8.3 Hz, 2H), 7.32 (d, J =

8.3 Hz, 2H), 6.07 (s, 2H), 4.18 (s, 2H). 13C NMR (100 MHz, DMSO-d6) δ 157.4 (-C-), 155.4 (-C-), 138.2 (-C-), 131.1 (-C-), 130.9 (-CH-), 120.0 (-CH-), 34.0 (-CH2-). HRMS (ESI): m/z calcd for C9H10BrN4S (M+H)-, 284.9809; found, 284.9798. 5-((2-Bromobenzyl)thio)-4H-1,2,4-triazol-3-amine (B18), white solid, yield: 75%. 1H


7.4 Hz, 1H), 7.32 (t, J = 7.4 Hz, 1H), 7.21 (t, J = 7.6 Hz, 1H), 6.09 (s, 2H), 4.31 (s, 2H). 13C NMR (100 MHz, DMSO-d6) δ 157.9 (-C-), 155.8 (-C-), 137.8 (-C-), 133.1 (-C-), 131.5 (-CH-), 129.8 (-CH-), 128.3 (-CH-), 124.3 (-CH-), 36.0 (-CH2-). HRMS (ESI): m/z calcd for C9H10BrN4S (M+H)-, 284.9809; found, 284.9799. 5-((3-Bromobenzyl)thio)-4H-1,2,4-triazol-3-amine (B19), white solid, yield: 74%. 1H

NMR (400 MHz, DMSO-d6) δ 11.97 (s, 1H), 7.57 (s, 1H), 7.42 (d, J = 7.9 Hz,

1H), 7.37 (d, J = 7.7 Hz, 1H), 7.25 (t, J = 7.8 Hz, 1H), 6.08 (s, 2H), 4.21 (s, 2H). 13C NMR (100 MHz, DMSO-d6) δ 157.9 (-C-), 155.8 (-C-), 131.8 (-C-), 130.9 (-C-), 130.2 (-CH-), 128.2 (-CH-), 121.9 (-CH-), 100.0 (-CH-), 34.5 (-CH2-). HRMS (ESI): m/z calcd for C9H10BrN4S (M+H)-, 284.9809; found, 284.9796. 48 / 102


Page 48 of 102

Page 49 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5-((4-Methylbenzyl)thio)-4H-1,2,4-triazol-3-amine (B20), white solid, yield: 82%. 1H


7.8 Hz, 2H), 6.05 (s, 2H), 4.17 (s, 2H), 2.26 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 157.8 (-C-), 156.3 (-C-), 136.6 (-C-), 135.8 (-C-), 129.3 (-CH-), 129.1 (-CH-), 35.1 (-CH2-), 21.1 (-CH3). HRMS (ESI): m/z calcd for C10H13N4S (M+H)-, 221.0860; found, 221.0848. 5-((4-(Trifluoromethyl)benzyl)thio)-4H-1,2,4-triazol-3-amine (B21), white solid, yield: 69%. 1H NMR (400 MHz, DMSO-d6) δ 12.21 (s, 1H), 7.66 (d, J = 8.2 Hz, 2H), 7.59 (d, J = 8.2 Hz, 2H), 6.09 (s, 2H), 4.31 (s, 2H). 13C NMR (100 MHz, DMSO-d6) δ 158.3 (-C-), 144.3 (-C-), 129.9 (-C-), 128.2 (-C-), 127.8 (-C-), 126.1 (-C-), 125.6 (-CH-), 125.6 (-CH-), 125.5 (-CH-), 123.4 (-CH-), 34.7 (-CH2-). HRMS (ESI): m/z calcd for C10H10F3N4S (M+H)-, 275.0578; found, 275.0564. 5-((2-(Trifluoromethyl)benzyl)thio)-4H-1,2,4-triazol-3-amine (B22), white solid, yield: 71%. 1H NMR (400 MHz, DMSO-d6) δ 12.01 (s, 1H), 7.67 (m, 3H), 7.47 (m, 1H), 6.13 (s, 2H), 4.40 (s, 2H). 13C NMR (100MHz, DMSO-d6) δ 158.0 (-C-), 155.8 (-C-), 137.0 (-C-), 133.2 (-C-), 132.0 (-C-), 128.3 (-C-), 127.5 (-CH-), 127.2 (-CH-), 126.5 (-CH-), 126.4 (-CH-), 126.2 (-CH-), 32.1 (-CH2-).

HRMS (ESI): m/z calcd for

C10H9F3N4S (M+H)-, 275.0578; found, 275.0568. 5-((3-(Trifluoromethyl)benzyl)thio)-4H-1,2,4-triazol-3-amine (B23), white solid, yield: 70%. 1H NMR (400 MHz, DMSO-d6) δ 11.97 (s, 1H), 7.72 (s, 1H), 7.68 (d, J = 7.6 Hz, 1H), 7.59 (d, J = 7.7 Hz, 1H), 7.53 (t, J = 7.7 Hz, 1H), 6.09 (s, 2H), 4.30 (s, 2H). 13C NMR (100MHz, DMSO-d6) δ 157.9 (-C-), 155.7 (-C-), 149.8 (-C-), 148.1 49 / 102



Page 50 of 102

(-C-), 141.0 (-C-), 133.3 (-CH-), 129.8 (-CH-), 125.7 (-CH-), 124.1 (-CH-), 34.6 (-CH2-). HRMS (ESI): m/z calcd for C10H9F3N4S (M)-, 274.0500; found, 274.0487. 5-((4-Methoxybenzyl)thio)-4H-1,2,4-triazol-3-amine (B24), white solid, yield: 87%. 1H

NMR (400 MHz, DMSO-d6) δ 12.04 (s, 1H), 7.27 (d, J = 8.6 Hz, 2H), 6.90 – 6.80

(m, 2H), 6.12 (s, 2H), 4.17 (s, 2H), 3.72 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 158.8 (-C-), 130.5 (-C-), 130.4 (-CH-), 114.2 (-CH-), 55.5 (-CH3), 35.0 (-CH2-). HRMS (ESI): m/z calcd for C10H13N4OS (M+H)-, 237.0810; found, 237.0799. 5-((4-Chloro-3-fluorobenzyl)thio)-4H-1,2,4-triazol-3-amine (B25), white solid, yield: 80%. 1H NMR (400 MHz, DMSO-d6) δ 11.97 (s, 1H), 7.50 (t, J = 8.1 Hz, 1H), 7.40 (m, 1H), 7.23 (d, J = 8.2 Hz, 1H), 6.09 (s, 2H), 4.22 (s, 2H). 13C NMR (100 MHz, DMSO-d6) δ 158.5 (-C-), 157.9 (-C-), 156.1 (-C-), 155.7 (-C-), 141.4 (-C-), 130.8 (-C-), 126.5 (-C-), 126.5 (-CH-), 117.5 (-CH-), 117.3 (-CH-), 34.2 (-CH2-). HRMS (ESI): m/z calcd for C9H9ClFN4S (M+H)-, 259.0220; found, 259.0210. 5-((3-Chloro-4-fluorobenzyl)thio)-4H-1,2,4-triazol-3-amine (B26), white solid, yield: 82%. 1H NMR (400 MHz, DMSO-d6) δ 12.02 (s, 1H), 7.58 (m, J = 7.2, 1.8 Hz, 1H), 7.43 – 7.26 (m, 2H), 6.11 (s, 2H), 4.21 (s, 2H). 13C NMR (100 MHz, DMSO-d6) δ 157.9 (-C-), 155.5 (-C-), 137.4 (-C-), 131.1 (-C-), 129.8 (-C-), 129.8 (-C-), 119.5 (-C-), 119.4 (-CH-), 117.2 (-CH-), 117.0 (-CH-), 34.0 (-CH2-). HRMS (ESI): m/z calcd for C9H9ClFN4S (M+H)-, 259.0220; found, 259.0210. 5-((2,6-Dichlorobenzyl)thio)-4H-1,2,4-triazol-3-amine (B27), white solid, yield: 74%. 1H NMR (400 MHz, DMSO-d6) δ 12.05 (s, 1H), 7.49 (d, J = 4.8 Hz, 1H), 7.48 (s, 1H), 7.38 – 7.30 (m, 1H), 6.12 (s, 2H), 4.49 (s, 2H). 50 / 102


13C

NMR (100 MHz,

Page 51 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


DMSO-d6) δ 158.0 (-C-), 155.6 (-C-), 135.4 (-C-), 133.6 (-C-), 130.5 (-C-), 129.2 (-CH-), 32.2 (-CH2-). HRMS (ESI): m/z calcd for C9H9Cl2N4S (M+H)-, 274.9925; found, 274.9913. General method for the synthesis of C1-C39. Compounds C1-C39 were prepared following the previously reported method 56 as described for C1. B1 (1g, 11.89 mmol) and ethyl 3-oxo-3-phenylpropanoate (2.06 mL, 11.89 mmol) was stirred in AcOH (10 mL) at 120 oC. After 3-6 h, the reaction mixture was cooled to RT and the white precipitate formed was filtered and washed using water to afford the desired compound C1. 5-Phenyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C1), white solid, yield: 73％. 1H

NMR (400 MHz, DMSO-d6) δ 11.41 (s, 1H), 8.43 (s, 1H), 7.91 (m, 2H), 7.63 –

7.49 (m, 3H), 6.39 (s, 1H).

13C

NMR (100 MHz, DMSO-d6) δ 156.0 (-CH-), 150.9

(-C-), 131.0 (-C-), 128.9 (-C-), 127.5 (-CH-), 97.5 (-CH-).

HRMS (ESI): m/z calcd

for C11H9N4O (M+H)+, 213.0776; found, 213.0768. 5-Methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C2), white solid, yield: 83％. 1H

NMR (400 MHz, DMSO-d6) δ 13.20 (s, 1H), 8.20 (s, 1H), 5.84 (s, 1H), 2.33 (s,

3H). 13C NMR (100 MHz, DMSO-d6) δ 155.8 (-CH-), 151.8 (-C-), 151.6 (-C-), 150.6 (-C-), 98.1 (-CH-), 18.6 (-CH3). HRMS (ESI): m/z calcd for C6H7N4O (M+H)+, 151.0619; found, 151.0612. 5-Ethyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C3), white solid, yield: 78 ％ . 1H

NMR (400 MHz, DMSO-d6) δ 13.20 (s, 1H), 8.21 (s, 1H), 5.85 (s, 1H), 2.62 (m,

2H), 1.23 (t, J = 7.6 Hz, 3H). 13C NMR (100 MHz, DMSO-d6) δ 157.2 (-CH-), 156.6 51 / 102



Page 52 of 102

(-C-), 152.4 (-C-), 151.2 (-C-), 97.2 (-CH-), 26.2 (-CH2-), 12.9 (-CH3).HRMS (ESI): m/z calcd for C7H9N4O (M+H)+, 165.0776; found, 165.0768. 5-Isopropyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C4), white solid, yield: 74％. 1H NMR (400 MHz, DMSO-d6) δ 13.18 (s, 1H), 8.23 (s, 1H), 5.86 (s, 1H), 2.90 (m, 1H), 1.27 (d, J = 6.9 Hz, 6H).

13C

NMR (100 MHz, DMSO-d6) δ 161.2 (-CH-),

156.7 (-C-), 152.3 (-C-), 151.2 (-C-), 95.7 (-CH-), 32.2 (-CH2-), 21.4 (-CH3). HRMS (ESI): m/z calcd for C8H11N4O (M+H)+, 179.0932; found, 179.0923. 5-Cyclopropyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C5), white solid, yield: 66％. 1H NMR (400 MHz, DMSO-d6) δ 13.31 (s, 1H), 8.23 (s, 1H), 5.67 (s, 1H), 2.00 – 1.84 (m, 1H), 1.20 – 0.89 (m, 4H). 13C NMR (100 MHz, DMSO-d6) δ 160.7 (-CH-), 156.3 (-C-), 151.9 (-C-), 150.8 (-C-), 95.2 (-CH-), 31.8 (-CH-), 20.9 (-CH2-). HRMS (ESI): m/z calcd for C8H9N4O (M+H)+, 177.0776; found, 177.0767. 4,5,6,7-Tetrahydro-8H-cyclopenta[d][1,2,4]triazolo[1,5-a]pyrimidin-8-one

(C6),

white solid, yield: 82％. 1H NMR (400 MHz, DMSO-d6) δ 13.39 (s, 1H), 8.16 (s, 1H), 2.91 (t, J = 7.7 Hz, 2H), 2.68 (t, J = 7.3 Hz, 2H), 2.17 – 1.99 (m, 2H). 13C NMR (100 MHz, DMSO-d6) δ 155.8 (-CH-), 154.9 (-C-), 152.1 (-C-), 151.4 (-C-), 110.4 (-C-), 31.8 (-CH2-), 27.2 (-CH2-), 22.2 (-CH2-). HRMS (ESI): m/z calcd for C8H9N4O (M+H)+, 177.0776; found, 177.0767. 5-Methylpyrazolo[1,5-a]pyrimidin-7(4H)-one (C7), white solid, yield: 63 ％ . 1H NMR (400 MHz, DMSO-d6) δ 12.29 (s, 1H), 7.83 (d, J = 1.9 Hz, 1H), 6.09 (d, J = 1.9 Hz, 1H), 5.57 (s, 1H), 2.29 (s, 3H).

13C

NMR (100 MHz, DMSO-d6) δ 156.3 (-C-),

52 / 102


Page 53 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


150.1 (-C-), 142.6 (-C-), 141.6 (-CH-), 94.8 (-CH-), 88.2 (-CH-), 18.5 (-CH3).HRMS (ESI): m/z calcd for C7H8N3O (M+H)+, 150.0667; found, 150.0669. 5-Methyl-2-(propylthio)-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one

(C8),

white

solid, yield: 64％. 1H NMR (400 MHz, DMSO-d6) δ 13.14 (s, 1H), 5.79 (s, 1H), 3.12 (t, J = 7.2 Hz, 2H), 2.29 (s, 3H), 1.73 (m, 2H), 0.99 (t, J = 7.3 Hz, 3H). 13C NMR (100 MHz, DMSO-d6) δ 162.3 (-C-), 154.8 (-C-), 151.1 (-C-), 150.5 (-C-), 98.4 (-CH-), 32.5 (-CH2-), 22.5 (-CH2-), 18.4 (-CH3), 13.0 (-CH3). HRMS (ESI): m/z calcd for C9H11N4OS (M-H)-, 223.0653; found, 223.0665. 2-(Allylthio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C9), white solid, yield: 69％. 1H NMR (400 MHz, DMSO-d6) δ 13.17 (s, 1H), 6.00 (m, 1H), 5.81 (s, 1H), 5.33 (m, 1H), 5.14 (d, J = 10.0 Hz, 1H), 3.84 (d, J = 6.8 Hz, 2H), 2.30 (s, 3H). 13C

NMR (100 MHz, DMSO-d6) δ 161.7 (-C-), 154.8 (-C-), 151.1 (-C-), 150.7 (-C-),

133.5 (-CH-), 118.1 (-CH2-), 98.5 (-CH-), 33.2 (-CH2-), 18.5 (-CH3).HRMS (ESI): m/z calcd for C9H9N4OS (M-H)-, 221.0497; found, 221.0499. 5-Methyl-2-(prop-2-yn-1-ylthio)-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C10), white solid, yield: 65％. 1H NMR (400 MHz, DMSO-d6) δ 13.22 (s, 1H), 5.81 (s, 1H), 4.00 (d, J = 2.6 Hz, 2H), 3.19 (t, J = 2.5 Hz, 1H), 2.29 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 160.9 (-C-), 154.7 (-C-), 151.2 (-C-), 150.7 (-C-), 98.5 (-CH-), 79.9 (-C-), 73.8 (-CH-), 19.0 (-CH2-), 18.4 (-CH3). HRMS (ESI): m/z calcd for C9H7N4OS (M-H)-, 219.0340; found, 219.0343. 2-(Isopropylthio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one

(C11),

white solid, yield: 81％. 1H NMR (400 MHz, DMSO-d6) δ 13.17 (s, 1H), 5.80 (s, 1H), 53 / 102



Page 54 of 102

3.82 (m, 1H), 2.30 (s, 3H), 1.41 (d, J = 6.8 Hz, 6H). 13C NMR (100 MHz, DMSO-d6) δ 162.4 (-C-), 155.4 (-C-), 151.5 (-C-), 151.1 (-C-), 98.9 (-CH-), 36.8 (-CH-), 23.7 (-CH3), 19.0 (-CH3). HRMS (ESI): m/z calcd for C9H13N4OS (M+H)+, 225.0810; found, 225.0800. 2-((Cyclopropylmethyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C12), white solid, yield: 76％. 1H NMR (400 MHz, DMSO-d6) δ 13.15 (s, 1H), 5.80 (s, 1H), 3.11 (d, J = 7.2 Hz, 2H), 2.29 (s, 3H), 1.20 (m, 1H), 0.73 – 0.44 (m, 2H), 0.39 – 0.20 (m, 2H).

13C

NMR (100 MHz, DMSO-d6) δ 163.1 (-C-), 155.3 (-C-), 151.6

(-C-), 151.1 (-C-), 99.0 (-CH-), 36.7 (-CH-), 19.0 (-CH3), 11.4 (-CH2-), 6.1 (-CH2-). HRMS (ESI): m/z calcd for C10H13N4OS (M+H)+, 237.0810; found, 237.0800. 2-((Cyclohexylmethyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C13), white solid, yield: 79％. 1H NMR (400 MHz, DMSO-d6) δ 13.15 (s, 1H), 5.79 (s, 1H), 3.07 (d, J = 6.9 Hz, 2H), 2.29 (s, 3H), 1.82 (d, J = 12.7 Hz, 2H), 1.73 – 1.65 (m, 2H), 1.64 – 1.54 (m, 2H), 1.26 – 1.09 (m, 3H), 1.07 – 0.94 (m, 2H).

13C

NMR

(100 MHz, DMSO-d6) δ 163.1 (-C-), 155.3 (-C-), 151.6 (-C-), 151.1 (-C-), 99.0 (-CH-), 37.9 (-CH-), 37.7 (-CH2-), 32.3 (-CH2-), 26.3 (-CH2-), 25.9 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C13H19N4OS (M+H)+, 279.1279; found, 279.1269. 5-Methyl-2-((naphthalen-1-ylmethyl)thio)-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H) -one (C14), white solid, yield: 61％. 1H NMR (400 MHz, DMSO-d6) δ 13.22 (s, 1H), 8.18 (d, J = 8.2 Hz, 1H), 7.97 (d, J = 7.8 Hz, 1H), 7.89 (d, J = 8.2 Hz, 1H), 7.68 (d, J = 6.9 Hz, 1H), 7.64 – 7.53 (m, 2H), 7.49 – 7.42 (m, 1H), 5.84 (s, 1H), 4.95 (s, 2H), 54 / 102


Page 55 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.31 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ162.5 (-C-), 155.4 (-C-), 151.7 (-C-), 151.2 (-C-), 134.0 (-C-), 133.0 (-C-), 131.4 (-C-), 129.2 (-CH-), 128.8 (-CH-), 128.1 (-CH-), 127.0 (-CH-), 126.5 (-CH-), 125.9 (-CH-), 124.2 (-CH-), 99.1 (-CH-), 33.1 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C17H15N4OS (M+H)+, 323.0966; found, 323.0951. 2-(Benzylthio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C15), white solid, yield: 85％. 1H NMR (400 MHz, DMSO-d6) δ 13.17 (s, 1H), 7.44 (d, J = 7.1 Hz, 2H), 7.32 (t, J = 7.3 Hz, 2H), 7.26 (d, J = 7.2 Hz, 1H), 5.80 (s, 1H), 4.43 (s, 2H), 2.29 (s, 3H). 13C NMR (100MHz, DMSO-d6) δ 161.9 (-C-), 154.8 (-C-), 151.1 (-C-), 150.6 (-C-), 137.4 (-C-), 128.8 (-CH-), 128.4 (-CH-), 127. 2 (-CH-), 98.5 (-CH-), 34.5 (-CH2-), 18.4 (-CH3). HRMS (ESI): m/z calcd for C13H11N4OS (M-H)-, 271.0654; found, 271.0661. 5-Methyl-2-(phenethylthio)-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one

(C16),

white solid, yield: 72％. 1H NMR (400 MHz, DMSO-d6) δ 13.18 (s, 1H), 7.61 – 6.94 (m, 5H), 5.81 (s, 1H), 3.42 (d, J = 7.2 Hz, 2H), 3.03 (t, J = 7.5 Hz, 2H), 2.30 (s, 3H). 13C


140.4 (-C-), 129.0 (-CH-), 128.8 (-CH-), 126.8 (-CH-), 99.0 (-CH-), 35.6 (-CH2-), 32.4 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C14H15N4OS (M+H)+, 287.0966; found, 287.0955. 5-Methyl-2-((3-phenylpropyl)thio)-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C17), white solid, yield: 62％. 1H NMR (400 MHz, DMSO-d6) δ 13.32 (s, 1H), 7.47 – 7.06 (m, 5H), 5.80 (s, 1H), 3.15 (t, J = 7.2 Hz, 2H), 2.79 – 2.69 (m, 2H), 2.29 (s, 55 / 102



3H), 2.08 – 1.95 (m, 2H). 13C NMR (100 MHz, DMSO-d6) δ 162.7 (-C-), 155.3 (-C-), 151.6 (-C-), 151.1 (-C-), 141.5 (-C-), 128.8 (-CH-), 128.8 (-CH-), 126.4 (-CH-), 99.0 (-CH-), 34.4 (-CH2-), 31.1 (-CH2-), 30.6 (-CH2-), 19.0 (-CH3).HRMS (ESI): m/z calcd for C15H15N4OS (M-H)-, 299.0966; found, 299.0974. 2-(((5-Chlorobenzo[b]thiophen-3-yl)methyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]p yrimidin-7(4H)-one (C18), white solid, yield: 73％. 1H NMR (400 MHz, DMSO-d6) δ 13.21 (s, 1H), 8.05 (t, J = 5.7 Hz, 2H), 7.83 (s, 1H), 7.43 (m, J = 8.6, 2.0 Hz, 1H), 5.83 (s, 1H), 4.72 (s, 2H), 2.30 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 161.7 (-C-), 154.8 (-C-), 151.2 (-C-), 150.8 (-C-), 139.1 (-C-), 138.2 (-C-), 131.0 (-C-), 129.6 (-C-), 128.3 (-CH-), 124.7 (-CH-), 124.6 (-CH-), 121.6 (-CH-), 98.5 (-CH-), 27.9 (-CH2-), 18.5 (-CH3). HRMS (ESI): m/z calcd for C15H12ClN4OS2 (M+H)+, 363.0141; found, 363.0127. 5-Methyl-2-(((2-oxo-2H-benzo[h]chromen-4-yl)methyl)thio)-[1,2,4]triazolo[1,5-a] pyrimidin-7(4H)-one (C19), black solid, yield: 66％. 1H NMR (400 MHz, DMSO-d6) δ 13.22 (s, 1H), 11.97 (s, 1H), 8.42 – 8.33 (m, 1H), 8.07 (m, 1H), 7.99 (d, J = 8.8 Hz, 1H), 7.92 (t, J = 7.4 Hz, 1H), 7.79 – 7.69 (m, 2H), 6.70 (s, 1H), 5.83 (s, 1H), 4.77 (s, 2H), 2.29 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 172.0 (-C-), 160.8 (-C-), 159.5 (-C-), 154.8 (-C-), 152.1 (-C-), 151.3 (-C-), 150.9 (-C-), 150.2 (-C-), 134.3 (-CH-), 128.9 (-CH-), 128.0 (-CH-), 127.5 (-C-), 124.1 (-CH-), 122.3 (-CH-), 121.6 (-CH-), 121.0 (-C-), 114.4 (-CH-), 113.6 (-CH-), 98.6 (-CH-), 31.2 (-CH2-), 18.5 (-CH3). HRMS (ESI): m/z calcd for C20H15N4O3S (M+H)+, 391.0864; found, 391.0851.

56 / 102


Page 56 of 102

Page 57 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2-(Benzylthio)-5-phenyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C20), white solid, yield: 74 ％. 1H NMR (400 MHz, DMSO-d6) δ 13.49 (s, 1H), 7.88 – 7.82 (m, 2H), 7.62 – 7.53 (m, 3H), 7.48 (d, J = 7.2 Hz, 2H), 7.34 (t, J = 7.3 Hz, 2H), 7.30 – 7.24 (m, 1H), 6.29 (s, 1H), 4.49 (s, 2H).

13C

NMR (100 MHz, DMSO-d6) δ 154.9

(-C-), 151.7 (-C-), 137.3 (-C-), 131.7 (-C-), 131.2 (-CH-), 129.0 (-CH-), 128.9 (-CH-), 128.5 (-CH-), 127.6 (-CH-), 127.4 (-CH-), 97.7 (-CH-), 34.6 (-CH2-). HRMS (ESI): m/z calcd for C18H15N4OS (M+H)+, 335.0966; found, 335.0950. 2-(Benzylthio)-5-ethyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one

(C21),

white

solid, yield: 78％. 1H NMR (400 MHz, DMSO-d6) δ 13.17 (s, 1H), 7.46 (d, J = 7.3 Hz, 2H), 7.33 (t, J = 7.3 Hz, 2H), 7.27 (m, 1H), 5.82 (s, 1H), 4.45 (s, 2H), 2.58 (q, J = 7.5 Hz, 2H), 1.21 (t, J = 7.5 Hz, 3H).

13C

NMR (100 MHz, DMSO-d6) δ 162.6 (-C-),

156.2 (-C-), 155.5 (-C-), 151.7 (-C-), 137.9 (-C-), 129.3 (-CH-), 129.0 (-CH-), 127.8 (-CH-), 97.6 (-CH-), 35.1 (-CH2-), 26.0 (-CH2-), 12.8 (-CH3). HRMS (ESI): m/z calcd for C14H15N4OS (M+H)+, 287.0966; found, 287.0949. 5-Phenyl-2-(prop-2-yn-1-ylthio)-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C22), white solid, yield: 69 ％ . 1H NMR (400 MHz, DMSO-d6) δ 13.54 (s, 1H), 7.84 (m, 2H), 7.66 – 7.46 (m, 3H), 6.30 (s, 1H), 4.06 (d, J = 2.6 Hz, 2H), 3.24 (s, 1H).

13C

NMR (100 MHz, DMSO-d6) δ 154.9 (-C-), 151.8 (-C-), 131.7 (-C-), 131.3 (-C-), 129.0 (-CH-), 127.6 (-CH-), 97.8 (-CH-), 80.0 (-C-), 74.0 (-CH-), 19.1 (-CH2-). HRMS (ESI): m/z calcd for C14H11N4OS (M+H)+, 283.0653; found, 283.0640. 5-Methyl-2-((4-nitrobenzyl)thio)-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C23), yellow solid, yield: 78％. 1H NMR (400 MHz, DMSO-d6) δ 13.21 (s, 1H), 8.18 (d, J = 57 / 102



8.7 Hz, 2H), 7.73 (d, J = 8.7 Hz, 2H), 5.82 (s, 1H), 4.57 (s, 2H), 2.29 (s, 3H).

Page 58 of 102

13C

NMR (100 MHz, DMSO-d6) δ 161.9 (-C-), 155.3 (-C-), 151.7 (-C-), 151.3 (-C-), 147.1 (-C-), 146.5 (-C-), 130.5 (-CH-), 124.0 (-CH-), 99.1 (-CH-), 34.2 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C13H12N5O3S (M+H)+, 318.0660; found, 318.0646. 5-Methyl-2-((2-nitrobenzyl)thio)-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C24), yellow solid, yield: 76％. 1H NMR (400 MHz, DMSO-d6) δ 13.20 (s, 1H), 8.07 (d, J = 8.0 Hz, 1H), 7.78 (d, J = 7.0 Hz, 1H), 7.71 (t, J = 7.3 Hz, 1H), 7.62 – 7.51 (m, 1H), 5.82 (s, 1H), 4.72 (s, 2H), 2.30 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 162.0 (-C-), 155.3 (-C-), 151.7 (-C-), 151.3 (-C-), 148.5 (-C-), 134.4 (-C-), 133.4 (-CH-), 132.7 (-CH-), 129.6 (-CH-), 125.6 (-CH-), 99.1 (-CH-), 32.5 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C13H12N5O3S (M+H)+, 318.0660; found, 318.0644. 2-((4-Fluorobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C25),

white solid, yield: 73％. 1H NMR (400 MHz, DMSO-d6) δ13.19 (s, 1H), 7.66

– 7.41 (m, 2H), 7.31 – 6.96 (m, 2H), 5.81 (s, 1H), 4.43 (s, 2H), 2.29 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 163.1 (-C-), 162.4 (-C-), 160.7 (-C-), 155.3 (-C-), 151.7 (-C-), 151.2 (-C-), 134.3 (-C-), 134.3 (-C-), 131.4 (-CH-), 131.3 (-CH-), 115.8 (-CH-), 115.6 (-CH-), 99.0 (-CH-), 34.2 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C13H12FN4OS (M+H)+, 291.0715; found, 291.0702. 2-((4-Chlorobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C26), white solid, yield: 71％. 1H NMR (400 MHz, DMSO-d6) δ 13.20 (s, 1H), 7.48 (d, J = 7.5 Hz, 2H), 7.38 (d, J = 7.3 Hz, 2H), 5.82 (s, 1H), 4.44 (s, 2H), 2.30 (s, 3H). 58 / 102


Page 59 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


13C


137.3 (-C-), 132.4 (-C-), 131.2 (-CH-), 128.9 (-CH-), 99.0 (-CH-), 34.2 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C13H12ClN4OS (M+H)+, 307.0420; found, 307.0405. 2-((4-Bromobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C27),

white solid, yield: 64 ％ . 1H NMR (400 MHz, DMSO-d6) δ 13.19 (s, 1H),

7.52 (d, J = 8.4 Hz, 2H), 7.42 (d, J = 8.4 Hz, 2H), 5.82 (s, 1H), 4.41 (s, 2H), 2.29 (s, 3H).

13C

NMR (100 MHz, DMSO-d6) δ 162.2 (-C-), 155.3 (-C-), 151.7 (-C-), 151.2

(-C-), 137.7 (-C-), 131.8 (-C-), 131.5 (-CH-), 120.9 (-CH-), 99.0 (-CH-), 34.3 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C13H12BrN4OS (M+H)+, 350.9915; found, 350.9899. 2-((2-Bromobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C28),


7.71 – 7.59 (m, 2H), 7.36 (t, J = 7.4 Hz, 1H), 7.25 (m, 1H), 5.83 (s, 1H), 4.52 (s, 2H), 2.30 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 162.0 (-C-), 155.3 (-C-), 151.7 (-C-), 151.3 (-C-), 136.8 (-C-), 133.3 (-C-), 131.7 (-CH-), 130.2 (-CH-), 128.4 (-CH-), 124.5 (-CH-), 99.1 (-CH-), 35.9 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C13H12BrN4OS (M+H)+, 350.9915; found, 350.9900. 2-((3-Bromobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C29),


7.68 (s, 1H), 7.55 – 7.40 (m, 2H), 7.28 (t, J = 7.8 Hz, 1H), 5.81 (s, 1H), 4.43 (s, 2H), 2.29 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 162.2 (-C-), 155.3 (-C-), 151.7 (-C-), 59 / 102



Page 60 of 102

151.2 (-C-), 141.1 (-C-), 132.0 (-C-), 131.1 (-CH-), 130.6 (-CH-), 128.4 (-CH-), 122.0 (-CH-), 99.1 (-CH-), 34.2 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C13H12BrN4OS (M+H)+, 350.9915; found, 350.9903. 5-Methyl-2-((4-methylbenzyl)thio)-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C30), white solid, yield: 80％. 1H NMR (400 MHz, DMSO-d6) δ 13.18 (s, 1H), 7.33 (d, J = 7.9 Hz, 2H), 7.12 (d, J = 7.9 Hz, 2H), 5.81 (s, 1H), 4.39 (s, 2H), 2.28 (d, J = 10.2 Hz, 6H). 13C NMR (100 MHz, DMSO-d6) δ 162.6 (-C-), 155.3 (-C-), 151.6 (-C-), 151.2 (-C-), 137.0 (-C-), 134.7 (-C-), 129.5 (-CH-), 129.3 (-CH-), 99.0 (-CH-), 34.9 (-CH2-), 21.2 (-CH3), 19.0 (-CH3). HRMS (ESI): m/z calcd for C14H15N4OS (M+H)+, 287.0966; found, 287.0952. 5-Methyl-2-((4-(trifluoromethyl)benzyl)thio)-[1,2,4]triazolo[1,5-a]pyrimidin-7(4 H)-one (C31), white solid, yield: 67％. 1H NMR (400 MHz, DMSO-d6) δ 13.21 (s, 1H), 7.69 (s, 4H), 5.82 (s, 1H), 4.53 (s, 2H), 2.30 (s, 3H).

13C

NMR (100 MHz,

DMSO-d6) δ 162.1 (-C-), 155.3 (-C-), 151.7 (-C-), 151.23 (-C-), 143.3 (-C-), 130.1 (-C-), 125.8 (-CH-), 125.7 (-CH-), 99.1 (-CH-), 34.3 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C14H12F3N4OS (M+H)+, 341.0683; found, 341.0668. 5-Methyl-2-((2-(trifluoromethyl)benzyl)thio)-[1,2,4]triazolo[1,5-a]pyrimidin-7(4 H)-one (C32), white solid, yield: 65％. 1H NMR (400 MHz, DMSO-d6) δ 13.23 (s, 1H), 7.77 (t, J = 7.6 Hz, 2H), 7.67 (t, J = 7.6 Hz, 1H), 7.53 (t, J = 7.6 Hz, 1H), 5.84 (s, 1H), 4.62 (s, 2H), 2.31 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 172.5 (-C-), 162.0 (-C-), 155.3 (-C-), 151.8 (-C-), 151.3 (-C-), 135.8 (-C-), 133.4 (-C-), 132.3 (-C-), 128.8 (-C-), 127.7 (-C-), 127.4 (-CH-), 126.7 (-CH-), 126.6 (-CH-), 126.2 (-CH-), 60 / 102


Page 61 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


123.4 (-CH-), 99.1 (-CH-), 31.9 (-CH2-), 19.0 (-CH3).HRMS (ESI): m/z calcd for C14H10F3N4OS (M-H)-, 339.0527; found, 339.0532. 5-Methyl-2-((3-(trifluoromethyl)benzyl)thio)-[1,2,4]triazolo[1,5-a]pyrimidin-7(4 H)-one (C33), white solid, yield: 63％. 1H NMR (400 MHz, DMSO-d6) δ 13.20 (s, 1H), 7.85 (s, 1H), 7.79 (d, J = 7.6 Hz, 1H), 7.63 (d, J = 7.8 Hz, 1H), 7.57 (t, J = 7.7 Hz, 1H), 5.82 (s, 1H), 4.54 (s, 2H), 2.30 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 162.1 (-C-), 155.3 (-C-), 151.7 (-C-), 151.2 (-C-), 139.9 (-C-), 133.5 (-C-), 130.0 (-C-), 129.7 (-C-), 129.4 (-C-), 125.9 (-C-), 125.9 (-CH-), 124.5 (-CH-), 124.4 (-CH-), 123.2 (-CH-), 99.1 (-CH-), 34.3 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C14H12F3N4OS (M+H)+, 341.0683; found, 341.0669. 2-((4-Methoxybenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C34), white solid, yield: 78％. 1H NMR (400 MHz, DMSO-d6) δ 13.18 (s, 1H), 7.37 (d, J = 8.6 Hz, 2H), 6.88 (d, J = 8.6 Hz, 2H), 5.81 (s, 1H), 4.38 (s, 2H), 3.73 (s, 3H), 2.30 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 162.6 (-C-), 159.0 (-C-), 155.3 (-C-), 151.6 (-C-), 151.2 (-C-), 130.6 (-C-), 129.6 (-CH-), 114.4 (-CH-), 99.0 (-CH-), 55.6 (-CH3), 34.6 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C14H15N4O2S (M+H)+, 303.0915; found, 303.0902. 2-((4-Chloro-3-fluorobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H) -one (C35), white solid, yield: 69％. 1H NMR (400 MHz, DMSO-d6) δ 13.19 (s, 1H), 7.53 (m, 2H), 7.34 (m, 1H), 5.82 (s, 1H), 4.45 (s, 2H), 2.30 (s, 3H).

13C

NMR (100

MHz, DMSO-d6) δ 162.0 (-C-), 158.6 (-C-), 156.1 (-C-), 155.3 (-C-), 151.7 (-C-), 151.3 (-C-), 140.3 (-C-), 140.2 (-C-), 131.0 (-C-), 126.7 (-C-), 126.6 (-C-), 118.8 61 / 102



(-C-), 118.6 (-CH-), 117.8 (-CH-), 117.6 (-CH-), 99.1 (-CH-), 33.9 (-CH2-), 19.0 (-CH3).

HRMS (ESI): m/z calcd for C13H11ClFN4OS (M+H)+, 325.0326; found,

325.0315. 2-((3-Chloro-4-fluorobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H) -one (C36), white solid, yield: 71％. 1H NMR (400 MHz, DMSO-d6) δ 13.19 (s, 1H), 7.69 (m, 1H), 7.53 – 7.43 (m, 1H), 7.36 (t, J = 9.0 Hz, 1H), 5.81 (s, 1H), 4.43 (s, 2H), 2.29 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 162.1 (-C-), 158.1 (-C-), 155.7 (-C-), 155.3 (-C-), 151.7 (-C-), 151.2 (-C-), 136.4 (-C-), 136.3 (-C-), 131.4 (-C-), 130.1 (-C-), 130.0 (-C-), 119.7 (-C-), 119.6 (-CH-), 117.4 (-CH-), 117.2 (-CH-), 99.1 (-CH-), 33.7 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C13H11ClFN4OS (M+H)+, 325.0326; found, 325.0314. 2-((2,6-Dichlorobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C37), white solid, yield: 77％. 1H NMR (400 MHz, DMSO-d6) δ 13.25 (s, 1H), 7.55 (d, J = 8.1 Hz, 2H), 7.46 – 7.36 (m, 1H), 5.85 (s, 1H), 4.73 (s, 2H), 2.32 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 161.8 (-C-), 155.3 (-C-), 151.8 (-C-), 151.3 (-C-), 135.6 (-C-), 132.4 (-CH-), 131.0 (-CH-), 129.3 (-CH-), 99.1 (-CH-), 31.9 (-CH2-), 19.0 (-CH3). HRMS (ESI): m/z calcd for C13H11Cl2N4OS (M+H)+, 341.0030; found, 341.0019. 2-((4-Chlorobenzyl)thio)-5,6-dimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H)-one (C38), white solid, yield: 72％. 1H NMR (400 MHz, DMSO-d6) δ 13.02 (s, 1H), 7.48 (d, J = 8.4 Hz, 2H), 7.41 – 7.28 (m, 2H), 4.43 (s, 2H), 2.30 (s, 3H), 1.95 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 162.3 (-C-), 156.1 (-C-), 150.6 (-C-), 146.4 (-C-), 62 / 102


Page 62 of 102

Page 63 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


137.3 (-C-), 132.4 (-C-), 131.2 (-CH-), 128.8 (-CH-), 105.2 (-CH-), 34.2 (-CH2-), 17.6 (-CH3), 10.8 (-CH3). HRMS (ESI): m/z calcd for C14H14ClN4OS (M+H)+, 321.0576; found, 321.0565. 2-((4-Chlorobenzyl)thio)-5-methyl-6-pentyl-[1,2,4]triazolo[1,5-a]pyrimidin-7(4H) -one (C39), white solid, yield: 74％. 1H NMR (400 MHz, DMSO-d6) δ 12.99 (s, 1H), 7.48 (d, J = 8.4 Hz, 2H), 7.37 (d, J = 8.4 Hz, 2H), 4.43 (s, 2H), 2.48 – 2.37 (m, 2H), 2.32 (s, 3H), 1.40 (d, J = 6.8 Hz, 2H), 1.29 (d, J = 3.0 Hz, 4H), 0.87 (t, J = 6.7 Hz, 3H).

13C


(-C-), 137.4 (-C-), 132.4 (-C-), 131.2 (-C-), 128.9 (-CH-), 110.1 (-CH-), 34.2 (-CH2-), 31.5 (-CH2-), 28.4 (-CH2-), 25.2 (-CH2-), 22.5 (-CH2-), 17.2 (-CH3), 14.4 (-CH3). HRMS (ESI): m/z calcd for C18H22ClN4OS (M+H)+, 377.1202; found, 377.1188. General method for the synthesis of D1-D39. Compounds D1-D39 were prepared following the previously reported method

56

as described for the synthesis of D15.

C15 was stirred in POCl3 (excess) at 90 oC for 3-5h. The resultant oil was added dropwise to ice cold bath. The resulting aqueous mixture was extracted with CH2Cl2 (4 × 30 mL) and the organic layer was washed by saturated aqueous NaHCO3 (3×10 mL). The organic layers were dried over MgSO4 and concentrated under reduced pressure to give the orange solid D15, which was used directly without further purification. D15 was unstable enough and therefore only characterized by HRMS. HRMS (ESI): m/z calcd for C13H12ClN4S (M-H)-, 291.0471; found, 291.0463. General method for the synthesis of E1-E44. The general method was described for the synthesis of E1. Compound D1 (150 mg, 0.65 mmol) was dissolved in ethanol (2 63 / 102



Page 64 of 102

mL), followed by addition of 1-methyl-1H-tetrazole-5-thiol (75.53 mg, 0.65 mmol). The reaction mixture was stirred at room temperature for 10 h. The resultant mixture was concentrated under reduced pressure to the residue, which was then purified by column chromatography to give E1. 7-((1-Methyl-1H-tetrazol-5-yl)thio)-5-phenyl-[1,2,4]triazolo[1,5-a]pyrimidine (E1), white solid, yield: 88%. HPLC purity: 95.06%.1H NMR (400 MHz, DMSO-d6) δ 8.75 (s, 1H), 8.19 – 8.09 (m, 2H), 7.64 – 7.49 (m, 4H), 4.23 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 160.1 (-C-), 156.2 (-C-), 154.6 (-C-), 146.3 (-CH-), 143.5 (-C-), 135.6 (-C-), 131.6 (-CH-), 129.1 (-CH-), 127.8 (-CH-), 107.2 (-CH-), 35.1 (-CH3). HRMS (ESI): m/z calcd for C13H11N8S (M+H)+, 311.0827; found, 311.0803. 5-Phenyl-7-((1-phenyl-1H-tetrazol-5-yl)thio)-[1,2,4]triazolo[1,5-a]pyrimidine (E2), white solid, yield: 63%. HPLC purity: 99.25%. 1H NMR (400 MHz, DMSO-d6) δ 8.69 (s, 1H), 8.18 (m, 2H), 7.96 (s, 1H), 7.81 (m, 2H), 7.67 – 7.53 (m, 6H).

13C

NMR (100 MHz, DMSO-d6) δ 160.2 (-C-), 156.1 (-C-), 154.5 (-C-), 146.8 (-CH-), 141.9 (-C-), 135.5 (-C-), 133.0 (-C-), 131.6 (-CH-), 131.0 (-CH-), 129.7 (-CH-), 129.1 (-CH-), 127.9 (-CH-), 125.3 (-CH-), 108.6 (-CH-). HRMS (ESI): m/z calcd for C18H13N8S (M+H)+, 373.0983; found, 373.0968. 4-(5-((5-Phenyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio)-1H-tetrazol-1-yl)phenol (E3), white solid, yield: 92%. HPLC purity: 99.60%. 1H NMR (400 MHz, DMSO-d6) δ 10.25 (s, 1H), 8.71 (s, 1H), 8.26 – 8.10 (m, 2H), 7.91 (s, 1H), 7.67 – 7.46 (m, 5H), 6.91 (d, J = 8.7 Hz, 2H). 13C NMR (100 MHz, DMSO-d6) δ 160.2 (-C-), 159.5 (-C-), 156.1 (-C-), 154.5 (-C-), 146.8 (-CH-), 142.0 (-C-), 135.5 (-C-), 131.6 (-CH-), 129.1 64 / 102


Page 65 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(-CH-), 127.9 (-CH-), 126.9 (-C-), 124.0 (-CH-), 115.9 (-CH-), 108.4 (-CH-). HRMS (ESI): m/z calcd for C18H13N8OS (M+H)+, 389.0933; found, 389.0900. N,N-Dimethyl-2-(5-((5-phenyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio)-1H-tetra zol-1-yl)ethan-1-amine hydrochloride (E4), white solid, yield: 91%. HPLC purity: 99.53%. 1H NMR (400 MHz, DMSO-d6) δ 11.13 (s, 1H), 8.76 (s, 1H), 8.18 (m, 2H), 7.71 (s, 1H), 7.63 – 7.54 (m, 3H), 5.08 (t, J = 6.4 Hz, 2H), 3.79 (s, 2H), 2.85 (s, 6H). 13C

NMR (100 MHz, DMSO-d6) δ 166.9 (-C-), 156.2 (-C-), 153.7 (-C-), 151.3 (-CH-),

150.0 (-C-), 133.4 (-C-), 130.7 (-CH-), 128.8 (-CH-), 127.4 (-CH-), 97.2 (-CH-), 55.7 (-CH2-), 42.6 (-CH2-), 40.7 (-CH3). HRMS (ESI): m/z calcd for C16H18N9S (M+H)+, 368.1400; found, 368.1373. N,N-Dimethyl-2-(5-((5-methylpyrazolo[1,5-a]pyrimidin-7-yl)thio)-1H-tetrazol-1yl)ethan-1-amine hydrochloride (E5), white solid, yield: 52%. HPLC purity: 100.00%. 1H NMR (400 MHz, DMSO-d6) δ 11.12 (s, 1H), 8.25 (d, J = 2.3 Hz, 1H), 6.68 (d, J = 2.3 Hz, 1H), 6.65 (s, 1H), 5.02 (t, J = 6.4 Hz, 2H), 3.72 (t, J = 6.0 Hz, 2H), 2.82 (s, 6H), 2.47 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 158.4 (-C-), 147.7 (-C-), 146.8 (-C-), 144.8 (-C-), 141.2 (-CH-), 107.3 (-CH-), 95.9 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.5 (-CH3), 24.3 (-CH3). HRMS (ESI): m/z calcd for C12H17N8S (M+H)+, 305.1291; found, 305.1284. N,N-Dimethyl-2-(5-(thieno[3,2-d]pyrimidin-4-ylthio)-1H-tetrazol-1-yl)ethan-1-a mine hydrochloride (E6), white solid, yield: 94%. HPLC purity: 99.72%. 1H NMR (400 MHz, DMSO-d6) δ 11.09 (s, 1H), 8.90 (s, 1H), 8.60 (d, J = 5.4 Hz, 1H), 7.74 (d, J = 5.4 Hz, 1H), 4.97 (t, J = 6.6 Hz, 2H), 3.72 (t, J = 6.5 Hz, 2H), 2.80 (s, 6H). 13C 65 / 102



NMR (100 MHz, DMSO-d6) δ 160.4 (-C-), 158.0 (-C-), 153.8 (-CH-), 146.7 (-C-), 138.6 (-CH-), 127.6 (-CH-), 124.3 (-CH-), 54.2 (-CH2-), 42.9 (-CH2-), 42.6 (-CH3). HRMS (ESI): m/z calcd for C11H14N7S2 (M+H)+, 308.0746; found, 308.0726. (Z)-2-(1-(((6,7-Bis(2-methoxyethoxy)quinazolin-4-yl)thio)methyl)tetraaz-2-en-1-y l)-N,N-dimethylethan-1-amine hydrochloride (E7), yellow solid, yield: 78%. HPLC purity: 97.60%. 1H NMR (400 MHz, DMSO-d6) δ 8.67 (s, 1H), 7.42 (d, J = 10.9 Hz, 2H), 4.90 (t, J = 6.5 Hz, 2H), 4.52 – 4.31 (m, 4H), 3.84 – 3.68 (m, 6H), 3.36 (t, J = 9.5 Hz, 7H), 2.83 (d, J = 9.2 Hz, 6H). 13C NMR (100 MHz, DMSO-d6) δ 161.7 (-C-), 155.8 (-C-), 152.0 (-CH-), 150.1 (-C-), 147.4 (-C-), 146.4 (-C-), 117.8 (-C-), 107.9 (-CH-), 102.3 (-CH-), 70.1 (-CH2-), 69.9 (-CH2-), 68.7 (-CH2-), 68.7 (-CH2-), 58.4 (-CH3), 58.3 (-CH3), 54.2 (-CH2), 42.8 (-CH2), 42.6 (-CH3). HRMS (ESI): m/z calcd for C19H28N7O4S (M+H)+, 450.1918; found, 450.1885. N,N-Dimethyl-2-(5-((5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio)-1H-tetra zol-1-yl)ethan-1-amine hydrochloride (E8), white solid, yield: 75%. HPLC purity: 99.59%. 1H NMR (400 MHz, DMSO-d6) δ 10.74 (s, 1H), 8.69 (s, 1H), 6.94 (s, 1H), 5.01 (t, J = 5.9 Hz, 2H), 3.71 (s, 2H), 2.83 (s, 6H), 2.56 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 167.0 (-C-), 155.8 (-C-), 151.8 (-C-), 151.6 (-CH-), 150.6 (-C-), 98.1 (-CH-), 55.8 (-CH2-), 42.6 (-CH3), 40.7 (-CH2-), 18.6 (-CH3). HRMS (ESI): m/z calcd for C11H16N9S (M+H)+, 306.1243; found, 306.1227. 2-(5-((5-Ethyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio)-1H-tetrazol-1-yl)-N,N-di methylethan-1-amine hydrochloride (E9), white solid, yield: 76%. HPLC purity: 98.85%. 1H NMR (400 MHz, DMSO--d6) δ 11.27 (s, 1H), 8.68 (s, 1H), 7.01 (s, 1H), 66 / 102


Page 66 of 102

Page 67 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5.03 (s, 2H), 3.74 (s, 2H), 2.86 (m, 8H), 1.22 (t, J = 7.5 Hz, 3H). 13C NMR (100 MHz, DMSO-d6) δ 169.2 (-C-), 155.4 (-C-), 154.3 (-C-), 146.3 (-CH-), 142.8 (-C-), 109.2 (-CH-), 54.0 (-CH2-), 43.1 (-CH2-), 42.4 (-CH3), 30.8 (-CH2-), 12.4 (-CH3). HRMS (ESI): m/z calcd for C12H18N9S (M+H)+, 320.1400; found, 320.1379. 2-(5-((5-Isopropyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio)-1H-tetrazol-1-yl)-N, N-dimethylethan-1-amine hydrochloride (E10), white solid, yield: 68%. HPLC purity: 98.80%. 1H NMR (400 MHz, DMSO-d6) δ 11.05 (s, 1H), 8.68 (s, 1H), 7.07 (s, 1H), 5.02 (t, J = 6.1 Hz, 2H), 3.73 (s, 2H), 3.05-3.12 (m, 1H), 2.82 (s, 6H), 1.23 (d, J = 6.8 Hz, 6H).

13C

NMR (100 MHz, DMSO-d6) δ 172.7 (-C-), 155.5 (-C-), 154.4

(-C-), 146.5 (-CH-), 142.8 (-C-), 108.8 (-CH-), 54.1 (-CH2-), 43.2 (-CH2-), 42.5 (-CH3), 35.8 (-CH-), 21.5 (-CH3). HRMS (ESI): m/z calcd for C13H20N9S (M+H)+, 334.1556; found, 334.1533. 2-(5-((5-Cyclopropyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio)-1H-tetrazol-1-yl)N,N-dimethylethan-1-amine hydrochloride (E11), white solid, yield: 68%. HPLC purity: 99.39%. 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 8.62 (s, 1H), 7.12 (s, 1H), 5.03 (t, J = 6.3 Hz, 2H), 3.74 (t, J = 5.9 Hz, 2H), 2.84 (s, 6H), 2.40 – 2.20 (m, 1H), 1.11 (t, J = 16.5 Hz, 4H). 13C NMR (100 MHz, DMSO-d6) δ 169.7 (-C-), 155.4 (-C-), 154.6 (-C-), 146.4 (-CH-), 142.3 (-C-), 108.9 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.5 (-CH3), 17.2 (-CH), 12.5 (-CH2). HRMS (ESI): m/z calcd for C13H18N9S (M+H)+, 332.1400; found, 332.1380. 2-(5-((6,7-Dihydro-5H-cyclopenta[d][1,2,4]triazolo[1,5-a]pyrimidin-8-yl)thio)-1H -tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E12), white solid, 67 / 102



yield: 86%. HPLC purity: 99.74%. 1H NMR (400 MHz, DMSO-d6) δ 8.47 (s, 1H), 4.76 – 4.65 (m, 2H), 3.15 – 3.04 (m, 2H), 2.84 (t, J = 7.4 Hz, 2H), 2.75 – 2.65 (m, 2H), 2.18 (s, 6H), 2.17 – 2.12 (m, 2H). 13C NMR (100 MHz, DMSO-d6) δ 174.0 (-C-), 154.7 (-C-), 154.6 (-C-), 148.4 (-CH-), 134.8 (-C-), 128.9 (-C-), 57.6 (-CH2-), 46.5 (-CH2-), 45.1 (-CH3), 34.4 (-CH2-), 28.0 (-CH2-), 23.0 (-CH2-). HRMS (ESI): m/z calcd for C13H18N9S (M+H)+, 332.1400; found, 332.1379. N,N-Dimethyl-2-(5-((5-methyl-2-(propylthio)-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl )thio)-1H-tetrazol-1-yl)ethan-1-amine hydrochloride (E13), white solid, yield: 90%. HPLC purity: 100%. 1H NMR (400 MHz, DMSO-d6) δ 11.22 (s, 1H), 6.82 (s, 1H), 5.00 (t, J = 6.2 Hz, 2H), 3.71 (s, 2H), 3.21 (t, J = 7.1 Hz, 2H), 2.81 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak), 1.85 – 1.69 (m, 2H), 1.02 (t, J = 7.3 Hz, 3H).

13C


(-C-), 141.8 (-C-), 108.4 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.4 (-CH3), 32.5 (-CH2-), 24.5 (-CH2-), 22.5 (-CH3), 13.0 (-CH3). HRMS (ESI): m/z calcd for C14H22N9S2 (M+H)+, 380.1434; found, 380.1407. 2-(5-((2-(Allylthio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio)-1H-tetrazo l-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E14), white solid, yield: 93%. HPLC purity: 99.79%. 1H NMR (400 MHz, DMSO-d6) δ 11.15 (s, 1H), 6.82 (s, 1H), 6.02 (m, 1H), 5.38 (d, J = 17.0 Hz, 1H), 5.16 (d, J = 10.0 Hz, 1H), 5.00 (t, J = 6.2 Hz, 2H), 3.92 (d, J = 6.8 Hz, 2H), 3.70 (s, 2H), 2.81 (s, 6H), 2.51 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ 166.0 (-C-), 164.5 (-C-), 154.6

(-C-), 146.0 (-C-), 142.0 (-C-), 133.4 (-CH-), 118.5 (-CH2), 108.4 (-CH-), 54.1 68 / 102


Page 68 of 102

Page 69 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(-CH2-), 43.1 (-CH2-), 42.4 (-CH3), 33.2 (-CH2-), 24.6 (-CH3).HRMS (ESI): m/z calcd for C14H20N9S2 (M+H)+, 378.1277; found, 378.1247. N,N-Dimethyl-2-(5-((5-methyl-2-(prop-2-yn-1-ylthio)-[1,2,4]triazolo[1,5-a]pyrimi din-7-yl)thio)-1H-tetrazol-1-yl)ethan-1-amine hydrochloride (E15), white solid, yield: 85%. HPLC purity: 99.12%. 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 6.85 (s, 1H), 5.00 (t, J = 6.2 Hz, 2H), 4.11 (d, J = 2.5 Hz, 2H), 3.70 (s, 2H), 3.24 (t, J = 2.5 Hz, 1H), 2.81 (s, 6H), 2.51 (s, 3H, overlapped with DMSO-d6 peak). 13C NMR (100 MHz, DMSO-d6) δ 165.1 (-C-), 164.7 (-C-), 154.6 (-C-), 146.0 (-C-), 142.1 (-C-), 108.8 (-CH-), 79.8 (-C-), 74.0 (-CH), 54.1 (-CH2-), 43.1 (-CH2-), 42.5 (-CH3), 24.6 (-CH2-), 19.1 (-CH3). HRMS (ESI): m/z calcd for C14H18N9S2 (M+H)+, 376.1121; found, 376.1091. 2-(5-((2-(Isopropylthio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio)-1H-te trazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E16), white solid, yield: 62%. HPLC purity: 99.75%. 1H NMR (400 MHz, DMSO-d6) δ 10.77 (s, 1H), 6.82 (s, 1H), 4.99 (t, J = 6.2 Hz, 2H), 3.88-3.98 (m, 1H), 3.70 (s, 2H), 2.83 (s, 6H), 2.51(s, 3H, overlapped with DMSO-d6 peak), 1.45 (d, J = 6.8 Hz, 6H). 13C NMR (100 MHz, DMSO-d6) δ 166.3 (-C-), 164.4 (-C-), 154.5 (-C-), 146.1 (-C-), 141.8 (-C-), 108.5 (-CH-), 54.1 (-CH2-), 42.5 (-CH2-), 36.6 (-CH3), 24.6 (-CH-), 23.2 (-CH3). HRMS (ESI): m/z calcd for C14H22N9S2 (M+H)+, 380.1434; found, 380.1412. 2-(5-((2-((Cyclopropylmethyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl) thio)-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E17), white solid, yield: 82%. HPLC purity: 98.27%. 1H NMR (400 MHz, DMSO-d6) δ 11.02 (s, 69 / 102



Page 70 of 102

1H), 6.81 (s, 1H), 4.99 (s, 2H), 3.70 (s, 2H), 3.19 (d, J = 6.9 Hz, 2H), 2.81 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak), 1.23 (s, 1H), 0.58 (d, J = 6.8 Hz, 2H), 0.37 (s, 2H). 13C NMR (100 MHz, DMSO-d6) δ 166.9 (-C-), 164.4 (-C-), 154.6 (-C-), 146.1 (-C-), 141.8 (-C-), 108.4 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.4 (-CH2-), 36.2 (-CH3), 24.5 (-CH3), 11.0 (-CH-), 5.7 (-CH2-). HRMS (ESI): m/z calcd for C15H22N9S2 (M+H)+, 392.1434; found, 392.1409. 2-(5-((2-((Cyclohexylmethyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)t hio)-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E18), white solid, yield: 87%. HPLC purity: 99.69%. 1H NMR (400 MHz, DMSO-d6) δ 10.90 (s, 1H), 6.80 (s, 1H), 4.99 (s, 2H), 3.70 (s, 2H), 3.16 (s, 2H), 2.82 (s, 6H), 2.50(s, 3H, overlapped with DMSO-d6 peak), 1.76 (m, 6H), 1.12 (d, J = 49.7 Hz, 5H). 13C NMR (100 MHz, DMSO-d6) δ 167.0 (-C-), 164.3 (-C-), 154.5 (-C-), 146.0 (-C-), 141.8 (-C-), 108.3 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.4 (-CH3), 31.8 (-CH2-), 25.8 (-CH-), 25.4 (-CH2-), 24.5 (-CH3). HRMS (ESI): m/z calcd for C18H28N9S2 (M+H)+, 434.1903; found, 434.1874. N,N-Dimethyl-2-(5-((5-methyl-2-((naphthalen-1-ylmethyl)thio)-[1,2,4]triazolo[1,5 -a]pyrimidin-7-yl)thio)-1H-tetrazol-1-yl)ethan-1-amine

hydrochloride

(E19),

white solid, yield: 62%. HPLC purity: 98.98%. 1H NMR (400 MHz, DMSO-d6) δ 10.81 (d, J = 109.5 Hz, 1H), 8.21 (d, J = 8.3 Hz, 1H), 7.98 (d, J = 7.8 Hz, 1H), 7.90 (d, J = 8.2 Hz, 1H), 7.74 (d, J = 7.0 Hz, 1H), 7.60 (m, 2H), 7.47 (t, J = 7.6 Hz, 1H), 6.82 (d, J = 4.4 Hz, 1H), 4.99 (m, 4H), 3.70 (s, 2H), 2.81 (s, 6H), 2.52(s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ 166.3 (-C-), 164.6 (-C-), 70 / 102


Page 71 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


154.6 (-C-), 146.0 (-C-), 142.0 (-C-), 133.5 (-C-), 132.5 (-C-), 130.9 (-C-), 128.7 (-CH-), 128.4 (-CH-), 127.9 (-CH-), 126.5 (-CH-), 126.0 (-CH-), 125.5 (-CH-), 123.7 (-CH-), 108.5 (-CH-), 54.2 (-CH2-), 43.1 (-CH2-), 42.5 (-CH3), 32.5 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C22H24N9S2 (M+H)+, 478.1590; found, 478.1580. 2-(5-((2-(Benzylthio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio)-1H-tetra zol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E20), white solid, yield: 88%. HPLC purity: 99.96%. 1H NMR (400 MHz, DMSO-d6) δ 11.07 (s, 1H), 7.50 (d, J = 7.3 Hz, 2H), 7.34 (t, J = 7.4 Hz, 2H), 7.27 (t, J = 7.3 Hz, 1H), 6.80 (s, 1H), 4.98 (t, J = 6.1 Hz, 2H), 4.52 (s, 2H), 3.67 (s, 2H), 3.35 (s, 2H), 2.79 (s, 6H), 2.50(s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ 166.3 (-C-),

164.5 (-C-), 154.6 (-C-), 146.0 (-C-), 142.0 (-C-), 137.5 (-C-), 129.0 (-CH-), 128.5 (-CH-), 127.4 (-CH-), 108.4 (-CH-), 54.2 (-CH2-), 43.2 (-CH2-), 42.5 (-CH3), 34.5 (-CH2-), 24.7 (-CH3). HRMS (ESI): m/z calcd for C18H22N9S2 (M+H)+,428.1439; found,428.1402. N,N-Dimethyl-2-(5-((5-methyl-2-(phenethylthio)-[1,2,4]triazolo[1,5-a]pyrimidin-7 -yl)thio)-1H-tetrazol-1-yl)ethan-1-amine hydrochloride (E21), white solid, yield: 82%. HPLC purity: 99.16%. 1H NMR (400 MHz, DMSO-d6) δ 11.09 (s, 1H), 7.41 – 7.30 (m, 4H), 7.30 – 7.19 (m, 1H), 6.81 (s, 1H), 5.00 (t, J = 6.2 Hz, 2H), 3.70 (s, 2H), 3.56 – 3.42 (m, 2H), 3.14 – 3.03 (m, 2H), 2.81 (s, 6H), 2.52 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ 166.5 (-C-), 164.4 (-C-), 154.7

(-C-), 146.0 (-C-), 142.0 (-C-), 139.9 (-C-), 128.6 (-CH-), 128.4 (-CH-), 126.4 (-CH-), 108.3 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.4 (-CH3), 35.2 (-CH2-), 32.0 (-CH2-), 71 / 102



24.5 (-CH3). HRMS (ESI): m/z calcd for C19H24N9S2 (M+H)+, 442.1590; found, 442.1558. N,N-Dimethyl-2-(5-((5-methyl-2-((3-phenylpropyl)thio)-[1,2,4]triazolo[1,5-a]pyri midin-7-yl)thio)-1H-tetrazol-1-yl)ethan-1-amine hydrochloride (E22), white solid, yield: 80%. HPLC purity: 99.80%. 1H NMR (400 MHz, DMSO-d6) δ 10.92 (s, 1H), 7.30 (t, J = 7.4 Hz, 2H), 7.24 (d, J = 7.0 Hz, 2H), 7.19 (t, J = 7.1 Hz, 1H), 6.79 (s, 1H), 4.98 (t, J = 6.0 Hz, 2H), 3.69 (s, 2H), 3.24 (t, J = 7.1 Hz, 2H), 2.77 (m, 8H), 2.50 (s, 3H, overlapped with DMSO-d6 peak), 2.16 – 2.01 (m, 2H). 13C NMR (100 MHz, DMSO-d6) δ 166.6 (-C-), 164.4 (-C-), 154.6 (-C-), 146.0 (-C-), 141.9 (-C-), 141.0 (-C-), 128.4 (-CH-), 128.3 (-CH-), 125.9 (-CH-), 108.3 (-CH-), 54.2 (-CH2-), 42.5 (-CH2-), 40.1 (-CH3), 34.0 (-CH2-), 30.7 (-CH2-), 30.2 (-CH2-), 24.5 (-CH3). HRMS (ESI): m/z calcd for C20H26N9S2 (M+H)+, 456.1747; found, 456.1723. 2-(5-((2-(((5-Chlorobenzo[b]thiophen-3-yl)methyl)thio)-5-methyl-[1,2,4]triazolo[1,5 -a]pyrimidin-7-yl)thio)-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E23), white solid, yield: 76%. HPLC purity: 99.05%. 1H NMR (400 MHz, DMSO-d6) δ 11.08 (s, 1H), 8.11 (d, J = 1.8 Hz, 1H), 8.04 (d, J = 8.6 Hz, 1H), 7.90 (s, 1H), 7.44 (m, 1H), 6.82 (s, 1H), 4.99 (t, J = 6.1 Hz, 2H), 4.81 (s, 2H), 4.61 (t, J = 6.0 Hz, 1H), 3.68 (s, 2H), 2.79 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak). 13C NMR (100 MHz, DMSO-d6) δ 166.0 (-C-), 164.6 (-C-), 154.6 (-C-), 146.0 (-C-), 142.1 (-C-), 139.0 (-C-), 138.2 (-C-), 130.9 (-C-), 129.6 (-C-), 128.7 (-CH-), 124.7 (-CH-), 124.6 (-CH-), 121.6 (-CH-), 108.5 (-CH-), 54.2 (-CH2-), 43.2 (-CH2-),

72 / 102


Page 72 of 102

Page 73 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


42.5 (-CH3), 27.9 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C20H21ClN9S3 (M+H)+, 518.0765; found, 518.0732. 4-(((7-((1-(2-(Dimethylamino)ethyl)-1H-tetrazol-5-yl)thio)-5-methyl-[1,2,4]triazol o[1,5-a]pyrimidin-2-yl)thio)methyl)-2H-benzo[h]chromen-2-one

hydrochloride

(E24), white solid, yield: 74%. HPLC purity: 97.10%. 1H NMR (400 MHz, DMSO-d6) δ 10.66 (s, 1H), 8.47 – 8.30 (m, 1H), 8.07 (m, 2H), 7.99 – 7.89 (m, 1H), 7.81 – 7.67 (m, 2H), 6.86 – 6.73 (m, 2H), 4.95 (t, J = 5.9 Hz, 2H), 4.88 (s, 2H), 3.67 (s, 2H), 2.74 (d, J = 49.7 Hz, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak). 13C NMR (100 MHz, DMSO-d6) δ 172.0 (-C-), 167.0 (-C-), 160.7 (-C-), 159.4 (-C-), 154.8 (-C-), 152.1 (-C-), 151.4 (-C-), 151.0 (-C-), 150.2 (-C-), 134.3 (-CH-), 128.9 (-CH-), 128.0 (-CH-), 127.5 (-CH-), 124.1 (-CH-), 122.3 (-CH-), 121.6 (-C-), 121.0 (-CH-), 114.4 (-CH-), 113.6 (-CH-), 98.6 (-CH-), 55.8 (-CH2-), 42.6 (-CH3), 40.7 (-CH2-), 31.2 (-CH2), 21.0 (-CH3). HRMS (ESI): m/z calcd for C25H24N9O2S2 (M+H)+, 546.1488; found, 546.1452. 2-(5-((2-(Benzylthio)-5-phenyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio)-1H-tetra zol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E25), white solid, yield: 81%. HPLC purity: 97.33%. 1H NMR (400 MHz, DMSO-d6) δ 11.16 (s, 1H), 8.13 (d, J = 6.4 Hz, 2H), 7.63 – 7.46 (m, 6H), 7.35 (t, J = 7.4 Hz, 2H), 7.28 (t, J = 7.2 Hz, 1H), 5.05 (t, J = 6.1 Hz, 2H), 4.55 (s, 2H), 3.75 (s, 2H), 2.83 (s, 6H). 13C NMR (100 MHz, DMSO-d6) δ 167.2 (-C-), 159.8 (-C-), 154.9 (-C-), 146.6 (-C-), 142.4 (-C-), 137.4 (-C-), 135.6 (-C-), 131.5 (-CH-), 129.1 (-CH-), 129.0 (-CH-), 128.5 (-CH-), 127.8 (-CH-), 127.4 (-CH-), 106.2 (-CH-), 54.1 (-CH2-), 43.2 (-CH2-), 42.5 (-CH3), 34.5 73 / 102



Page 74 of 102

(-CH2-). HRMS (ESI): m/z calcd for C23H24N9S2 (M+H)+, 490.1590; found, 490.1559. 2-(5-((2-(Benzylthio)-5-ethyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio)-1H-tetrazo l-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E26), white solid, yield: 91%. HPLC purity: 98.56%. 1H NMR (400 MHz, DMSO-d6) δ 11.10 (s, 1H), 7.50 (d, J = 7.3 Hz, 2H), 7.34 (t, J = 7.4 Hz, 2H), 7.27 (t, J = 7.2 Hz, 1H), 6.84 (s, 1H), 4.98 (t, J = 6.0 Hz, 2H), 4.52 (s, 2H), 3.65 (s, 2H), 2.80 (m, 8H), 1.20 (t, J = 7.5 Hz, 3H).

13C

NMR (100 MHz, DMSO-d6) δ 168.9 (-C-), 166.3 (-C-), 154.7 (-C-), 146.1 (-C-), 142.0 (-C-), 137.5 (-C-), 129.0 (-CH-), 128.5 (-CH-), 127.4 (-CH-), 108.0 (-CH-), 54.3 (-CH2-), 43.2 (-CH2-), 42.6 (-CH3), 34.5 (-CH2-), 30.7 (-CH2-), 12.4 (-CH3).. HRMS (ESI): m/z calcd for C19H24N9S2 (M+H)+, 442.1590; found, 442.1566. N,N-Dimethyl-2-(5-((5-phenyl-2-(prop-2-yn-1-ylthio)-[1,2,4]triazolo[1,5-a]pyrimi din-7-yl)thio)-1H-tetrazol-1-yl)ethan-1-amine hydrochloride (E27), white solid, yield: 87%. HPLC purity: 97.72%. 1H NMR (400 MHz, DMSO-d6) δ 11.23 (s, 1H), 8.15 (m, 2H), 7.67 – 7.43 (m, 4H), 5.07 (t, J = 6.4 Hz, 2H), 4.14 (d, J = 2.5 Hz, 2H), 3.77 (s, 2H), 3.28 (t, J = 2.5 Hz, 1H), 2.84 (s, 6H). 13C NMR (100 MHz, DMSO-d6) δ 166.1 (-C-), 159.9 (-C-), 155.0 (-C-), 146.6 (-C-), 142.6 (-C-), 135.5 (-C-), 131.6 (-CH-), 129.1 (-CH-), 127.8 (-CH-), 106.5 (-CH-), 79.8 (-C-), 74.1 (-CH), 54.0 (-CH2-), 43.2 (-CH2-), 42.4 (-CH3), 19.1 (-CH2-). HRMS (ESI): m/z calcd for C19H20N9S2 (M+H)+, 438.1277; found, 438.1253. N,N-Dimethyl-2-(5-((5-methyl-2-((4-nitrobenzyl)thio)-[1,2,4]triazolo[1,5-a]pyrimi din-7-yl)thio)-1H-tetrazol-1-yl)ethan-1-amine hydrochloride (E28), white solid, yield: 78%. HPLC purity: 99.26%. 1H NMR (400 MHz, DMSO-d6) δ 8.20 (d, J = 8.5 74 / 102


Page 75 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Hz, 2H), 7.80 (d, J = 8.5 Hz, 2H), 6.79 (s, 1H), 4.97 (s, 2H), 4.63 (d, J = 14.1 Hz, 2H), 3.65 (s, 2H), 2.81 (d, J = 22.6 Hz, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak). 13C NMR (100 MHz, DMSO-d6) δ 165.6 (-C-), 164.6 (-C-), 154.6 (-C-), 146.6 (-C-), 146.1 (-C-), 146.0 (-C-), 142.2 (-C-), 130.3 (-CH-), 123.5 (-CH-), 108.5 (-CH-), 54.3 (-CH2-), 43.3 (-CH2-), 42.6 (-CH3), 33.7 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C18H21N10O2S2 (M+H)+, 473.1284; found, 473.1254. N,N-Dimethyl-2-(5-((5-methyl-2-((2-nitrobenzyl)thio)-[1,2,4]triazolo[1,5-a]pyrimi din-7-yl)thio)-1H-tetrazol-1-yl)ethan-1-amine hydrochloride (E29), white solid, yield: 89%. HPLC purity: 98.90%. 1H NMR (400 MHz, DMSO-d6) δ 10.24 (s, 1H), 7.81 (m, 4H), 6.78 (s, 1H), 4.93 (s, 2H), 4.82 (s, 2H), 4.57 (s, 1H), 2.78 (d, J = 45.2 Hz, 9H).

13C

NMR (100 MHz, DMSO-d6) δ 165.8 (-C-), 164.7 (-C-), 154.5 (-C-),

148.0 (-C-), 145.9 (-C-), 142.2 (-C-), 133.9 (-C-), 133.0 (-CH-), 132.6 (-CH-), 129.2 (-CH-), 125.1 (-CH-), 108.5 (-CH-), 54.4 (-CH2-), 43.2 (-CH2-), 42.6 (-CH3), 32.0 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C18H21N10O2S2 (M+H)+, 473.1284; found, 473.1253. 2-(5-((2-((4-Fluorobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio )-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E30), white solid, yield: 77%. HPLC purity: 98.53%. 1H NMR (400 MHz, DMSO-d6) δ 11.01 (s, 1H), 7.55 (m, 2H), 7.16 (t, J = 8.9 Hz, 2H), 6.80 (s, 1H), 4.99 (t, J = 6.2 Hz, 2H), 4.52 (s, 2H), 3.70 (s, 2H), 2.81 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ 166.1 (-C-), 164.6 (-C-), 162.6 (-C-), 160.12 (-C-), 154.6 (-C-), 146.0 (-C-), 142.1 (-C-), 134.0 (-CH-), 133.9 (-CH-), 131.1 (-CH-), 131.0 75 / 102



Page 76 of 102

(-CH-), 115.3 (-CH-), 115.1 (-CH-), 108.4 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.5 (-CH3), 33.7 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C18H21FN9S2 (M+H)+, 446.1339; found, 446.1316. 2-(5-((2-((4-Chlorobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio )-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E31), white solid, yield: 76%. HPLC purity: 99.10%. 1H NMR (400 MHz, DMSO-d6) δ 11.18 (s, 1H), 7.54 (d, J = 8.4 Hz, 2H), 7.39 (d, J = 8.4 Hz, 2H), 6.80 (s, 1H), 4.99 (t, J = 6.1 Hz, 2H), 4.51 (s, 2H), 3.68 (s, 2H), 2.82 (d, J = 15.9 Hz, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ 166.0 (-C-), 164.6 (-C-), 154.6

(-C-), 146.0 (-C-), 142.1 (-C-), 136.9 (-C-), 131.9 (-C-), 130.9 (-CH-), 128.4 (-CH-), 108.4 (-CH-), 54.2 (-CH2-), 43.2 (-CH2-), 42.5 (-CH3), 33.7 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C18H21ClN9S2 (M+H)+, 462.1044; found, 462.1015. 2-(5-((2-((4-Bromobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio )-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E32), white solid, yield: 79%. HPLC purity: 99.83%. 1H NMR (400 MHz, DMSO-d6) δ 10.95 (s, 1H), 7.61 – 7.42 (m, 4H), 6.79 (s, 1H), 4.99 (t, J = 6.2 Hz, 2H), 4.50 (s, 2H), 3.70 (s, 2H), 2.81 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz,

DMSO-d6) δ 166.0 (-C-), 164.6 (-C-), 154.5 (-C-), 146.0 (-C-), 142.1 (-C-), 137.3 (-C-), 131.3 (-C-), 131.3 (-CH-), 120.4 (-CH-), 108.3 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.5 (-CH3), 33.7 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C18H21BrN9S2 (M+H)+, 506.0539; found, 506.0510. 2-(5-((2-((2-Bromobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio 76 / 102


Page 77 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


)-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E33), white solid, yield: 65%. HPLC purity: 98.14%. 1H NMR (400 MHz, DMSO-d6) δ 10.89 (s, 1H), 7.69 (t, J = 8.5 Hz, 2H), 7.42 – 7.32 (m, 1H), 7.26 (t, J = 7.0 Hz, 1H), 6.81 (s, 1H), 4.99 (t, J = 6.1 Hz, 2H), 4.61 (s, 2H), 3.69 (s, 2H), 2.81 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ 165.8 (-C-),

164.6 (-C-), 154.6 (-C-), 146.0 (-C-), 142.1 (-C-), 136.3 (-C-), 132.8 (-C-), 131.5 (-CH-), 129.7 (-CH-), 127.9 (-CH-), 124.1 (-CH-), 108.5 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.4 (-CH3), 35.3 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C18H21BrN9S2 (M+H)+, 506.0539; found, 506.0507. 2-(5-((2-((3-Bromobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)thio )-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E34), white solid, yield: 80%. HPLC purity: 97.86%. 1H NMR (400 MHz, DMSO-d6) δ 11.26 (s, 1H), 7.74 (s, 1H), 7.53 (d, J = 7.6 Hz, 1H), 7.47 (d, J = 8.0 Hz, 1H), 7.31 (t, J = 7.8 Hz, 1H), 6.81 (s, 1H), 5.00 (t, J = 6.2 Hz, 2H), 4.52 (s, 2H), 3.71 (s, 2H), 2.81 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ

167.0 (-C-), 161.5 (-C-), 154.8 (-C-), 151.3 (-C-), 150.8 (-C-), 136.3 (-C-), 132.8 (-C-), 131.2 (-CH-), 129.7 (-CH-), 127.9 (-CH-), 124.0 (-CH-), 98.5 (-CH-), 55.9 (-CH2-), 42.6 (-CH3), 40.7 (-CH2-), 35.4 (-CH2-), 18.6 (-CH3). HRMS (ESI): m/z calcd for C18H21BrN9S2 (M+H)+, 506.0539; found, 506.0500. N,N-Dimethyl-2-(5-((5-methyl-2-((4-methylbenzyl)thio)-[1,2,4]triazolo[1,5-a]pyri midin-7-yl)thio)-1H-tetrazol-1-yl)ethan-1-amine hydrochloride (E35), white solid, yield: 74%. HPLC purity: 100.00%. 1H NMR (400 MHz, DMSO-d6) δ 11.08 (s, 1H), 77 / 102



Page 78 of 102

7.38 (d, J = 8.0 Hz, 2H), 7.14 (d, J = 7.9 Hz, 2H), 6.80 (s, 1H), 5.00 (t, J = 6.2 Hz, 2H), 4.47 (s, 2H), 3.70 (s, 2H), 2.81 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak), 2.28 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 166.3 (-C-), 164.5 (-C-), 154.6 (-C-), 146.0 (-C-), 142.0 (-C-), 136.6 (-C-), 134.3 (-C-), 129.0 (-CH-), 128.9 (-CH-), 108.4 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.5 (-CH3), 34.3 (-CH2-), 24.6 (-CH3), 20.7 (-CH3). HRMS (ESI): m/z calcd for C19H24N9S2 (M+H)+, 442.1590; found, 442.1561. N,N-Dimethyl-2-(5-((5-methyl-2-((4-(trifluoromethyl)benzyl)thio)-[1,2,4]triazolo[ 1,5-a]pyrimidin-7-yl)thio)-1H-tetrazol-1-yl)ethan-1-amine hydrochloride (E36), white solid, yield: 82%. HPLC purity: 99.59%. 1H NMR (400 MHz, DMSO-d6) δ 11.22 (s, 1H), 7.73 (m, 4H), 6.80 (s, 1H), 5.00 (s, 2H), 4.61 (s, 2H), 3.71 (s, 2H), 2.81 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz,

DMSO-d6) δ 165.8 (-C-), 164.6 (-C-), 154.6 (-C-), 145.9 (-C-), 142.9 (-C-), 142.2 (-C-), 129.8 (-C-), 128.0 (-C-), 127.7 (-C-), 125.6 (-CH-), 125.3 (-CH-), 125.2 (-CH-), 122.8 (-CH-), 108.4 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.4 (-CH3), 33.8 (-CH2-), 24.5 (-CH3). HRMS (ESI): m/z calcd for C19H21F3N9S2 (M+H)+, 496.1307; found, 496.1271. N,N-Dimethyl-2-(5-((5-methyl-2-((2-(trifluoromethyl)benzyl)thio)-[1,2,4]triazolo[ 1,5-a]pyrimidin-7-yl)thio)-1H-tetrazol-1-yl)ethan-1-amine hydrochloride (E37), white solid, yield: 85%. HPLC purity: 98.97%. 1H NMR (400 MHz, DMSO-d6) δ 10.78 (s, 1H), 7.81 (m, 2H), 7.68 (t, J = 7.3 Hz, 1H), 7.54 (t, J = 7.3 Hz, 1H), 6.82 (s, 1H), 4.98 (s, 2H), 4.71 (s, 2H), 3.69 (s, 2H), 2.81 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ 165.7 (-C-), 164.7 (-C-), 154.6 78 / 102


Page 79 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(-C-), 145.9 (-C-), 142.2 (-C-), 135.3 (-C-), 133.0 (-C-), 131.9 (-C-), 128.4 (-CH-), 126.3 (-CH-), 108.5 (-CH-), 54.1 (-CH2-), 43.2 (-CH2-), 42.5 (-CH3), 31.4 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C19H21F3N9S2 (M+H)+, 496.1307; found, 496.1295. N,N-Dimethyl-2-(5-((5-methyl-2-((3-(trifluoromethyl)benzyl)thio)-[1,2,4]triazolo[ 1,5-a]pyrimidin-7-yl)thio)-1H-tetrazol-1-yl)ethan-1-amine hydrochloride (E38), white solid, yield: 72%. HPLC purity: 99.36%. 1H NMR (400 MHz, DMSO-d6) δ 11.00 (s, 1H), 7.90 (s, 1H), 7.84 (d, J = 7.5 Hz, 1H), 7.60 (m, 2H), 6.79 (s, 1H), 4.98 (t, J = 6.2 Hz, 2H), 4.62 (s, 2H), 3.69 (s, 2H), 2.81 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ 165.9 (-C-), 164.6 (-C-),

154.6 (-C-), 145.9 (-C-), 142.2 (-C-), 139.5 (-C-), 133.3 (-C-), 129.5 (-C-), 125.5 (-CH-), 124.1 (-CH-), 122.8 (-CH-), 108.3 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.4 (-CH3), 33.8 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C19H21F3N9S2 (M+H)+, 496.1307; found, 496.1294. 2-(5-((2-((4-Methoxybenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)th io)-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E39), white solid, yield: 71%. HPLC purity: 96.85%. 1H NMR (400 MHz, DMSO-d6) δ 10.94 (s, 1H), 7.42 (d, J = 8.6 Hz, 2H), 6.89 (d, J = 8.7 Hz, 2H), 6.80 (s, 1H), 4.99 (t, J = 6.2 Hz, 2H), 4.46 (s, 2H), 3.73 (s, 3H), 3.70 (s, 2H), 2.82 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ 166.4 (-C-), 164.5 (-C-),

158.6 (-C-), 154.6 (-C-), 146.0 (-C-), 142.0 (-C-), 130.3 (-C-), 129.2 (-CH-), 113.9 (-CH-), 108.3 (-CH-), 55.1 (-CH3), 54.1 (-CH2-), 43.1 (-CH2-), 42.5 (-CH3), 34.1 79 / 102



(-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C19H24N9OS2 (M+H)+, 458.1539; found, 458.1510. 2-(5-((2-((4-Chloro-3-fluorobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin -7-yl)thio)-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E40), white solid, yield: 64%. HPLC purity: 99.85%. 1H NMR (400 MHz, DMSO-d6) δ 11.12 (s, 1H), 7.65 – 7.51 (m, 2H), 7.40 (d, J = 8.3 Hz, 1H), 6.80 (s, 1H), 4.99 (t, J = 6.0 Hz, 2H), 4.58 (d, J = 37.5 Hz, 2H), 3.77 – 3.57 (m, 2H), 2.82 (d, J = 15.7 Hz, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ

165.8 (-C-), 164.6 (-C-), 158.1 (-C-), 155.6 (-C-), 154.6 (-C-), 145.9 (-C-), 142.2 (-C-), 139.9 (-C-), 139.8 (-C-), 130.5 (-CH-), 126.4 (-CH-), 118.3 (-CH-), 117.5 (-CH-), 117.2 (-CH-), 108.4 (-CH-), 54.2 (-CH2-), 43.2 (-CH2-), 42.5 (-CH3), 33.4 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C18H20ClFN9S2 (M+H)+, 480.0950; found, 480.0923. 2-(5-((2-((3-Chloro-4-fluorobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin -7-yl)thio)-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E41), white solid, yield: 78%. HPLC purity: 99.85%. 1H NMR (400 MHz, DMSO-d6) δ 10.91 (s, 1H), 7.75 (m, 1H), 7.59 – 7.51 (m, 1H), 7.38 (t, J = 9.0 Hz, 1H), 6.79 (s, 1H), 4.98 (t, J = 6.2 Hz, 2H), 4.52 (s, 2H), 3.69 (s, 2H), 2.81 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz, DMSO-d6) δ 165.9 (-C-),

165.6 (-C-), 164.6 (-C-), 162.0 (-C-), 157.6 (-C-), 155.2 (-C-), 155.1 (-C-), 154.6 (-C-), 152.4 (-CH-), 145.9 (-CH-), 142.1 (-CH-), 137.2 (-CH-), 136.0 (-CH-), 131.0 (-CH-), 129.8 (-CH-), 129.8 (-CH-), 119.2 (-CH-), 119.0 (-CH-), 116.9 (-CH-), 116.7 (-CH-), 80 / 102


Page 80 of 102

Page 81 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


116.0 (-CH-), 108.4 (-CH-), 54.2 (-CH2-), 43.1 (-CH2-), 42.5 (-CH3), 33.1 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C18H20ClFN9S2 (M+H)+, 480.0950; found, 480.0922. 2-(5-((2-((2,6-Dichlorobenzyl)thio)-5-methyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)t hio)-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E42), white solid, yield: 64%. HPLC purity: 98.70%. 1H NMR (400 MHz, DMSO-d6) δ 10.70 (s, 1H), 7.56 (s, 2H), 7.42 (s, 1H), 6.84 (s, 1H), 4.99 (s, 2H), 4.82 (s, 2H), 3.70 (s, 2H), 2.82 (s, 6H), 2.50 (s, 3H, overlapped with DMSO-d6 peak).

13C

NMR (100 MHz,

DMSO-d6) δ 165.5 (-C-), 164.7 (-C-), 154.6 (-C-), 146.0 (-C-), 142.2 (-C-), 135.1 (-C-), 131.9 (-C-), 130.6 (-C-), 128.8 (-CH-), 124.5 (-CH-), 108.6 (-CH-), 54.1 (-CH2-), 43.1 (-CH2-), 42.4 (-CH3), 31.2 (-CH2-), 24.6 (-CH3). HRMS (ESI): m/z calcd for C18H20Cl2N9S2 (M+H)+, 496.0654; found, 496.0618. 2-(5-((2-((4-Chlorobenzyl)thio)-5,6-dimethyl-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl) thio)-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E43), white solid, yield: 88%. HPLC purity: 99.61%. 1H NMR (400 MHz, DMSO-d6) δ 11.14 (s, 1H), 7.42 (d, J = 8.5 Hz, 2H), 7.35 (d, J = 8.5 Hz, 2H), 5.13 – 4.93 (m, 2H), 4.37 (s, 2H), 3.70-3.84 (m, 2H), 2.85 (s, 6H), 2.69 (s, 3H), 2.63 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 165.2 (-C-), 164.8 (-C-), 153.3 (-C-), 149.2 (-C-), 136.6 (-C-), 134.7 (-C-), 131.9 (-CH-), 130.7 (-CH-), 128.4 (-C-), 124.7 (-C-), 53.9 (-CH2-), 43.1 (-CH2-), 42.6 (-CH3), 33.7 (-CH2-), 24.4 (-CH3), 16.0 (-CH3). HRMS (ESI): m/z calcd for C19H23ClN9S2 (M+H)+, 476.1200; found, 476.1172. 2-(5-((2-((4-Chlorobenzyl)thio)-5-methyl-6-pentyl-[1,2,4]triazolo[1,5-a]pyrimidin 81 / 102



-7-yl)thio)-1H-tetrazol-1-yl)-N,N-dimethylethan-1-amine hydrochloride (E44), white solid, yield: 82%. HPLC purity: 99.05%. 1H NMR (400 MHz, DMSO-d6) δ 7.46-7.29 (m, 4H), 5.06 (t, J = 6.6 Hz, 2H), 4.34 (s, 2H), 3.78 (s, 2H), 3.11-2.99 (m, 2H), 2.87 (s, 6H), 2.72 (s, 3H), 1.73 – 1.58 (m, 2H), 1.51 – 1.29 (m, 4H), 0.90 (t, J = 7.1 Hz, 3H). 13C NMR (100 MHz, DMSO-d6) δ 165.1 (-C-), 164.7 (-C-), 153.2 (-C-), 149.1 (-C-), 136.5 (-C-), 135.2 (-C-), 132.0 (-C-), 130.6 (-CH-), 128.4 (-C-), 128.2 (-CH-), 53.9 (-CH2-), 43.1 (-CH2-), 42.7 (-CH3), 33.7 (-CH2-), 31.2 (-CH2-), 29.4 (-CH2-), 28.8 (-CH2-), 23.7 (-CH2-), 21.8 (-CH3), 13.8 (-CH3). HRMS (ESI): m/z calcd for C23H31ClN9S2 (M+H)+, 532.1826; found, 532.1788. Molecular docking. All the molecular docking study, including protein preparation, ligand preparation and docking simulation, was performed using MOE 2015.10. The crystal structure of a small molecular inhibitor DI-591 binding to DCN1 (PDB code: 5UFI) was prepared by default parameters using QuickPrep module and the protonation states of the ionizable residues were adjusted at pKa = 7. DI-591 was first re-docked into the protein to investigate the reliability of our docking simulation using the Dock module. The three-dimensional structures of E1, WS-383 and WS-524 were generated by taking energy minimization and conformational search. Then compound E1, WS-383 and WS-524 were docked into the binding pocket of DCN1. After the docking simulations, the 20 best-scored ligand−protein complexes of each ligands were kept for further analyses. Molecular dynamics simulations. Molecular dynamics simulations study was performed using Gromacs 5.1.4. Docking results of WS-383 and WS-524 and crystal 82 / 102


Page 82 of 102

Page 83 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


structure of DI-591 in complex with DCN1 were regarded as the starting structures. The Amber99SB-ildn force field and gaff force field were employed for the proteins and the three ligands, respectively. The electrostatic potentials (ESP) of each compound was computed at the HF/6-31G(d) level in the Gaussian 09 program, and the partial atomic charges for these compounds were generated using the RESP protocol. During the preparation of the protein structure for simulation, the protonation state of the protein and ligands were determined using the PROPKA 3.1. The complex was placed in the center of a cubic periodic box and solvated by the addition of TIP3P water molecules. The net charge on the system was then neutralized by adding 0.15 mol/L of NaCl as counter ions. The energy was minimized using the steepest descent algorithm. The system was then heated to 300 K during 500 ps in NVT ensemble. The pressure was then equilibrated to 1 atm during a 500 ps NPT simulation. In both simulations, all heavy atoms were position restrained with the force constant of 1000 kJ/(mol•nm2). Production simulations were performed for 20 ns for each complex and the temperature and pressure were maintained at 300 K and 1 atm. Then the binding free energy was calculated using MM-PBSA method with g_mmpbsa. Constructs, protein expression and purification. Full length of DCN1 was cloned into the expression vector pGEX-4T-1. Then the vector was transformed into E.coli. BL21(DE3). Cells were cultured at 37 oC, and the protein was induced with isopropyl-β-D-thiogalactoside (IPTG) at a final concentration of 0.5 mM at 20 oC for 16h. Cells were collected by centrifugation and re-suspended in the binding buffer 83 / 102



(140 mM NaCl, 2.7 mM KCl, 10mM Na2HPO4, 1.8 mM KH2PO4, pH 7.3). After sonication and centrifuge, the cleared lysate was subjected to purification with GSH-Sepharose beads (GE, USA). The beads were washed with binding buffer and the recombinant was eluted and collected with elution buffer (50mM Tris-HCl, 10 mM reduced glutathione, pH 8.0). Then the recombinant was concentrated with 10 KDa molecular cutoff filter. The concentrated recombinant was then quantified with BCA assay and stored at -80 oC. The Ac-UBC121-12 peptide corresponding to N-terminally acetylated residues 1-12 of human UBC12 with an additional C-terminal biotin was synthesized by Shenggong biological technology. HTRF assay. HTRF assays were carried out in white 384-well microliter plates at a final volume of 20 µL per well. In the screening, the assay cocktail was prepared as a mixture of 30 nM GST-DCN1, 2.84 µM Ac-UBC12-biotin, 0.125µg/ml Anti-GST-Cryptate (Cisbio, France) and 2.5 µg/mL Streptavidin-d2(Cisbio, France) in assay buffer (50 mM HEPES, 50mM NaCl, 400 mM KF, 0.1% BSA, 0.1% Tween 20, pH 6.0). The assay cocktail was incubated for 1h at 25˚C and compound to be screened was added from DMSO stock solutions. The assay mixture was incubated for another 1h at 25˚C and then read plate with Envision microplate reader (PerkinElmer, USA) equipped with HTRF modules for excitation at 314nm and emission at 615 and 665nm. The 665/615 ratio was used as the HTRF signal in calculations.

To avoid interference of false positive compounds, PAINS screening

of the synthesized compounds was carried out by employing the online program ("PAINS-Remover", http://www.cbligand.org/PAINS/), and all the tested compounds 84 / 102


Page 84 of 102

Page 85 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


passed the filter. Reversible assay. For the dilution assay, around 40-fold IC50 of the tested compounds or DMSO as control were incubated with DCN1 for 1 h in HTRF assay buffer. Then the mixer was diluted for 80 folds with HTRF assay buffer in order to have the same component as HTRF assay. After that, 2.84 µM Ac-UBC12-biotin, 0.125 µg/mL Anti-GST-Cryptate (Cisbio, France) and 2.5 µg/mL Streptavidin-d2(Cisbio, France) were added, assay buffer was added to the mixture either to have the final volume as 20 μL for following HTRF assay. This represents an 80-fold dilution of the inhibitor concentration, which is expected to yield the same inhibition rate for an irreversible inhibitor or significant difference for a reversible inhibitor. For the ultrafiltration experiment, around 40-fold IC50 of the tested compounds or DMSO as control were incubated with DCN1 for 1 h in HTRF assay buffer. Then the mixer was subject to 5 KDa cut-off ultrafiltration tube (Millipore, USA). After six round centrifuge at 10k rpm for 20min, 2.84 µM Ac-UBC12-biotin, 0.125 µg/mL Anti-GST-Cryptate (Cisbio, France) and 2.5 µg/mL Streptavidin-d2 (Cisbio, France) were added, assay buffer was added to the mixture either to have the final volume as 20 μL for following HTRF assay. This represents a compound clean wash step for ultrafiltration, which is expected to yield the same inhibition rate for an irreversible inhibitor or significant difference for a reversible inhibitor. BTK enzyme assay. BTK was purchased from Carna Biosciences. The kinases (5 nM) were assayed with test compound in a final volume of 5 μL, 3 μM peptide2 (5-FAM-EAIYAAPFAKKK), 90 μM ATP, and reaction buffer (50 mM HEPES, pH 85 / 102



Page 86 of 102

7.5, 0.0015% Brij-35, 10 mM MgCl2, 2 mM DTT). After incubation at 28 oC for 60 min, the reactions were stopped by adding 25 μL stop buffer (100 mM HEPES, pH 7.5, 0.015% Brij-35, 50 mM EDTA). The reaction mixture was analyzed on Caliper, and the conversion values were converted to inhibition values. EGFR L858R enzyme assay. EGFR L858R was purchased from Carna Biosciences. The kinase (2.5 nM) was assayed with the test compound in a final volume of 5 μL, 3 μM kinase peptide22 (5-FAM-EEPLYWSFPAKKK-CONH2), 80.8 μM ATP, and reaction buffer (50 mM HEPES, 0.01% Triton X-100, 10 mM MgCl2, 2 mM DTT). After incubate at RT for 30min, the reactions were stopped by adding 25 μL stop buffer (100 mM HEPES, 0.015% Brij-35, 50 mM EDTA). The reaction mixture was analyzed with Caliper EZ Reader, and the conversion values were converted to inhibition. CDKs enzyme assay. CDK1/cyclinB, CDK2/CycA2, CDK7/cyclinH/MAT1 and CDK9/cyclinT1 kinase were purchased from Millipore, and CDK4/CycD3, CDK6/cycD3 were purchased from Carna. The kinases were assayed with 3 μM peptide8

(5-FAM-IPTSPITTTYFFFKKK-COOH for CDK4 and CDK6), peptide18

(5-FAM-QSPKKG-CONH2

for

CDK1

and

CDK2),

peptide

CTD3

(5-FAM-ACSYSPTSPSYSPTSPSYSPTSPSKK for CDK7 and CDK9) in the 20/30/280/800/77/10 μM ATP (for CDK1/CDK2/CDK4/CDK6/CDK7CDK9), and of the test compounds in a final volume of 5 μL, and the reaction buffer (50 mM HEPES, pH 7.5, 0.0015% Brij-35, 10 mM MgCl2, 2 mM DTT). After incubation at 28 oC for 60 min, the reactions were stopped by adding 25 μL stop buffer (100 mM HEPES, pH 86 / 102


Page 87 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


7.5, 0.015% Brij-35, 50 mM EDTA). The reaction mixture was analyzed on Caliper, and the conversion values were converted to inhibition values. Cellular thermal shift assay. Cells (5 × 105) were treated with a compound or with DMSO for 1 h, washed with PBS three times, and dissolved in 50 μL PBS supplemented with a protease inhibitor cocktail, followed by heating at the indicated temperatures in a PCR instrument (Senso, Germany). Treated cells were then subjected to snap-freezing in liquid nitrogen and thawed on ice for 3 cycles. The protein levels of DCN1 in equal amounts of the supernatant were examined by western blotting assay. GAPDH was used as the control. Results are representative of three independent experiments. Cell lines and chemicals. Human gastric epithelial cell line GES-1 and gastric cancer cell line MGC-803 were cultured in DMEM medium (BI, Israel), SGC-7901, HGC-27, BGC-823, and KYSE70 cells were cultured in RPMI 1640 medium (BI, Israel), supplemented with 10% fetal bovine serum and incubated at 5% CO2 incubator (Thermo, USA) at 37 oC. RT-qPCR. Total RNA from cells was purified using Ultrapure RNA Extraction kit (CWBIO, China) with the aid of DNase I (NEB, USA) to remove the possible DNA contamination, and cDNA was obtained using HiFi-MMLV cDNA Kit (CWBIO, China). qPCR analysis was conducted using a LightCycler 96 Real-Time PCR System (Roche, USA). Primers for UBC12: F, 5’ - AGCCAGTCCTTACGATAAACTCC 3’; R, 5’ - TGCACGTTCTGCTCAAACAGCC - 3’. Primers for DCN1: F, 5’ TTGCGTGGAAGTTCAGAGCAGC

-

3’;

87 / 102


R,

5’

–


GTTCCATCTTGGGTATCTGGGC

-

3’.

GTCTCCTCTGACTTCAACAGCG

Primers

-

Page 88 of 102

for

3’;

GAPDH: R,

F, 5’

5’

– –

ACCACCCTGTTGCTGTAGCCAA - 3’. Western blotting. Cells were seeded into 6-well plates and incubated with different concentrations of candidate compounds for 24 h. Then cells were collected and the total protein was collected with RIPA in the presence of complete protease inhibitor cocktail (Roche, USA). Cell lysates were quantified with BCA kit (Beyotime Biotechnology, China) and denatured with protein loading buffer in 100 oC water for 10 minutes. 30 μg of the denatured samples were subjected to SDS-PAGE (acrylamide 5% for stacking gel and 8% for separating gel), and transferred to NC (Nitrocellulose) membranes (Millipore, USA) and incubated with the primary antibodies overnight at 4 oC. The membranes were washed with PBST for 3 times, 5 minutes per time. Then membranes were incubated with suitable HRP-conjugated second antibodies. For exposure, ECL western blotting substrate from ThermoFisher was used. Imaging was done with an X-ray film (Koda, Japan). The sources of primary antibodies were as follows: Cullin1 (Abcam, ab75817), Cullin2 (Abcam, ab166917), Cullin3 (Abcam, ab75851), Cullin4a (Abcam, ab92554), Cullin4b (Proteintech, 12916-1-AP), Cullin5 (Abcam, ab184177), UBC12 (Abcam, ab109507), p21 (Cell Signaling Technology, #2947), p27 (Cell Signaling Technology, #3686), NRF2

(Cell

Signaling

Technology,

#4399),

DCN1

(GenWay

Biotech,

GWB-E3D700). Intracellular ROS assay. Intracellular reactive oxygen species (ROS) was measured 88 / 102


Page 89 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


by DCFH-DA (Beyotime), according to the manual operation. Briefly, cells were digested and washed twice by serum-free medium, loaded with 1 µM of 2', 7'-dichlorofluorescein diacetate (DCFH-DA). The cells were then incubated at 37 ℃ for 30 min. The cells were then washed twice with serum-free medium and suspended in PBS. Ten thousand cells were collected and analyzed at 488 nm excitation and 525 nm emission wavelength by a flow cytometer (FACSCalibur, BD). Statistical analysis. Data were expressed as mean ± SD. Statistical differences in two groups were performed by student's t-test and One-way analysis of variance was used for a multiple-group comparison. P value < 0.05 or less were considered statistically significant. 

AUTHOR INFORMATION

Corresponding Author *Hong-Min Liu, Phone: +86-0371-67781908. Fax: +86-0371-67781908. E-mail: [email protected] *Shaomeng

Wang,

Phone:

734-615-0362.

Fax:

734-764-2532.

E-mail:

[email protected]. * Bin Yu, Phone: +86-0371-67781908. Fax: +86-0371-67781908. E-mail: [email protected]

* Yi-Chao Zheng, Phone: +86-0371-67781908. Fax: +86-0371-67781908. E-mail: [email protected] ORCID Bin Yu: 0000-0002-0531-2236 89 / 102



Yi-Chao Zheng: 0000-0002-2662-3770 Shaomeng Wang: 0000-0002-8782-6950 Hong-Min Liu: 0000-0001-6771-9421 Author Contributions ɸ S. W., L. Z., X. S., and L. D. contributed equally. Notes The authors declare no competing financial interest. 

ACKNOWLEDGMENTS

This work was supported by the National Key R&D Program of China (No. 2016YFA0501800); National Natural Science Foundation of China (Nos. 81430085, 81773562, 81703326, 81602961); China Postdoctoral Science Foundation (No. 2018M630840); the open fund of state key laboratory of Pharmaceutical Biotechnology, Nan-jing University, China (Grant no. KF-GN-201902); Key Research Program of Henan Province (Nos. 161100310100, 182102310123); Outstanding Young Talent Research Fund of Zhengzhou University (No. 1521331002); Key Scientific Research Project for Higher Education by Department of Education of Henan Educational Committee (Nos. 15A350018, 18B350009); the Starting Grant of Zhengzhou University (No. 32210533), and International training of high-level talents in Henan (2017) from Henan Administration of Foreign Experts Affairs. 

ABBREVIATIONS USED

DCN1, defective in cullin neddylation protein 1; UBC12, ubiquitin-conjugating 90 / 102


Page 90 of 102

Page 91 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


enzyme E2M; Cul, cullin; NEDD8, neural precursor cell expressed developmentally down-regulated protein 8; NAE, NEDD8 activating enzyme; NRF2, nuclear factor erythroid 2-related factor 2; BTK, Bruton's tyrosine kinase; CDK, cyclin-dependent kinase; p21, cyclin-dependent kinase inhibitor 1; p27, cyclin-dependent kinase inhibitor 1B; HTRF, homogeneous time resolved fluorescence; SCC, squamous cell carcinoma; NC, nitrocellulose; CMC-Na, sodium carboxymethyl cellulose; SD, standard deviation; FBS, fetal bovine serum; E.Coli, Escherichia coli; SKP1, S-phase kinase associated protein 1; RBX1, RING-box protein 1; RBX2, RING-box protein 2; SCF complex, Skp, Cullin, F-box containing complex; CDK, cyclin-dependent kinase; AP2, activator protein 2; MMP2, matrix metalloproteinase 2; SARs, structure-activity relationships. CETSA, cellular thermal shift assay; TLC, Thin-layer chromatography; TMS, tetramethylsilane; HRMS, high-resolution mass spectra; HPLC, High-performance liquid chromatography. 

ASSOCIATED CONTENT

Supporting Information. Molecular formula strings (CSV), NMR, HRMS, and HPLC spectra of representative compounds, some biochemical data, and coordinates of modeled structure of related compounds in complex with DCN1. Authors will release the atomic coordinates upon article publication. The Supporting Information is available free of charge on the ACS Publications website at DOI: XXXX. Coordinates of modeled strctures of compound E1 in complex with DCN1 (PDB code: 5UFI) Coordinates of modeled strctures of compound DI-591 in complex with DCN1 91 / 102



Page 92 of 102

after molecular dynamics simulations (PDB code: 5UFI) Coordinates of modeled strctures of compound WS-383 in complex with DCN1

(PDB code: 5UFI)

Coordinates of modeled strctures of compound WS-383 in complex with DCN1 after molecular dynamics simulations (PDB code: 5UFI) Coordinates of modeled strctures of compound WS-524 in complex with DCN1 (PDB code: 5UFI) Coordinates of modeled strctures of compound WS-524 in complex with DCN1 after molecular dynamics simulations (PDB code: 5UFI) 

REFERENCES

1.

Petroski, M. D.; Deshaies, R. J. Function and regulation of cullin–RING ubiquitin

ligases. Nature Reviews Molecular Cell Biology 2005, 6, 9-20. 2.

Zhao, Y.; Sun, Y. Cullin-RING ligases as attractive anti-cancer targets. Current

Pharmaceutical Design 2013, 19, 3215-3225. 3.

Andérica-Romero,

A.

C.;

González-Herrera,

I.

G.;

Santamaría,

A.;

Pedraza-Chaverri, J. Cullin 3 as a novel target in diverse pathologies. Redox Biology 2013, 1, 366-372. 4.

Hori, T.; Osaka, F.; Chiba, T.; Miyamoto, C.; Okabayashi, K.; Shimbara, N.;

Kato, S.; Tanaka, K. Covalent modification of all members of human cullin family proteins by NEDD8. Oncogene 1999, 18, 6829-6834. 5.

Enchev, R. I.; Schulman, B. A.; Peter, M. Protein neddylation: beyond cullin–

RING ligases. Nature Reviews Molecular Cell Biology 2014, 16, 30-44. 92 / 102


Page 93 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


6.

Deshaies, R. J.; Emberley, E. D.; Saha, A. Control of cullin-ring ubiquitin ligase

activity by nedd8. Subcellular Biochemistry 2010, 54, 41-56. 7.

Zhao, Y.; Morgan, M. A.; Sun, Y. Targeting neddylation pathways to inactivate

cullin-RING ligases for anticancer therapy. Antioxidants & Redox Signaling 2014, 21, 2383-2400. 8.

Bulatov, E.; Ciulli, A. Targeting cullin-RING E3 ubiquitin ligases for drug

discovery: structure, assembly and small-molecule modulation. Biochemical Journal 2015, 467, 365-386. 9.

Tanaka, T.; Nakatani, T.; Kamitani, T. Inhibition of nedd8-conjugation pathway

by novel molecules: potential approaches to anticancer therapy. Molecular Oncology 2012, 6, 267-275. 10. Soucy, T. A.; Smith, P. G.; Rolfe, M. Targeting nedd8-activated cullin-RING ligases for the treatment of cancer. Clinical Cancer Research 2009, 15, 3912-3916. 11. Zhong, H.-J.; Yang, H.; Chan, D. S.-H.; Leung, C.-H.; Wang, H.-M.; Ma, D.-L. A metal-based inhibitor of nedd8-activating enzyme. PLoS ONE 2012, 7, e49574. 12. Leung, C.-H.; Chan, D. S.-H.; Yang, H.; Abagyan, R.; Lee, S. M.-Y.; Zhu, G.-Y.; Fong, W.-F.; Ma, D.-L. A natural product-like inhibitor of nedd8-activating enzyme. Chemical Communications 2011, 47, 2511-2513. 13. Lu, P.; Liu, X.; Yuan, X.; He, M.; Wang, Y.; Zhang, Q.; Ouyang, P.-k. Discovery of a novel Nedd8 activating enzyme inhibitor with piperidin-4-amine scaffold by structure-based virtual screening. ACS Chemical Biology 2016, 11, 1901-1907. 14. Zhong, H.-J.; Wang, W.; Kang, T.-S.; Yan, H.; Yang, Y.; Xu, L.; Wang, Y.; Ma, 93 / 102



D.-L.; Leung, C.-H. A rhodium(iii) complex as an inhibitor of neural precursor cell expressed, developmentally down-regulated 8-activating enzyme with in vivo activity against inflammatory bowel disease. Journal of Medicinal Chemistry 2017, 60, 497-503. 15. Schlierf, A.; Altmann, E.; Quancard, J.; Jefferson, A. B.; Assenberg, R.; Renatus, M.; Jones, M.; Hassiepen, U.; Schaefer, M.; Kiffe, M.; Weiss, A.; Wiesmann, C.; Sedrani, R.; Eder, J.; Martoglio, B. Targeted inhibition of the COP9 signalosome for treatment of cancer. Nature Communications 2016, 7, 13166. 16. Zhong, H.-J.; Pui-Yan Ma, V.; Cheng, Z.; Shiu-Hin Chan, D.; He, H.-Z.; Leung, K.-H.; Ma, D.-L.; Leung, C.-H. Discovery of a natural product inhibitor targeting protein neddylation by structure-based virtual screening. Biochimie 2012, 94, 2457-2460. 17. Zhang, S.; Tan, J.; Lai, Z.; Li, Y.; Pang, J.; Xiao, J.; Huang, Z.; Zhang, Y.; Ji, H.; Lai, Y. Effective virtual screening strategy toward covalent ligands: identification of novel nedd8-activating enzyme inhibitors. Journal of Chemical Information and Modeling 2014, 54, 1785-1797. 18. Soucy, T. A.; Smith, P. G.; Milhollen, M. A.; Berger, A. J.; Gavin, J. M.; Adhikari, S.; Brownell, J. E.; Burke, K. E.; Cardin, D. P.; Critchley, S.; Cullis, C. A.; Doucette, A.; Garnsey, J. J.; Gaulin, J. L.; Gershman, R. E.; Lublinsky, A. R.; McDonald, A.; Mizutani, H.; Narayanan, U.; Olhava, E. J.; Peluso, S.; Rezaei, M.; Sintchak, M. D.; Talreja, T.; Thomas, M. P.; Traore, T.; Vyskocil, S.; Weatherhead, G. S.; Yu, J.; Zhang, J.; Dick, L. R.; Claiborne, C. F.; Rolfe, M.; Bolen, J. B.; 94 / 102


Page 94 of 102

Page 95 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Langston, S. P. An inhibitor of nedd8-activating enzyme as a new approach to treat cancer. Nature 2009, 458, 732-736. 19. Bhatia, S.; Pavlick, A. C.; Boasberg, P.; Thompson, J. A.; Mulligan, G.; Pickard, M. D.; Faessel, H.; Dezube, B. J.; Hamid, O. A phase I study of the investigational NEDD8-activating enzyme inhibitor pevonedistat (TAK-924/MLN4924) in patients with metastatic melanoma. Investigational New Drugs 2016, 34, 439-449. 20. Monda, Julie K.; Scott, Daniel C.; Miller, Darcie J.; Lydeard, J.; King, D.; Harper, J. W.; Bennett, Eric J.; Schulman, Brenda A. Structural conservation of distinctive N-terminal acetylation-dependent interactions across a family of mammalian nedd8 ligation enzymes. Structure 2013, 21, 42-53. 21. Sarkaria, I.; O-charoenrat P Fau - Talbot, S. G.; Talbot Sg Fau - Reddy, P. G.; Reddy Pg Fau - Ngai, I.; Ngai I Fau - Maghami, E.; Maghami E Fau - Patel, K. N.; Patel Kn Fau - Lee, B.; Lee B Fau - Yonekawa, Y.; Yonekawa Y Fau - Dudas, M.; Dudas M Fau - Kaufman, A.; Kaufman A Fau - Ryan, R.; Ryan R Fau - Ghossein, R.; Ghossein R Fau - Rao, P. H.; Rao Ph Fau - Stoffel, A.; Stoffel A Fau - Ramanathan, Y.; Ramanathan Y Fau - Singh, B.; Singh, B. Squamous cell carcinoma related oncogene/DCUN1D1 is highly conserved and activated by amplification in squamous cell carcinomas. Cancer Research 2006, 66, 9437-9444. 22. Estilo, C. L.; O-charoenrat, P.; Ngai, I.; Patel, S. G.; Reddy, P. G.; Dao, S.; Shaha, A. R.; Kraus, D. H.; Boyle, J. O.; Wong, R. J.; Pfister, D. G.; Huryn, J. M.; Zlotolow, I. M.; Shah, J. P.; Singh, B. The role of novel oncogenes squamous cell carcinoma-related oncogene and phosphatidylinositol 3-kinase p110α in squamous 95 / 102



cell carcinoma of the oral tongue. Clinical Cancer Research 2003, 9, 2300-2306. 23. Broderick, S. R.; Golas Bj Fau - Pham, D.; Pham D Fau - Towe, C. W.; Towe Cw Fau - Talbot, S. G.; Talbot Sg Fau - Kaufman, A.; Kaufman A Fau - Bains, S.; Bains S Fau - Huryn, L. A.; Huryn La Fau - Yonekawa, Y.; Yonekawa Y Fau - Carlson, D.; Carlson D Fau - Hambardzumyan, D.; Hambardzumyan D Fau - Ramanathan, Y.; Ramanathan Y Fau - Singh, B.; Singh, B. SCCRO promotes glioma formation and malignant progression in mice. Neoplasia 2010, 12, 476-484. 24. Yoo, J.; Lee Sh Fau - Lym, K.-I.; Lym Ki Fau - Park, S. Y.; Park Sy Fau - Yang, S.-H.; Yang Sh Fau - Yoo, C.-Y.; Yoo Cy Fau - Jung, J.-H.; Jung Jh Fau - Kang, S.-J.; Kang Sj Fau - Kang, C.-S.; Kang, C. S. Immunohistochemical expression of DCUN1D1 in non-small cell lung carcinoma: its relation to brain metastasis. Cancer Research and Treatment 2012, 44, 57-62. 25. Scott, D. C.; Hammill, J. T.; Min, J.; Rhee, D. Y.; Connelly, M.; Sviderskiy, V. O.; Bhasin, D.; Chen, Y.; Ong, S.-S.; Chai, S. C.; Goktug, A. N.; Huang, G.; Monda, J. K.; Low, J.; Kim, H. S.; Paulo, J. A.; Cannon, J. R.; Shelat, A. A.; Chen, T.; Kelsall, I. R.; Alpi, A. F.; Pagala, V.; Wang, X.; Peng, J.; Singh, B.; Harper, J. W.; Schulman, B. A.; Guy, R. K. Blocking an N-terminal acetylation–dependent protein interaction inhibits an E3 ligase. Nature Chemical Biology 2017, 13, 850-857. 26. Kurz, T.; Chou, Y. C.; Willems, A. R.; Meyer-Schaller, N.; Hecht, M. L.; Tyers, M.; Peter, M.; Sicheri, F. Dcn1 functions as a scaffold-type E3 ligase for cullin neddylation. Molecular Cell 2008, 29, 23-35. 27. Scott, D. C.; Monda, J. K.; Bennett, E. J.; Harper, J. W.; Schulman, B. A. 96 / 102


Page 96 of 102

Page 97 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


N-terminal acetylation acts as an avidity enhancer within an interconnected multiprotein complex. Science 2011, 334, 674-678. 28. Scott, D. C.; Sviderskiy, V. O.; Monda, J. K.; Lydeard, J. R.; Cho, S. E.; Harper, J. W.; Schulman, B. A. Structure of a RING E3 trapped in action reveals ligation mechanism for the ubiquitin-like protein NEDD8. Cell 2014, 157, 1671-1684. 29. Kurz, T.; Ozlu, N.; Rudolf, F.; O'Rourke, S. M.; Luke, B.; Hofmann, K.; Hyman, A. A.; Bowerman, B.; Peter, M. The conserved protein DCN-1/Dcn1p is required for cullin neddylation in C. elegans and S. cerevisiae. Nature 2005, 435, 1257-1261. 30. Zhou, H.; Lu, J.; Liu, L.; Bernard, D.; Yang, C.-Y.; Fernandez-Salas, E.; Chinnaswamy, K.; Layton, S.; Stuckey, J.; Yu, Q.; Zhou, W.; Pan, Z.; Sun, Y.; Wang, S. A potent small-molecule inhibitor of the DCN1-UBC12 interaction that selectively blocks cullin 3 neddylation. Nature Communications 2017, 8, 1150. 31. Hammill, J. T.; Scott, D. C.; Min, J.; Connelly, M. C.; Holbrook, G.; Zhu, F.; Matheny, A.; Yang, L.; Singh, B.; Schulman, B. A.; Guy, R. K. Piperidinyl ureas chemically control defective in cullin neddylation 1 (DCN1)-mediated cullin neddylation. Journal of Medicinal Chemistry 2018, 61, 2680-2693. 32. Scott, Daniel C.; Sviderskiy, Vladislav O.; Monda, Julie K.; Lydeard, John R.; Cho, Shein E.; Harper, J. W.; Schulman, Brenda A. Structure of a ring E3 trapped in action reveals ligation mechanism for the ubiquitin-like protein Nedd8. Cell 2014, 157, 1671-1684. 33. Scott, D. C.; Monda, J. K.; Bennett, E. J.; Harper, J. W.; Schulman, B. A. N-terminal acetylation acts as an avidity enhancer within an interconnected 97 / 102



Page 98 of 102

multiprotein complex. Science 2011, 334, 674-678. 34. Hammill, J. T.; Bhasin, D.; Scott, D. C.; Min, J.; Chen, Y.; Lu, Y.; Yang, L.; Kim, H. S.; Connelly, M. C.; Hammill, C.; Holbrook, G.; Jeffries, C.; Singh, B.; Schulman, B. A.; Guy, R. K. Discovery of an orally bioavailable inhibitor of defective in cullin neddylation 1 (DCN1)-mediated cullin neddylation. Journal of Medicinal Chemistry 2018, 61, 2694-2706. 35. Zhou, H.; Zhou, W.; Zhou, B.; Liu, L.; Chern, T.-R.; Chinnaswamy, K.; Lu, J.; Bernard, D.; Yang, C.-Y.; Li, S.; Wang, M.; Stuckey, J.; Sun, Y.; Wang, S. High-Affinity Peptidomimetic inhibitors of the DCN1-UBC12 protein–protein interaction. Journal of Medicinal Chemistry 2018, 61, 1934-1950. 36. Chen, H.-Y.; Chen, R.-H. Cullin 3 ubiquitin ligases in cancer biology: functions and therapeutic implications. Frontiers in Oncology 2016, 6, 113. 37. Cheng, J.; Guo, J.; Wang, Z.; North, B. J.; Tao, K.; Dai, X.; Wei, W. Functional analysis of cullin 3 E3 ligases in tumorigenesis. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 2018, 1869, 11-28. 38. Kumari, R.; Kumar, R.; Lynn, A. g_mmpbsa - a GROMACS tool for high-throughput MM-PBSA calculations. Journal of Chemical Information and Modeling 2014, 54, 1951-1962. 39. Wu, P.; Nielsen, T. E.; Clausen, M. H. Small-molecule kinase inhibitors: an analysis of FDA-approved drugs. Drug Discovery Today 2016, 21, 5-10. 40. Sun, Q.-A.; Hess, D. T.; Wang, B.; Miyagi, M.; Stamler, J. S. Off-target thiol alkylation

by

the

NADPH 98 / 102


oxidase

inhibitor

Page 99 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3-benzyl-7-(2-benzoxazolyl)thio-1,2,3-triazolo[4,5-d]pyrimidine (VAS2870). Free Radical Biology and Medicine 2012, 52, 1897-1902. 41. Singh, B.; Stoffel, A.; Gogineni, S.; Poluri, A.; Pfister, D. G.; Shaha, A. R.; Pathak, A.; Bosl, G.; Cordon-Cardo, C.; Shah, J. P.; Rao, P. H. Amplification of the 3q26.3 locus is associated with progression to invasive cancer and is a negative prognostic factor in head and neck squamous cell carcinomas. American Journal of Pathology 2002, 161, 365-371. 42. Heselmeyer, K.; Macville, M.; Schrock, E.; Blegen, H.; Hellstrom, A. C.; Shah, K.; Auer, G.; Ried, T. Advanced-stage cervical carcinomas are defined by a recurrent pattern of chromosomal aberrations revealing high genetic instability and a consistent gain of chromosome arm 3q. Genes Chromosomes Cancer 1997, 19, 233-240. 43. Petersen, I.; Bujard, M.; Petersen, S.; Wolf, G.; Goeze, A.; Schwendel, A.; Langreck, H.; Gellert, K.; Reichel, M.; Just, K.; du Manoir, S.; Cremer, T.; Dietel, M.; Ried, T. Patterns of chromosomal imbalances in adenocarcinoma and squamous cell carcinoma of the lung. Cancer Research 1997, 57, 2331-2335. 44. Zhang, Z. H.; Li, J.; Luo, F.; Wang, Y. S. Clinical significance of SCCRO (DCUN1D1) in prostate cancer and its proliferation-inhibiting effect on Lncap cells. European Review for Medical and Pharmacological Sciences 2017, 21, 4283-4291. 45. Wu, K.; Yan, H.; Fang, L.; Wang, X.; Pfleger, C.; Jiang, X.; Huang, L.; Pan, Z. Q. Mono-ubiquitination drives nuclear export of the human DCN1-like protein hDCNL1. Journal of Biological Chemistry 2011, 286, 34060-34070. 46. Soucy, T. A.; Smith, P. G.; Milhollen, M. A.; Berger, A. J.; Gavin, J. M.; 99 / 102



Adhikari, S.; Brownell, J. E.; Burke, K. E.; Cardin, D. P.; Critchley, S.; Cullis, C. A.; Doucette, A.; Garnsey, J. J.; Gaulin, J. L.; Gershman, R. E.; Lublinsky, A. R.; McDonald, A.; Mizutani, H.; Narayanan, U.; Olhava, E. J.; Peluso, S.; Rezaei, M.; Sintchak, M. D.; Talreja, T.; Thomas, M. P.; Traore, T.; Vyskocil, S.; Weatherhead, G. S.; Yu, J.; Zhang, J.; Dick, L. R.; Claiborne, C. F.; Rolfe, M.; Bolen, J. B.; Langston, S. P. An inhibitor of nedd8-activating enzyme as a new approach to treat cancer. Nature 2009, 458, 732-736. 47. Tong, S.; Si, Y.; Yu, H.; Zhang, L.; Xie, P.; Jiang, W. MLN4924 (Pevonedistat), a protein neddylation inhibitor, suppresses proliferation and migration of human clear cell renal cell carcinoma. Scientific Reports 2017, 7, 5599. 48. Zhang, Y.; Shi, C. C.; Zhang, H. P.; Li, G. Q.; Li, S. S. MLN4924 suppresses neddylation and induces cell cycle arrest, senescence, and apoptosis in human osteosarcoma. Oncotarget 2016, 7, 45263-45274. 49. Tsvetkov, L. M.; Yeh, K. H.; Lee, S. J.; Sun, H.; Zhang, H. p27(Kip1) ubiquitination and degradation is regulated by the SCF(Skp2) complex through phosphorylated Thr187 in p27. Current Biology 1999, 9, 661-664. 50. Carrano, A. C.; Eytan, E.; Hershko, A.; Pagano, M. SKP2 is required for ubiquitin-mediated degradation of the CDK inhibitor p27. Nature Cell Biology 1999, 1, 193-199. 51. Morimoto, M.; Nishida, T.; Honda, R.; Yasuda, H. Modification of cullin-1 by ubiquitin-like protein nedd8 enhances the activity of SCF(skp2) toward p27(kip1). Biochemical and Biophysical Research Communications 2000, 270, 1093-1096. 100 / 102


Page 100 of 102

Page 101 of 102 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


52. Yan,

Y.;

Zhang,

X.;

Legerski,

R.

J.

Artemis

interacts

with

the

Cul4A-DDB1DDB2 ubiquitin E3 ligase and regulates degradation of the CDK inhibitor p27. Cell Cycle 2011, 10, 4098-4109. 53. Abbas, T.; Sivaprasad, U.; Terai, K.; Amador, V.; Pagano, M.; Dutta, A. PCNA-dependent regulation of p21 ubiquitylation and degradation via the CRL4Cdt2 ubiquitin ligase complex. Genes & Development 2008, 22, 2496-2506. 54. Cullinan, S. B.; Gordan, J. D.; Jin, J.; Harper, J. W.; Diehl, J. A. The Keap1-BTB protein is an adaptor that bridges Nrf2 to a Cul3-based E3 ligase: oxidative stress sensing by a Cul3-Keap1 ligase. Molecular and Cellular Biology 2004, 24, 8477-8486. 55. Zhao, Y.; Sun, Y. Cullin-RING ligases as attractive anti-cancer targets. Current Pharmaceutical Design 2013, 19, 3215-3225. 56. Niture, S. K.; Kaspar, J. W.; Shen, J.; Jaiswal, A. K. Nrf2 signaling and cell survival. Toxicology and Applied Pharmacology 2010, 244, 37-42. 57. Wang, S.; Zhao, L.-J.; Zheng, Y.-C.; Shen, D.-D.; Miao, E.-F.; Qiao, X.-P.; Zhao, L.-J.; Liu, Y.; Huang, R.; Yu, B.; Liu, H.-M. Design, synthesis and biological evaluation of [1,2,4]triazolo[1,5-a]pyrimidines as potent lysine specific demethylase 1 (LSD1/KDM1A) inhibitors. European Journal of Medicinal Chemistry 2017, 125, 940-951.

101 / 102



Table of Contents Graphic

102 / 102


Page 102 of 102

The Development of Highly Potent, Selective, and Cellular Active

Recommend Documents