The Role of Translationally Controlled Tumor Protein in Tumor Growth and Metastasis of Colon Adenocarcinoma Cells Qiang Ma,† Yan Geng,‡ Weiwen Xu,† Yingsong Wu,† Fuli He,§ Wen Shu,† Maoliang Huang,¶ Hongyan Du,† and Ming Li*,† The Institute of Antibody Engineering, School of Biotechnology, Southern Medical University, Guangzhou 510515, China, Department of Digestive Diseases, the No. 303 Hospital of PLA, Nanning 530021, China, Oncology Center, Zhujiang Hospital, Southern Medical University, Guangzhou 510282, China, and Department of Digestive Diseases, Nanfang Hospital, Southern Medical University, Guangzhou 510515, China Received February 14, 2009
Translationally controlled tumor protein (TCTP) plays a major role in a broad array of biological processes. However, the TCTP-related biological process and interactive proteins still remain poorly characterized. In the present study, we found that knockdown of TCTP inhibited proliferation, migration, and invasion activities of LoVo cells in vitro and in vivo. The whole-cell proteomes were compared by 2D gel electrophoresis before and after knockdown of TCTP. Alterations in 27 proteins were detected and their identities were revealed by mass spectrometry analysis. Components of Ubiquitin-Proteasome System, proteins involved in the cytoskeleton biosynthesis and tumor metastasis were found to be changed upon TCTP removal. These results imply that TCTP might play at least a partial role in colon adenocarcinoma progression. Keywords: translationally controlled tumor protein (TCTP) • proteomics • metastasis • mass spectrometry • MALDI-TOF/TOF-MS • 2D gel electrophoresis
Introduction The translationally controlled tumor protein (TCTP), a highly conserved protein,1,2 has been suggested as a tumor associated antigen. Its mRNA and protein expression levels tend to be higher in the colorectal cancers (CRC), compared to the corresponding normal tissue.3 Biological models of tumor reversion were established from human leukemia and breast cancer cell lines by using the H-1 parvovirus as a selective agent. Differential gene expression analysis was performed between the parental malignant cells and their revertants. TCTP was found to be the most strikingly down-regulated in tumor reversion.4 Furthermore, the levels of TCTP in the revertants from three other major solid cancers, colon, lung and melanoma cell lines, have the same results. In addition, it was verified that inhibition of TCTP expression could induce changes in the malignant phenotype, when the v-src-transformed NIH3T3 cells were transfected with antisense TCTP.5 The expression levels of TCTP were also found to be associated with Caco-2 differentiation by proteomics approach.6 On the basis of recently prognosis studies, TCTP has the potential to be identified as a new predictive marker for better understand* To whom correspondence should be addressed. E-mail: mingli2006_2006@ 126.com. Tel/Fax: +86-20-6164-8550. † The Institute of Antibody Engineering, School of Biotechnology, Southern Medical University. ‡ Department of Digestive Diseases, the No. 303 Hospital of PLA. § Oncology Center, Zhujiang Hospital, Southern Medical University. ¶ Department of Digestive Diseases, Nanfang Hospital, Southern Medical University.
40 Journal of Proteome Research 2010, 9, 40–49 Published on Web 07/21/2009
ing CRC progression involved in metastasis;7 however, the TCTP biological characteristics in colorectal cancer progression still remained to be elucidated. Double-stranded RNA-mediated interference (RNAi) has recently emerged as a powerful genetic tool to silence gene expression in multiple organisms and has been widely used for gene function analysis.8,9 Small interfering RNA (siRNA) expression mediated by specific plasmids enables efficient and specific suppression of target gene expression in mammalian cells with maintenance of stable loss-of-function phenotypes.10 To investigate the biological role of TCTP in colorectal cancer progression, we used an RNAi-based proteomics approach with which we compared proteomes of LoVo cells before and after TCTP knockdown. LoVo initiated from a fragment of a metastatic tumor nodule in the left supraclavicular region of a male patient with a histologically proven diagnosis of colon adenocarcinoma.11 We investigated the phenotypic changes including the tumor proliferative, invasive, and metastatic activities. Our results showed that knockdown of TCTP by shRNA inhibited proliferation, invasion, and metastasis of LoVo cells both in vitro and in vivo. TCTP knockdown related proteins were identified by the comparative proteomes strategy. Several different spots were identified as components of the Ubiquitin-Proteasome System, proteins involved in the cytoskeleton biosynthesis and tumor metastasis.
Materials and Methods Materials. Anti-mouse and anti-rabbit IgG-conjugated horseradish peroxidase were purchased at Bethyl (Bethyl Laboratories, Inc., TX). Rabbit polyclonal antibodies specific for TCTP 10.1021/pr9001367
2010 American Chemical Society
Tumor Growth and Metastasis of Colon Adenocarcinoma Cells were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit polyclonal antibodies specific for p65, IκBR, PSMA3, PSME3 and PSMA6 were purchased from Cell Signaling Technology, Inc.. Rabbit polyclonal antibodies specific for PSMD8 were purchased from SigmasAldrich (St. Louis, MO). Rabbit polyclonal antibodies specific for STMN1, mouse monoclonal antibodies specific for HMGB1, goat polyclonal antibodies specific for LASP1 and mouse monoclonal antibodies specific for PSMA1 were purchased from Abnova Antibody Innovation (Taiwan). Luciferase assay kit was purchased from Promega (Madison, MA). Cell Culture. Culture of tumor cells LoVo cells were plated on tissue culture flasks and cultured in Dulbecco’s modified Eagle medium (DMEM) (Gibco Life Technologies, Carlsbad, CA) supplemented with 10% inactivated fetal calf serum (Invitrogen, Carlsbad, CA), 2 mM L-glutamine (Invitrogen, Carlsbad, CA), and 1% penicillin/streptomycin (100 U/m:; Gibco Life Technologies,Carlsbad, CA) in a humidified incubator at 37 °C and 5% CO2. Construction of Plasmid-Based shRNA Targeting TCTP. Specific silencing of the endogenous TCTP (GenBank accession no. NM003295) was achieved by using a shRNA-expressing vector. Nucleotides 228-246 (CTCGCTCAT TGGTGGAAAT) of the TCTP coding sequence were chosen as target for shRNA. The shRNA-TCTP encoding sequence was created by using the two complementary oligonucleotides indicated below, each containing the 19 nucleotides target sequence of TCTP (228-246), followed by a short spacer TTCAAGAGA: Oligonucleotide1, 5′-CACCGCTCGCTCATTGGTGGAAATTTCAAGAGAATTTCCACCAATGAGCGAGTTTTTTG-3′; and oligonucleotide2, 5′-GATCCAAAAAACTCGCTCATTGGTGGAAATTCTCTTGAAATTTCCACCAATGAGCGAGC-3′. The shRNA TCTP-encoding sequence was cloned into the BamHI and BbsI sites of the pGPU6/GFP/ Neo siRNA Expression vector (Genepharma, Shanghai, China), containing a neomycin-resistance gene. The pGPU6/GFP/Neo Negative Control (shncRNA-TCTP) plasmid supplied is a circular plasmid encoding a hairpin siRNA whose sequence is not found in the mouse, human, or rat genome databases. The sequence is 5′-GTTCTCCGAACGTGTCACGT-3′, followed by a short spacer CAAGAGATT: Oligonucleotide1, 5′-CACCGTTCTCCGAA CGTGTCACGTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTG-3′; and oligonucleotide2, 5′-GATCCAAAAAATTCTCCGAACGTGTTCACGTAATCTCTTGACGTGACACGTTCGGAGAAC3′. The shncRNA-TCTP encoding sequence was cloned into the BamHI and BbsI sites of the pGPU6/GFP/Neo siRNA Expression vector. RNA Isolation. Total cellular RNA was extracted using Trizol Reagent (Invitrogen, Carlsbad, CA). Cellular RNA in the aqueous phase was transferred to sterile RNase-free 1.5 mL microcentrifuge tubes and precipitated by adding an equal volume of isopropyl alcohol and centrifugation at 10 000 rpm for 10 min. The pellets were washed with 70% ethanol, air-dried, and resuspended in diethyl pyrocarbonate (DEPC) water. The RNA preparations were used for semiquantitative RT-PCR. Semiquantitative RT-PCR Analysis. Total RNA was isolated with Trizol Reagent (Invitrogen). Then, the amount of total RNA was determined using ultraviolet (UV) spectrophotometry, and first strand cDNA was synthesized from 2 µg of total RNA using M-MLV (Promega), Oligo-(dT)18 primer (Invitrogen) and RNasin (Takara). For semiquantitative PCR analysis, cDNA was amplified by Taq DNA polymerase (Takara). Human β-actin gene was used as an internal control. Each PCR program involved a 5-min initial denaturation step at 95 °C, followed by 32 cycles
research articles
at 95 °C for 30 s, 56 °C for 30 s, and 72 °C for 1 min, followed by a final step at 72 °C for 10 min. DNA primer sequences were designed as follows: for human TCTP, sense 5′ ATGATT ATCTACCGGG 3′ and antisense 5′ TTAACATTTTTCCATT 3′. The amplicon size is 521 bp, for human β-actin gene, sense 5′CTCCATCCTGGCCTCGCTGT 3′ and antisense 5′ GCTGTCACCTTCACCGTTCC 3′. The amplicon size is 268 bp; the PCR amplified products were separated using electrophoresis on 1.5% agarose gels and visualized by staining with 0.5% Goldview. Gel images were obtained and the densities of PCR products were quantified using densitometry methods. All experiments were repeated on at least three occasions. Real-Time Quantitative PCR and the 2∆∆ Method. To monitor the expression of the TCTP gene in different groups, RNA was first extracted using the Trizol method (Invitrogen) following the manufacturer’s instructions. Any residual DNA remaining in the RNA preparations was removed by DNase digestion. cDNA was synthesized using 1 µg of RNA and an oligo (dT)18 primer and Superscript reverse transcriptase (Invitrogen, CA). Quantitative real-time PCR (qRT-PCR) was performed using custom SYBR Assays using primer sets. The following primers were selected to detect TCTP expression: TCTP-F, 5′-TGAAGAACAGAGACCAGAAAG-3′; TCTP-R, 5′-CACGGTAGTCCAATAGAGCAAC-3′. To detect the expression of the endogenous control GAPDH gene, the following primers were used: GAPDH-F, 5′-GATGACATCAAGAAGGTGGTGA-3′; GAPDHR, 5′-TTCGTTGTCATACCAGGA AATG-3′. To detect the expression of the IFN-response gene OAS1, the following primers were used: OAS1-F, 5′-AGGTGGTAAAGGGTGGCTCC-3′; and OAS1R, 5′-ACAACC AGGT CAGCGTCAGAT-3′.12 Each real-time SYBR PCR was performed using cDNA equivalent to 10 ng of total parasite RNA according to the manufacturer’s universal conditions PCR protocol, in a final volume of 20 µL. All samples were run in triplicate and underwent 40 amplification cycles on a MX3000P Real-time PCR Instrument (Stratagene). For relative quantification, the ∆∆Ct method was employed,13 using GAPDH as the endogenous standard for each sample. For graphical representation, the ∆∆Ct values were normalized to controls and expressed as percent difference. Western Blot Analysis. LoVo and SW620 cells were washed with ice-cold Tris buffered saline (TBS) and lysed with 3 vol of lysis buffer consisting of 20 mM Tris-HCl (pH 7.6), 50 mM KCl, 400 mM NaCl, 1 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride, aprotinin (2 µg/mL), leupeptin (2 µg/mL), 1 mM dithiotreitol, 1% Triton X-100, and 20% glycerol. The lysates were centrifuged at 10 000 rpm for 20 min and the supernatant was stored at -70 °C or used immediately. Proteins were resolved on SDS-PAGE and transferred to Immobilon polyvinyldifluoride (PVDF) membranes. The blots were blocked with 4% BSA for 1 h at room temperature and then probed with antibodies against TCTP (1:1000) for 1 h at room temperature. After three washes, the blots were subsequently incubated with a mouse anti-rabbit peroxidase-conjugated secondary antibody (1:1000) for 1 h at room temperature. The blots were visualized by enhanced chemiluminescence using FUJI SUPER RX film (Fujifilm, Tokyo, Japan). In Vitro Transfection and Selection. LoVo colon carcinoma cells were plated on 24-well tissue culture flasks at a density of 1 × 105cells. After an overnight incubation and a confluence around 70-80%, these cells were transfected with 1 µg of each TCTP-specific shRNA expressing plasmid and 1 µL of Lipofectamine 2000 (Invitrogen, Carlsbad, CA). The plasmid and Lipofectamine 2000 were diluted in serum-free medium left at Journal of Proteome Research • Vol. 9, No. 1, 2010 41
research articles room temperature for 5 min, mixed immediately, and incubated for 20 min at room temperature at a (v/w) ratio of liposomes to shRNA of 1:1. The culture medium was removed and the shRNA-lipid complex (0.6 mL total volume) was added. The cells were incubated overnight at 37 °C. The medium was then replaced, and 48 h later, 0.5 mg/mL neomycin was added for selection of transfected cells. Growth was monitored for 2 weeks, with medium being refreshed every 48 h. The pools were analyzed by immunoblot using polyclonal anti-TCTP antibodies. The pool expressing 2-fold in silver stained gels was considered a significant alternation. These spots were excised and analyzed by MALDI-TOF/TOF-MS. Tryptic In-Gel Digestion. Silver-stained protein spots on the polyacrylamide gel were excised and transferred into a 0.5 mL microcentrifuge tube, rinsed twice with ddH2O, then destained in a 1:1 solution of 30 mM potassium ferricyanide and 100 mM ammonium bicarbonate to pH 8.0. After hydrating with acetonitrile and drying in a SpeedVac, the gels were rehydrated in a minimal volume of sequencing grade porcine trypsin (Promega) solution (20 µg/mL in 25 mM NH4HCO3) and incubated at 37 °C overnight. The supernatants were transferred into a 200 µL microcentrifuge tube and the gels were extracted once with extraction buffer (67% acetonitrile containing 1% trifluoroacetic acid). The peptide extract and the supernatant of the gel spot were combined and then completely dried in a SpeedVac centrifuge. MALDI-TOF/TOF MS Analysis. Protein digestion extracts (tryptic peptides) were resuspended with 5 µL of 0.1% trifluoroacetic acid and then the peptide samples were mixed (1:1 ratio) with a matrix consisting of a saturated solution of R-cyano-4- hydroxy-trans-cinnamic acid in 50% acetonitrile-1% trifluoroacetic acid. Aliquots of 0.8 µL were spotted onto stainless steel sample target plates. Peptide mass spectra were obtained on an Applied Biosystem Sciex 4800 MALDI TOF/TOF mass spectrometer. Data were acquired in positive MS reflector using a CalMix5 standard to calibrate the instrument (ABI4700 Calibration Mixture). Mass spectra were obtained from each sample spot by accumulation of 600-800 laser shots in an 800-4000 mass range. For MS/ MS spectra, the 5 most abundant precursor ions per sample were selected for subsequent fragmentation and 900-1200 laser shots were accumulated per precursor ion. The criterion for precursor selection was a minimum S/N of 50. Both the MS and MS/MS data were interpreted and processed using the GPS Explorer software(V3.6, Applied Biosystems); then, the obtained MS and MS/MS spectra per spot were combined and submitted to MASCOT search engine (V2.1, Matrix Science, London, U.K.) by GPS Explorer software and searched with the following parameters: IPI Human database (V3.36), taxonomy of Homo sapiens (human), trypsin of the digestion enzyme, one missed cleavage site, partial modification of carboamidomethylated cysteine and oxidized methionine, no fixed modifications, MS tolerance of 30-60 ppm, and MS/MS tolerance of 0.2-0.3 Da. Known contaminant ions (keratin) were excluded. MASCOT protein scores (based on combined MS and MS/MS spectra) of greater than 61 were considered statistically significant (p e 0.05). The individual MS/MS spectrum with statistically significant
research articles
Figure 2. Knockdown of TCTP inhibited the proliferation of LoVo cells in vitro. Proliferation of LoVo cells transfected with shRNATCTP, shncRNA-TCTP, and parental LoVo cells were analyzed by CCK-8 assay. *P < 0.05 compared with shncRNA-TCTP transfected cells and/or parental LoVo cells.
Figure 3. Down-regulation of TCTP by RNAi attenuated migration and invasion activity of LoVo cells. (A) The polycarbonate filters were stained with crystal violet and inspected under a microscope at 400×. (B) Statistical plots of the number of cells that invaded the transwell membranes of haptotactic migration assay and matrigel invasion assay. **P < 0.01 compared with shncRNATCTP transfected cells and/or parental LoVo cells.
(confidence interval >95%) best ion score (based on MS/MS spectra) was also accepted. Statistics. The values given are means ( SD. Statistical analysis between two samples was performed using Student’s t test. Statistical comparisons of more than two groups were performed using one-way analysis of variance (ANOVA) with Bonferroni’s post hoc test. In all cases, p < 0.05 was considered as significant.
Results The TCTP Expression in Different Colon Cancer Cell Lines. The TCTP expression levels in different colon cancer cell lines (including both high tumorigenic and metastatic potentials) were tested. We found that the TCTP expression in the high metastatic potential colon cancer cell lines (LoVo, SW620) is higher than that in the relatively lower metastatic potential colon cancer cell lines (LS174T, SW480) (Figure 1A). The Vector Stably Expressing TCTP shRNA Effectively Suppressed TCTP Expression. The inhibition efficiency of TCTP specific shRNA in LoVo cells was first examined by reverse transcription-PCR using β-actin as the internal Journal of Proteome Research • Vol. 9, No. 1, 2010 43
research articles
Ma et al.
Figure 4. Down-regulation of TCTP by RNAi attenuated adhesion activity of LoVo cells. (A) Original cell adhesion photos of the parental LoVo cells, shncRNA-TCTP LoVo cells and shRNA-TCTP LoVo cells to extracellular matrix (fibronectin, vitronectin, laminin, and collagen I) (200×). (B) The Y-axis shows optical density following crystal violet staining of adhered cells. **P < 0.01 compared with shncRNATCTP transfected cells and/or parental LoVo cells.
reference (Figure 1B). Western blotting also showed the reduced expression of TCTP protein in TCTP-shRNA transfected cells (Figure 1C). TCTP and OAS1 mRNA levels were also measured by QRT-PCR (Figure 1D). The TCTP mRNA levels were obviously reduced in the shRNA-TCTP LoVo cells; 44
Journal of Proteome Research • Vol. 9, No. 1, 2010
however, the IFN-response gene OAS1 mRNA levels had not significantly changed in the three groups. Effect of TCTP Knockdown on Cell Proliferation in Vitro. To investigate the effect of TCTP knockdown on functional alteration, growth of cells was first assessed by
Tumor Growth and Metastasis of Colon Adenocarcinoma Cells
Figure 5. Knockdown of TCTP in LoVo cells inhibited tumor growth and liver metastasis in nude mice. (A) Weights of subcutaneous tumors in nude mice. **P < 0.01 compared with LoVo parental and/or empty vector-transfected cells. (B) Numbers of tumor metastasis in nude mice. (C) Representative sections of liver tissue. The liver architecture was normal of mice inoculated with shRNA-TCTP transfected LoVo cells (left), whereas the liver tissue of mice inoculated with shncRNA-TCTP vectortransfected LoVo cells manifested carcinoma cell colonies (right) (H&E staining, original magnification, 200×).
CCK-8 assay. As shown in Figure 2, compared with those TCTP-shncRNA transfected cells, the growth of TCTP-shRNA transfected cells was inhibited to 78.0% (P < 0.05), 67.2% (P < 0.05), 81.8% (P < 0.05), and 84.9% (P < 0.05) at fourth, fifth, sixth, and seventh day, calculated by absorbance, respectively. Suppression of TCTP Attenuated Migration and Invasion Activity of LoVo Cells in Vitro. The effect of TCTP RNAi on motility of LoVo cells was examined using transwell (Costar, NY; pore size, 8-mm) in 24-well dishes. Fewer TCTP-shRNAtransfected cells than TCTP-shncRNA-transfected and parental cells were observed when the polycarbonate filters were stained with crystal violet. The migration assay showed the number of cells invaded to the bottom chamber was much greater both in TCTP-shncRNA-transfected cells and in parental LoVo cells than in TCTP-shRNA-transfected cells. TCTP knockdown significantly inhibited the invasiveness of LoVo cells, by 87.5% (Figure 3). Suppression of TCTP Attenuated Adhesion Activity of LoVo Cells in Vitro. To determine whether adhesion was affected by inhibiting expression of TCTP in LoVo cells, we tested attachment of LoVo cells to the extracellular matrix (fibronectin, vitronectin, laminin, and collagen I). Under identical experimental conditions, shRNA-TCTP plasmids transfected cells showed reduced adhesion to fibronectin, vitronectin, laminin and collagen I as compared to shncRNATCTP vector transfected cells (Figure 4A). The result of adhesion assay demonstrated that TCTP silencing significantly inhibited the adhesive power of LoVo cells to laminin up to 59.6% (Figure 4B). Effects of TCTP Suppression on Tumor Growth and Metastasis in Vivo. Since knockdown of TCTP attenuated proliferation, migration, and invasion activity of LoVo cells in vitro, we further investigated whether TCTP suppression
research articles
would alter tumor growth and metastatic potential in nude mice. Cells (5 × 106/mouse) suspended in 0.2 mL of DMEM were injected subcutaneously into the 6-week-old BALB/c nude mice at the right flanks. The animals were sacrificed on the 21st day after injection and the tumors were dissected and weighed. The tumorigenicity inhibition rate was up to 71.9% (Figure 5A). Transfected shRNA-TCTP, transfected shncRNA-TCTP, and parental LoVo cells were injected into the spleen of nude mice. When the mice were sacrificed 5 weeks after injection, the number of the hepatic surface metastases of shRNA-TCTP group was significantly less than that of the tumors formed by shncRNA-TCTP transfected LoVo cells (Figure 5B). These data indicated that suppressed TCTP expression in LoVo cells could inhibit tumor growth and metastasis in nude mice. Histopathologic examinations revealed relatively normal liver tissue of the mice injected with TCTP-shRNA transfected cells and malignant liver tissue of the mice injected with TCTP-shncRNA transfected cells; there are more carcinoma cell colonies presented in liver samples from mice injected with shncRNA-TCTP transfected LoVo cells (Figure 5C). Proteomic Analysis. To explore the functional consequences of TCTP knockdown, we compared whole-cell proteomes on 2D-SDS-PAGE before and after knockdown of TCTP. Comparison of whole-cell proteomes yielded an alteration in 2D gel spots that was changed upon the removal of TCTP. These spots were excised from the gel, digested with trypsin, and analyzed by mass spectrometry. Information was gathered from 27 individual spots in total, from which 23 were down-regulated and 4 were up-regulated accompanied by the reduced levels of TCTP (Figure 6, Table 1). The altered spots include Ubiquitin-Proteasome subunits, cancer proliferation, metastasis, cytoskeleton metabolism and ion binding related protein. To validate our mass spectrometry results, we obtained antibodies against a subset of the identified proteins and analyzed their expression levels in the shRNA-TCTP, shncRNA-TCTP and parental LoVo cells groups by Western blotting (Figure 6C). We confirmed reduced expression of proteasome subunits of ubiquitin-proteasome system, PSMA1, PSMA3, PSME3, PSMA6, and PSMD8 upon knockdown of TCTP; translational related protein HMGB1, the cell cytoskeleton metabolism related protein STMN1, LASP1 could also be confirmed. The Protein Identification in SW620 Cell Lines. We use another high metastatic potential colon cancer cell line SW620 to examine these protein level changes by knockdown TCTP for validation. The reduced expression of proteasome subunits of ubiquitin-proteasome system, PSMA1, PSMA3, PSME3, PSMA6, PSMD8, were confirmed upon knockdown of TCTP; translational related protein HMGB1, the cell cytoskeleton metabolism related protein STMN1, LASP1 could also be confirmed like that in the LoVo cells (Figure 7).
Discussion CRC is one of the most common cancers in the world, with a high propensity to metastasize. A total of 30-40% of patients have metastatic disease at the initial diagnosis. The liver is the most frequent site of metastases.22,23 Special markers for early diagnosis and target for effective therapies of malignancies are imperative needed. On the basis of the recent prognosis research data, TCTP was suggested as a new predictive marker for better understanding of CRC progression involved in tumor metastasis.7 Moreover, we found that the TCTP expression levels in the high metastatic potential colon cancer cell lines Journal of Proteome Research • Vol. 9, No. 1, 2010 45
research articles
Ma et al.
Figure 6. 2-D gels images of shRNA-TCTP and shncRNA-TCTP LoVo cells. (A) Master gel images of whole cell proteome of before and after TCTP-knockdown LoVo cells. Arrows indicate those proteins whose expressions were altered after TCTP-knockdown and were unequivocally identified by MS. Numbers are correlated with those spot no. listed in Table 1. (B) Detailed alternation patterns of identified protein spots. (C) Western blots analysis of the altered proteins in shRNA-TCTP, shncRNA-TCTP and parental LoVo cells.
(LoVo, SW620) are higher than those in the relatively lower metastatic potential colon cancer cell lines (LS174T, SW480) as this might explain the importance of TCTP in colon cancer progression (Figure 1A). TCTP has been implicated in important cellular processes, such as cell growth, cell cycle progression, and malignant transformation and in the protection of cells against various stress conditions and apoptosis.24 Better understanding of its molecular mechanisms involved in the progression of CRC might improve our capacity for early diagnosis and prognosis. To this end, we used RNA interference to silence TCTP expression in LoVo colon carcinoma cells. Transfection of a vector with shRNA-TCTP stably suppressed the expression of TCTP in LoVo cells confirmed by semiquantitative RT-PCR (Figure 1B), Western blot analysis (Figure 1C) and qRT-PCR (Figure 1D). The induction of shRNA expression may lead to an IFNmediated cellular stress response with downstream changes in protein expression as a consequence. To rule out IFN-mediated effects in LoVo cells, we analyzed the expression of IFN target gene (OAS1) by qRT-PCR before and after TCTP-knockdown 46
Journal of Proteome Research • Vol. 9, No. 1, 2010
(Figure 1C). The OAS1 gene was not induced in the shRNATCTP and shncRNA-TCTP transfected LoVo cells compared to the parental LoVo cells, indicating that the observed changes in TCTP expression were not due to an IFN-mediated stress response. Proliferation, migration and invasion assay in vitro indicated that knockdown of TCTP significantly inhibited the proliferation, migration and invasion activity of LoVo cells (Figures 2 and 3). Furthermore, we also found that down-regulation of TCTP inhibits liver tumor growth and metastasis of LoVo cells in nude mice (Figure 5A,B) using Tumorigenicity and Intrasplenic injection model, respectively. This intrasplenic injection model of experimental metastasis has some advantages since it appears to be a rather consistent method to induce liver metastasis25 and this procedure is relative easy, only requiring a small subcostal incision.26 Figure 5B shows that the liver metastatic nodules were dramatically reduced in mice inoculated with shRNA-TCTP transfected LoVo cells, compared to the shncRNA-TCTP transfected LoVo cells and parental LoVo cells. Histopathologic examinations also revealed that the mice injected with TCTP-shRNA formed fewer colonies on the
research articles
Tumor Growth and Metastasis of Colon Adenocarcinoma Cells Table 1 spot no.
protein name
accession no.
1822 1972
Setp11 PSMC5
IPI00019376 IPI00745502
2240 2267
STOML2 PPP2R4
IPI00442543 IPI00470813
2355 2367 2397 2400
LASP1 SFRS10 TIMM50 PPP1CA
IPI00000861 IPI00555647 IPI00656071 IPI00550451
2474 2533 2577 2592 2622
ZNF230 PRPS2 PIR BLVRA PSMA1
IPI00006278 IPI00718888 IPI00012575 IPI00294158 IPI00871889
2627
PSME3
IPI00030243
2661
PSMA3
IPI00171199
2667
PSMD8
IPI00883744
2725 2745
CAPNS1 PSMD9
IPI00025084 IPI00010860
2750 2788 2792
PGAM1 IDI1 PSMA6
IPI00549725 IPI00640997 IPI00029623
2814 2888 2962 3234 3283 3292
TPI1 HMGB1 ITPA STMN1 NME2 ITPR1
IPI00797270 IPI00419258 IPI00375446 IPI00479997 IPI00795292 IPI00218661
a
protein description
microtubules biosynthesis ubiquitin-dependent protein catabolic process receptor binding regulation of phosphoprotein phosphatase activity actin binding, ion transport RNA binding 33611.5/10.89 RNA binding phosphoprotein phosphatase activity DNA binding 54506.5/8.75 ion binding ion binding catalytic activity ubiquitin-dependent protein catabolic process ubiquitin-dependent protein catabolic process ubiquitin-dependent protein catabolic process ubiquitin-dependent protein catabolic process regulation of cell proliferation ubiquitin-dependent protein catabolic process catalytic activity ion binding ubiquitin-dependent protein catabolic process catalytic activity DNA binding ion binding tubulin binding DNA binding ion transport
Protein MW/pI
protein score (C.I.%)
expression fold ratea
queries matched
protein coverage (%)
49367.2/6.36 44755.7/8.23
100 100
0.39 0.49
23.00 14.00
43% 30%
19732.2/6.75 11731/8.82
100 99.849
2.15 0.41
11.00 6.00
40% 25%
29698.2/6.61 96.375 39621.5/8.55 37487.8/5.94
100 >10 99.931 100
0.25 7.00 >10 0.39
20.00 17% 8.00 26.00
46% 10% 43%
99.995 35032.1/6 32093.3/6.42 33407.3/6.06 29578.9/6.15
2.23 100 100 95.642 100
27.00 0.38 0.48 0.36 0.43
49% 21.00 18.00 6.00 8.00
49% 34% 9% 52%
29487.6/5.69
100
0.30
23.00
50%
27629.7/5.19
100
0.36
22.00
39%
29985.6/6.85
95.33
0.29
5.00
17%
28297.7/5.05 24638.5/6.46
100 99.972
0.34 0.34
11.00 9.00
26% 21%
28785.8/6.67 13642.2/8.91 27381.8/6.34
100 98.454 100
0.35 0.49 0.42
13.00 4.00 19.00
37% 32% 43%
22856.7/6.44 24878.2/5.62 19590.8/5.08 17291.9/5.76 30117.6/9.06 310953.2/5.79
99.877 99.998 97.605 100 100 99.089
0.48 0.08 0.39 0.32 0.34 0.37
2.00 14.00 2.00 16.00 9.00 6.00
9% 37% 9% 48% 31% 15%
The expression level of shRNA-TCTP/the expression level of shncRNA-TCTP.
surface of their livers (Figure 5C). All the in vivo results were consistent with the results of in vitro proliferation, migration, invasion and adhesion assays. These results indicated an association between the invasive potential of LoVo cells and the expression level of TCTP both in vitro and in vivo. The process of metastasis involves a complex series of events including growth of a primary tumor, cell transformation, motility, angiogenesis, vascular invasion and, finally, growth of the tumor mass in secondary sites;27 a series of important genes expression involved in invasion and metastasis might have changed when TCTP was silenced. So we use an RNAibased proteomics approach with which we compared proteomes of cells before and after knockdown of TCTP to explore the TCTP-related proteins. Consequently, 27 different spots were identified, including components of Ubiquitin-Proteasome system, proteins involved in the cytoskeleton biosynthesis and tumor metastasis. The proteasome subunits (PSMA1, PSMA3, PSMA6 and PSMD8), and ubiquitin-proteasome system activator PSME3 were down-regulated in the TCTP-knockdown cells. There have been results showing that the aberrations in the ubiquitinproteasome system (UPS) have been recently connected to the pathogenesis of several human protein degradation disorders.28 Alterations in the proteolytic system are associated with
pathologies of colorectal cancer.29,30 The UPS could activate the nuclear factor-kappa B (NF-κB), trigger an enhanced cellular proliferation and angiogenic cytokine production, induce cell death and attenuate tumor cell adhesion to stroma. STMN1, a microtubule-regulatory protein, mediates the effects of p27 (Kip1) on cell motility. It provides new insights into migration and metastasis of tumor cells and the relationship of these processes to cell proliferation.31 HMGB1 is involved during different steps of metastasis, and has been linked with cancer in human and animal models.32,33 Some reported functions of HMGB1 are related to CRC tumor growth and metastasis.34-36 In addition, there are studies showing that HMGB1 could induce significant increase the glioblastoma cell migration ability.37 LASP1 is a dynamic focal adhesion protein necessary for cell migration.38 Moreover, it is not sufficient to conclude that these proteins described above are regulated by TCTP in LoVo cell line. Therefore, we use another high metastatic potential colon cancer cell line SW620 to examine these protein level changes by knockdown TCTP for validation. The down-regulated expression of several proteasome subunits of ubiquitin-proteasome system, translational related protein HMGB1, and the cell cytoskeleton metabolism related proteins STMN1, LASP1 were confirmed upon knockdown of TCTP (Figure 7). Journal of Proteome Research • Vol. 9, No. 1, 2010 47
research articles
Ma et al.
(7)
(8) (9)
(10)
(11)
(12) (13) (14)
Figure 7. Western blots analysis of the altered proteins in shRNATCTP(SW620), shncRNA-TCTP(SW620) and parental SW620 cells.
(15) (16)
In summary, the present study suggests that knockdown of TCTP in colon carcinoma cell lines might play at least a partial role in effectively inhibiting their migration, invasion in vitro and liver metastasis in vivo. The proteome-wide approach identified expression levels of multiple proteins in absence of TCTP. From the data, we conclude that TCTP-knockdown might inhibit the biosynthesis level of several metastasis related protein, especially the subunits of ubiquitin-proteasome system. Further work will be required to explain the concrete biological mechanism of TCTP on tumor growth and metastasis of colon adenocarcinoma LoVo cells.
Acknowledgment. This work is supported by the National High Technology Research and Development Program of China (No. 2006AA02A311). References (1) Gachet, Y.; Tournier, S.; Lee, M.; Lazaris-Karatzas, A.; Poulton, T.; Bommer, U. A. The growth-related, translationally controlled protein P23 has properties of a tubulin binding protein and associates transiently with microtubules during the cell cycle. J. Cell Sci. 1999, 112 (Pt. 8), 1257–1271. (2) Bommer, U. A.; Thiele, B. J. The translationally controlled tumour protein (TCTP). Int. J. Biol. Chem. Cell Biol. 2004, 36 (3), 379–385. (3) Chung, S.; Kim, M.; Choi, W.-J.; Chung, J.-K.; Lee, K. Expression of translationally controlled tumor protein mRNA in human colon cancer. Cancer Lett. 2000, 156 (2), 185–190. (4) Tuynder, M.; Susini, L.; Prieur, S.; Besse, S.; Fiucci, G.; Amson, R.; Telerman, A. Biological models and genes of tumor reversion: cellular reprogramming through tpt1/TCTP and SIAH-1. Proc. Natl. Acad. Sci. U.S.A. 2002, 99 (23), 14976–14981. (5) Tuynder, M.; Fiucci, G.; Prieur, S.; Lespagnol, A.; Geant, A.; Beaucourt, S.; Duflaut, D.; Besse, S.; Susini, L.; Cavarelli, J.; Moras, D.; Amson, R.; Telerman, A. Translationally controlled tumor protein is a target of tumor reversion. Proc. Natl. Acad. Sci. U.S.A. 2004, 101 (43), 15364–15369. (6) Stierum, R.; Gaspari, M.; Dommels, Y.; Ouatas, T.; Pluk, H.; Jespersen, S.; Vogels, J.; Verhoeckx, K.; Groten, J.; van Ommen, B.
48
Journal of Proteome Research • Vol. 9, No. 1, 2010
(17) (18) (19)
(20)
(21)
(22) (23)
(24) (25) (26) (27) (28) (29)
Proteome analysis reveals novel proteins associated with proliferation and differentiation of the colorectal cancer cell line Caco-2. Biochim. Biophys. Acta 2003, 1650 (1-2), 73–91. Slaby, O.; Sobkova, K.; Svoboda, M.; Garajova, I.; Fabian, P.; Sachlova, M.; Smerdova, T.; Knoflickova, D.; Vyzula, R. Altered expression of heat shock protein 110 (HSP110), hypoxia upregulated 1 (HYOU1) and translationally controlled tumor protein (TCTP) during colorectal cancer progression. Eur. J. Cancer Suppl. 2008, 6 (9), 129–129. Brummelkamp, T. R.; Bernards, R.; Agami, R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002, 296 (5567), 550–553. Sui, G.; Soohoo, C.; Affar el, B.; Gay, F.; Shi, Y.; Forrester, W. C. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 2002, 99 (8), 5515– 5520. Abu-Hamad, S.; Sivan, S.; Shoshan-Barmatz, V. The expression level of the voltage-dependent anion channel controls life and death of the cell. Proc. Natl. Acad. Sci. U.S.A. 2006, 103 (15), 5787– 5792. Drewinko, B.; Romsdahl, M. M.; Yang, L. Y.; Ahearn, M. J.; Trujillo, J. M. Establishment of a human carcinoembryonic antigenproducing colon adenocarcinoma cell line. Cancer Res. 1976, 36 (2 Pt 1), 467–475. Fish, R. J.; Kruithof, E. K. Short-term cytotoxic effects and longterm instability of RNAi delivered using lentiviral vectors. BMC Mol. Biol. 2004, 5, 9. Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25 (4), 402–408. Kaneda, T.; Sonoda, Y.; Ando, K.; Suzuki, T.; Sasaki, Y.; Oshio, T.; Tago, M.; Kasahara, T. Mutation of Y925F in focal adhesion kinase (FAK) suppresses melanoma cell proliferation and metastasis. Cancer Lett. 2008, 270 (2), 354–361. Yan, C.; Han, R. Genistein suppresses adhesion-induced protein tyrosine phosphorylation and invasion of B16-BL6 melanoma cells. Cancer Lett. 1998, 129 (1), 117–124. Murao, L. E.; Shisler, J. L. The MCV MC159 protein inhibits late, but not early, events of TNF-alpha-induced NF-kappaB activation. Virology 2005, 340 (2), 255–264. Bartholin, L.; Guindon, S.; Martel, S.; Corbo, L.; Rimokh, R. Identification of NF-kappaB responsive elements in follistatin related gene (FLRG) promoter. Gene 2007, 393 (1-2), 153–162. Ji, L. L.; Gomez-Cabrera, M. C.; Steinhafel, N.; Vina, J. Acute exercise activates nuclear factor (NF)-kappaB signaling pathway in rat skeletal muscle. FASEB J. 2004, 18 (13), 1499–1506. Rychahou, P. G.; Jackson, L. N.; Silva, S. R.; Rajaraman, S.; Evers, B. M. Targeted molecular therapy of the PI3K pathway: therapeutic significance of PI3K subunit targeting in colorectal carcinoma. Ann. Surg. 2006, 243 (6), 833-142, discussion 843-844. Palumbo, R.; Galvez, B. G.; Pusterla, T.; De Marchis, F.; Cossu, G.; Marcu, K. B.; Bianchi, M. E. Cells migrating to sites of tissue damage in response to the danger signal HMGB1 require NFkappaB activation. J. Cell Biol. 2007, 179 (1), 33–40. Mercurio, F.; Murray, B. W.; Shevchenko, A.; Bennett, B. L.; Young, D. B.; Li, J. W.; Pascual, G.; Motiwala, A.; Zhu, H.; Mann, M.; Manning, A. M. IkappaB kinase (IKK)-associated protein 1, a common component of the heterogeneous IKK complex. Mol. Cell. Biol. 1999, 19 (2), 1526–1538. Van’t Veer, L. J.; Weigelt, B. Road map to metastasis. Nat. Med. 2003, 9 (8), 999–1000. Hiraoka, K.; Kimura, T.; Logg, C. R.; Tai, C. K.; Haga, K.; Lawson, G. W.; Kasahara, N. Therapeutic efficacy of replication-competent retrovirus vector-mediated suicide gene therapy in a multifocal colorectal cancer metastasis model. Cancer Res. 2007, 67 (11), 5345–5353. Bommer, U. A.; Thiele, B. J. The translationally controlled tumour protein (TCTP). Int. J. Biochem. Cell Biol. 2004, 36 (3), 379–385. Lafreniere, R.; Rosenberg, S. A. A novel approach to the generation and identification of experimental hepatic metastases in a murine model. J. Natl. Cancer Inst. 1986, 76 (2), 309–322. Giavazzi, R.; Jessup, J. M.; Campbell, D. E.; Walker, S. M.; Fidler, I. J. Experimental nude mouse model of human colorectal cancer liver metastases. J. Natl. Cancer Inst. 1986, 77 (6), 1303–1308. Fidler, I. J. The pathogenesis of cancer metastasis: the ‘seed and soil’ hypothesis revisited. Nat. Rev. Cancer 2003, 3 (6), 453–458. D’Alessandro, A.; Pieroni, L.; Ronci, M.; D’Aguanno, S.; Federici, G.; Urbani, A. Proteasome inhibitors therapeutic strategies for cancer. Recent Pat. Anti-Cancer Drug Discovery 2009, 4 (1), 73–82. Uddin, S.; Ahmed, M.; Bavi, P.; El-Sayed, R.; Al-Sanea, N.; AbdulJabbar, A.; Ashari, L. H.; Alhomoud, S.; Al-Dayel, F.; Hussain, A. R.;
research articles
Tumor Growth and Metastasis of Colon Adenocarcinoma Cells
(30) (31) (32) (33) (34)
Al-Kuraya, K. S. Bortezomib (Velcade) induces p27Kip1 expression through S-phase kinase protein 2 degradation in colorectal cancer. Cancer Res. 2008, 68 (9), 3379–3388. Smith, L.; Lind, M. J.; Drew, P. J.; Cawkwell, L. The putative roles of the ubiquitin/proteasome pathway in resistance to anticancer therapy. Eur. J. Cancer 2007, 43 (16), 2330–2338. Iancu-Rubin, C.; Atweh, G. F. p27(Kip1) and stathmin share the stage for the first time. Trends Cell Biol. 2005, 15 (7), 346–348. Evans, A.; Lennard, T. W.; Davies, B. R. High-mobility group protein 1(Y): metastasis-associated or metastasis-inducing. J. Surg. Oncol. 2004, 88 (2), 86–99. Lotze, M. T.; Tracey, K. J. High-mobility group box 1 protein (HMGB1): nuclear weapon in the immune arsenal. Nat. Rev. Immunol. 2005, 5 (4), 331–342. Kuniyasu, H.; Chihara, Y.; Takahashi, T. Co-expression of receptor for advanced glycation end products and the ligand amphoterin associates closely with metastasis of colorectal cancer. Oncol. Rep. 2003, 10 (2), 445–448.
(35) Kuniyasu, H.; Sasaki, T.; Sasahira, T.; Ohmori, H.; Takahashi, T. Depletion of tumor-infiltrating macrophages is associated with amphoterin expression in colon cancer. Pathobiology 2004, 71 (3), 129–136. (36) Sasahira, T.; Akama, Y.; Fujii, K.; Kuniyasu, H. Expression of receptor for advanced glycation end products and HMGB1/ amphoterin in colorectal adenomas. Virchows Arch. 2005, 446 (4), 411–415. (37) Bassi, R.; Giussani, P.; Anelli, V.; Colleoni, T.; Pedrazzi, M.; Patrone, M.; Viani, P.; Sparatore, B.; Melloni, E.; Riboni, L. HMGB1 as an autocrine stimulus in human T98G glioblastoma cells: role in cell growth and migration. J. Neurooncol. 2008, 87 (1), 23–33. (38) Lin, Y. H.; Park, Z. Y.; Lin, D.; Brahmbhatt, A. A.; Rio, M. C.; Yates, J. R.; Klemke, R. L. Regulation of cell migration and survival by focal adhesion targeting of Lasp-1. J. Cell Biol. 2004, 165 (3), 421–432.
PR9001367
Journal of Proteome Research • Vol. 9, No. 1, 2010 49
