Article Cite This: Chem. Mater. XXXX, XXX, XXX−XXX
pubs.acs.org/cm
Thiabicyclononane-Based Hyperbranched Polycations for Low-Dose Oligonucleotide Delivery Zhishuai Geng, Mark Garren, and M. G. Finn* School of Chemistry & Biochemistry, School of Biological Sciences, Georgia Institute of Technology, 901 Atlantic Drive, Atlanta, Georgia 30332, United States
Downloaded via UNIV OF SOUTH DAKOTA on November 12, 2018 at 20:42:36 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
S Supporting Information *
ABSTRACT: Hyperbranched bicyclo[3.3.1]nonane (BCN) polycations were synthesized by the reaction of the bivalent electrophile thiabicyclo[3.3.1]nonane dinitrate with a series of simple tris(pyridine) nucleophiles, including one alkynecontaining nucleophile to allow for postpolymerization functionalization. The hyperbranched polymers were found to be efficient binders of nucleic acid and exhibited higher efficiencies for oligo DNA and siRNA transfection than their linear counterparts, enabling knockdown at low siRNA concentrations to a superior extent than standard hyperbranched polyethylenimine and lipofectamine transfection agents. The use of an amide-containing linkage in the tris(pyridine) building block was found to be highly advantageous, but built-in fragmentability of the polycation structure, a unique potential feature of this new family of materials, did not give significantly better performance.
■
and reliable nature enabled by anchimeric assistance.26,27 We have recently shown it to be particularly well suited to the production of fragmentable cationic linear oligomers and polymers with applications to gene delivery28 and antimicrobial function.29 Rather than assembling charged monomers, positive charge is only created in BCN-based polyionenes by each substitution event and disappears when the linkage fragments in the course of anchimerically assisted hydrolysis. This degradation mechanism is unique among well-studied polyamine/polyionene-based materials. Combining the roles of charge creation and degradation provides interesting opportunities for the design and construction of new materials for polynucleotide binding and transport. Here we describe the synthesis of a new class of functional fragmentable hyperbranched polycationic molecules based on the BCN motif, represented schematically in Figure 1. We have explored the often counterbalancing properties of transfection and cytotoxicity and arrived at a formulation that exhibits desirable siRNA transfection efficiency at low doses.
INTRODUCTION Cationic polymers have attracted significant attention as potentially safe, scalable, and tailorable vectors for polynucleotide delivery into cells.1−4 The majority of such materials are polyamines that require protonation to carry charge. Among these is the common transfection standard, polyethylenimine (PEI),5 which suffers from high cytotoxicity and comparatively low efficiency compared with viral vectors. Linkers such as esters,6 acetals/ketals,7 imines,8,9 and disulfide bonds,10 each of which are cleavable with acid or cytosolic reducing agents, have been recently employed to connect branched PEI or similar fragments. These hybrid materials have exhibited lower toxicity than linear PEI counterparts, resulting in transfection agents with better biodegradability and faster clearance rate in cells, at the cost of some loss of charge density per unit mass. The property of charge density makes the polyionenes an attractive class of compounds for cation-based applications. This class of materials, defined by the installation of quaternary ammonium centers in the main chain by C−N bond-forming substitution reactions,11,12 are thermally and chemically stable at physiological temperature.13 Their nonbiodegradable nature can limit their use in biomedical application.14 Very few reports exist of hyperbranched polyionenes applied to gene delivery,15−18 although the potential benefits of hyperbranched structures for the formation of polycation/DNA complexes and gene/drug delivery with other polymeric materials, such as polyesters,19−21 have been described. We have explored the substitution chemistry of bicyclo[3.3.1]nonane (BCN) electrophiles22−25 for its fast © XXXX American Chemical Society
■
RESULTS AND DISCUSSION Polycation Synthesis and Characterization. Racemic 9thiabicyclo[3.3.1]nonyl dinitrate (prepared in situ by mixing 1 and silver nitrate) was condensed with tris(pyridine) trinucleophiles 2 at room temperature to provide novel Received: July 15, 2018 Revised: October 21, 2018
A
DOI: 10.1021/acs.chemmater.8b02993 Chem. Mater. XXXX, XXX, XXX−XXX
Article
Chemistry of Materials
Figure 1. Schematic representation of condensation polymerization and depolymerization of BCN-based hyperbranched polycations, both processes taking place via anchimeric assistance.
on the same pyridine to greatly reduce its nucleophilicity. Consistent with previous observations,28 these newly made linkages between monomers are highly dynamic under physiological conditions with half-lives determined by the nucleophilicity (basicity) of pyridine moiety. Thus, pyridines lacking electron-withdrawing groups are more difficult to eject by internal attack of the β thioether, decelerating the formation of the episulfonium intermediate (illustrated in brackets in Figure 1). Thus, 3a (derived from 4-methylpyridine, calculated pKa = 5.23) is not likely to fragment at all while 3b (derived from alkyl isonicotinamide, calculated pKa = 3.16) and 3c (from 5-bromoisonicotinamide, calculated pKa = 1.22) should be stable for hundreds and tens of hours, respectively, at 37 °C and pH 7.4. Random copolymers 3d−3f were also prepared with two different trinucleophiles (2b and 2c) or one trinucleophile and one dinucleohile (2b or 2c, with 2d). The degree of polymerization indicated by NMR and GPC analyses was comparatively low compared with homopolymers prepared with same monomers. Copolymer 3d, constructed with pyridines of differing nucleophilicity (and therefore leaving group ability), exhibited the expected two-stage fragmentation behavior. Thus, NMR analysis revealed almost all of the 3bromo-5-amidopyridine connections (from 2c) to have fragmented after 22 h in D2O at 37 °C, while the isonicotinamide connections (from 2b) required more than 120 h to disconnect (Figure S2). An additional functional group was incorporated by blending in 5% (relative to total pyridine) of the terminal alkyne-containing monomer 2d without significantly altering the properties of the resulting hyperbranched polycation. The resulting “clickable” material 3e was successfully addressed with a rhodamine azide, verified by GPC with monitoring at wavelengths appropriate for the detection of both pyridine (254 nm) and rhodamine (540 nm) groups (Figure S4). DNA and siRNA Binding. The branched polyionenes produced above were found to be efficient binders of DNA by agarose gel shift assay; a representative example is shown in Figure 2. The inhibition of electrophoretic migration of a 6.2 kb double-stranded plasmid was achieved by polyplex
hyperbranched polycations 3 in a simple and scalable procedure (Figure 1). The nucleophilic components were prepared by reductive amination of pyridine-4-carboxaldehyde with amine linkers or condensation of trivalent amines to 4pyridinecarboxylic acid. After reaction under standard conditions with equimolar amounts of the functional groups (electrophile 1 concentration = 0.3 M, nucleophile 2 concentration = 0.2 M, dry dimethyl sulfoxide solvent, room temperature, 18 h), the precipitated polycations were isolated by filtration and purified by a simple trituration procedure. Higher concentrations of monomer (>0.5 M) gave organogels that were difficult to purify. Characterization of polyelectrolyte hyperbranched materials such as these is challenging.30 It was assumed the second substitution reaction on each BCN core was substantially faster than the first, as has been observed in the reactivity of analogous small molecules26 and in previous step-growth polymerizations to assemble linear polycations.28 Therefore, each branch should be capped by the pyridine nucleophile. Differences in chemical shift of the pyridine protons made the determination of the ratio of alkylated to nonalkylated (endgroup) pyridines possible, but these ratios (Table 1) do not provide information on the size of the molecules because we do not know the degree to which cyclic structures are formed; ratios greater than 2 indicate some degree of cyclization (see Supporting Information for a brief discussion of this point.) Gel permeation chromatography (GPC) was also performed in a high-ionic strength ternary solvent mixture to minimize ionic interactions (Figure S3). While the lack of appropriate standards and well-known interactions between polyionenes and the stationary phase31 made the assignment of absolute molecular weights impossible, relative comparisons could be made. All of these materials, along with commercial hyperbranched PEI, displayed bimodal molecular weight distributions. Using the same conditions, three hyperbranched polycations (3a−3c) were prepared from the tris(pyridine) linkers as shown in Table 1. The synthetic procedure proved to be modular, giving materials of similar size (n ≈ 10) except for monomer 2c with two electron-withdrawing groups installed B
DOI: 10.1021/acs.chemmater.8b02993 Chem. Mater. XXXX, XXX, XXX−XXX
Article
Chemistry of Materials Table 1. Components and Characterization of Hyperbranched BCN Polycations
Figure 2. (A) Agarose gel electrophoresis of plasmid DNA mixed with polycations 3b or 3c at various N/P ratios. (B) Agarose gel electrophoresis of polyplex assembled with plasmid DNA and 3c incubated at 37 °C for different times. Both supercoiled (lower band) and relaxed (upper band) DNA appears after release from fragmented 3c, indicating either endonuclease contamination or polycationenhanced relaxation.
a
n = ratio of alkylated to unreacted pyridine (chain end) determined by 1 H NMR. b Apparent number-average molecular weight determined by GPC (most showing bimodal traces) in 54/23/23 (v/v/v %) water/methanol/acetic acid containing 0.5 M NaOAc, referenced against linear polyethylene glycol. cApproximate lifetime of the pyridine-BCN bonds at 37 °C, estimated from the half-life of analogous linear polycations in pure D2O. The half-life of each polymer is much less than this, depending on what degree of fragmentation is required for the polymer to have been judged decomposed. “no decomp.” means no observable fragmentation by NMR after incubation for 21 days; blank entry = not determined. d Polymer L3a reported in reference 28.
Figure 3. (A) Hydrodynamic radii (Rh) of polyplexes formed from the indicated polycation and a 21-mer duplex DNA at N/P ratio of 28. L3a = a linear analogue of 3a previously made with a bis(pyridine) nucleophile (Table 1).28 BPEI = branched polyethylenimine obtained from commercial supplier, Mn = 60 kDa. (B) Hydrodynamic radii of polyplexes assembled from different hyperbranched polycations and 21-mer duplex DNA or siRNA at different N/P ratios. These duplexes were similar in sequence, with T vs U substitutions (see Supporting Information).
In Vitro Transfection Efficiency. The transfection of siRNA into HeLa cells by stable and fragmentable hyperbranched polycations was assessed as shown in Figure 4. To screen for a balance of toxicity and transfection efficiency, the concentration of each polycation was varied for a constant siRNA concentration of 10 nM. Optimal N/P ratios were determined for 3a−c and PEI, defined as the formulation achieving maximum transfection efficiency while maintaining greater than 80% cell viability (Figure S6). Among the three new polycations, 3b had the best profile, indistinguishable from that of Lipofectamine and branched PEI at a far lower N/P ratio than the latter. In the two direct comparisons, branched polycations were more effective than linear (BPEI vs PEI, 3a vs L3a, although the latter do not involve completely analogous building blocks) at their respective optimal N/P ratios, even though the size of polyplexes are not dramatically different (Figures 3A and 4). Similar reports have appeared, assigned in part to higher membrane affinities of hyperbranched architectures compared to other polycations.17,18 In our case, the branched structures also have an additional basic N center in each tripodal nucleophile monomer, which may provide a better “proton sponge” effect than the linear analogues, although we have not tested this hypothesis.34 When employed
formation with polymer 3b at N/P ratios of 7 and with 3c at an N/P ratio of approximately 11 (Figure 2A), comparable to other reported polycations.9,32,33 Dynamic light scattering analysis showed the size of polyplexes assembled from 21-basepaired DNA or RNA with each of the hyperbranched polycations, including branched PEI, to be very similar (60− 90 nm radius) at the same N/P ratio (Figure 3A), and not to vary much at different N/P ratios (Figure 3B). Release of DNA or RNA from the polyplexes was observed at relative rates corresponding roughly to the decomposition behavior of the component polycations. Thus, the 3c-DNA polyplex remained largely intact for 24 h at 37 °C, but released most of its DNA by 72 h (Figure 2B). In contrast, the corresponding 3b-derived polyplex showed little DNA release after 72 h at 37 °C, but nearly complete release after 24 h at 60 °C (Supporting Information). While we have not yet confirmed this with quantitative measurements, it appears that the polycation may be somewhat stabilized against fragmentation when complexed with oligo or polynucleotide. C
DOI: 10.1021/acs.chemmater.8b02993 Chem. Mater. XXXX, XXX, XXX−XXX
Article
Chemistry of Materials
others. Control experiments showed dye-labeled DNA alone to be unable to enter the cells, and the linear polycation L3a to be much less efficient than any of the branched materials in mediating cell entry of fluorescently labeled DNA (Supporting Information).
■
CONCLUSIONS A new class of fragmentable hyperbranched polycations has been developed through facile nucleophilic substitution of bicyclo[3.3.1]nonane scaffolds under mild conditions. The stabilities of polycations toward spontaneous fragmentation were varied by using pyridine units of varying nucleophilicity. These hyperbranched polymers were efficient complexing agents of oligo- and polynucleotides, and showed promising low-dose siRNA transfection behavior. Polycation 3b was far superior to 3a in terms of polynucleotide binding (N/P ratio) and transfection efficiency; the structural difference between the two cases being the presence of a slightly longer, amidecontaining chain connecting the charge-carrying pyridine ring to the central N atom of the tripodal nucleophile. We have earlier observed that such amide-based linkers are far more active in related polycationic antimicrobial agents as well.29 For polynucleotide delivery, we were hoping that fragmentation of the polycation at rates comparable to the time scale of the transfection experiment would provide an advantage, but this was not the case in the example tested (3c). Further studies of detailed structure−activity relationships and the delivery of functional oligonucleotides in other target cells are ongoing; this initial report suggests that these novel hyperbranched polycations are worth exploring for biomolecular and materials applications.
Figure 4. Box-and-whisker plots summarizing the results of transfection experiments at optimal N/P ratios for each polycation. Closed red diamonds = knockdown of GFP expression in GFP-HeLa cells using siRNA (10 nM), normalizing GFP fluorescence intensity to untreated cells. Open black diamonds = cell viability assessed by MTT assay relative to cells treated with buffer. LPEI = linear polyethylenimine (Mn = 8 kDa); BPEI and L3a defined as in Figure 3; Lipo = lipofectamine, used according to the supplier’s instructions.
with low doses35,36 of siRNA, 3b outperformed both PEI and Lipofectamine in knockdown efficiency (Figure 5).
■
METHODS
Representative Procedure for the Synthesis of Hyperbranched Polycations (Table 1). Compound 1 (19 mg, 0.09 mmol, 3 equiv), silver nitrate (30.6 mg, 0.18 mmol, 6 equiv), and the tris(pyridine) of interest (0.06 mmol, 2 equiv) were mixed in 1 mL of DMSO, and the solution was stirred overnight at room temperature under inert atmosphere. Solid AgCl was filtered out, and the resulting solution was added to 15 mL of CH2Cl2 to precipitate the desired product. The material was isolated by filtration and dried to give an off-white sticky solid. For copolymers incorporating bis(pyridine) 2d, compound 1 (19 mg, 0.09 mmol, 3 equiv), silver nitrate (30.6 mg, 0.18 mmol, 6 equiv), tris(pyridine) (0.0576 mmol, 0.0576 equiv) and 2d (0.0036 mmol, 0.0024 equiv) of interest were mixed in 1 mL of DMSO. Knockdown of Green Fluorescent Protein in GFP-HeLa Cells. siRNAs were obtained from Integrated DNA Technologies (Coralville, IA), with the following sequences. GFP sense: 5′CAAGCUGACCCUGAAGUUCUU, GFP antisense: 5′-GAACUUCAGGGUCAGCUUGUU. Approximately 10 000 GFP-HeLa cells/well were plated in a 96-well plate in 100 μL of complete growth media, and adhered overnight at 37 °C. For positive control experiments, 10 nM double-stranded siRNA was transfected with Lipofectamine RNAiMAX according to the manufacturer’s protocol. After 24 h, the media was replaced with complete growth media (100 μL/well). Fluorescence was measured 48 h post-transfection. For knockdown experiments with polyplexes, cells were plated as above and treated with 100 μL of hyperbranched polycation/ds-siRNA complexes at the indicated N/P ratios. Media was again replenished after 24 h. Fluorescence was measured 48 h post-treatment and cell viability measured as described below. Viability Assay. MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, 5 mg/mL, 25 μL per well] was added to each individual well, and the solutions were incubated at 37 °C for approximately 1 h (the assay was stopped when accumulated purple
Figure 5. Comparison of transfection performance at lower siRNA loading by BCN polycation 3b, commercially available branched PEI (60 kDa), and lipofectamine (analyzed by Student’s t test, *p < 0.05). GFP expression in GFP-HeLa cells is reported relative to buffertreated control.
Intracellular Localization. To examine intracellular trafficking, we purchased Cy5-labeled 21-mer DNA and covalently attached an azide derivative of rhodamine B to the alkyne groups of hyperbranched polymer 3e via CuAAC reaction (Supporting Information). The polyplexes formed from these components were incubated with B16-F10 melanoma cells and imaged at 4 and 24 h, the former data shown in Figure 6. These cells were chosen to assess trafficking in a cell type representing a potential therapeutic target. Both polycation and DNA were found to be closely associated with LysoTracker Green-stained acidic (endolysosomal) compartments (Figure 6) and occasionally larger structures (Supporting Information), validating the expectation, derived from many literature reports on PEI-based polyplexes and related materials,37−39 that uptake occurs through endocytosis into both endosomes and related vacuoles. Similar confocal images were recorded for polyplexes derived from 3b, 3c, and BPEI (Supporting Information); no significant differences were observed for the fragmentable material (3c) compared to the D
DOI: 10.1021/acs.chemmater.8b02993 Chem. Mater. XXXX, XXX, XXX−XXX
Article
Chemistry of Materials
Figure 6. Confocal fluorescence microscopy of B16-F10 cells treated with polyplexes made from Cy5-DNA (50 nM) and 3e (10 μg/mL), incubated for 4 h. (a) Lysotracker Green (green), (b) Cy5-DNA (red), (c) DAPI (blue), (d) 3e−rhodamine conjugate (yellow), (e) brightfield image, (f) overlay. Scale bars = 10 μm.
■
formazan crystals were visible in the control wells). The media was carefully aspirated, and DMSO was added (200 mL per well) to dissolve the purple MTT−formazan crystals. Absorbance of the dissolved formazan was quantified at 570 nm by using a UV−vis plate reader, and cell viability was determined as a fraction of absorbance relative to untreated control wells.
■
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.chemmater.8b02993. Experimental details and additional data (PDF)
■
AUTHOR INFORMATION
Corresponding Author
*M. G. Finn. E-mail: mgfi
[email protected]. ORCID
Zhishuai Geng: 0000-0001-6124-3354 M. G. Finn: 0000-0001-8247-3108 Funding
This work was supported by the National Science Foundation (CHE 1011796) and by a research partnership between Children’s Healthcare of Atlanta and the Georgia Institute of Technology. Notes
The authors declare no competing financial interest.
■
REFERENCES
(1) Samal, S. K.; Dash, M.; Van Vlierberghe, S.; Kaplan, D. L.; Chiellini, E.; van Blitterswijk, C.; Moroni, L.; Dubruel, P. Cationic polymers and their therapeutic potential. Chem. Soc. Rev. 2012, 41 (21), 7147−7194. (2) Russ, V.; Elfberg, H.; Thoma, C.; Kloeckner, J.; Ogris, M.; Wagner, E. Novel degradable oligoethylenimine acrylate ester-based pseudodendrimers for in vitro and in vivo gene transfer. Gene Ther. 2008, 15 (1), 18−29. (3) Luo, D.; Saltzman, W. M. Synthetic DNA delivery systems. Nat. Biotechnol. 2000, 18 (1), 33−37. (4) Green, J. J.; Langer, R.; Anderson, D. G. A Combinatorial Polymer Library Approach Yields Insight into Nonviral Gene Delivery. Acc. Chem. Res. 2008, 41 (6), 749−759. (5) Godbey, W. T.; Wu, K. K.; Mikos, A. G. Poly(ethylenimine) and its role in gene delivery. J. Controlled Release 1999, 60 (2), 149−160. (6) Yue, Y.; Wu, C. Progress and perspectives in developing polymeric vectors for in vitro gene delivery. Biomater. Sci. 2013, 1 (2), 152−170. (7) Knorr, V.; Russ, V.; Allmendinger, L.; Ogris, M.; Wagner, E. Acetal Linked Oligoethylenimines for Use As pH-Sensitive Gene Carriers. Bioconjugate Chem. 2008, 19 (8), 1625−1634. (8) Kim, Y. H.; Park, J. H.; Lee, M.; Kim, Y.-H.; Park, T. G.; Kim, S. W. Polyethylenimine with acid-labile linkages as a biodegradable gene carrier. J. Controlled Release 2005, 103 (1), 209−219. (9) Chen, G.; Wang, Y.; Xie, R.; Gong, S. Tumor-targeted pH/redox dual-sensitive unimolecular nanoparticles for efficient siRNA delivery. J. Controlled Release 2017, 259, 105−114. (10) Lin, C.; Zhong, Z.; Lok, M. C.; Jiang, X.; Hennink, W. E.; Feijen, J.; Engbersen, J. F. J. Novel Bioreducible Poly(amido amine)s for Highly Efficient Gene Delivery. Bioconjugate Chem. 2006, 18 (1), 138−145. (11) Abboud, J.-u. M.; Notario, R.; Bertrán, J.; Solà, M. One Century of Physical Organic Chemistry: The Menshutkin Reaction. In Prog. Phys. Org. Chem.; John Wiley & Sons, Inc.: 2007; pp 1−182. (12) Williams, S. R.; Borgerding, E. M.; Layman, J. M.; Wang, W.; Winey, K. I.; Long, T. E. Synthesis and Characterization of WellDefined 12,12-Ammonium Ionenes: Evaluating Mechanical Proper-
ACKNOWLEDGMENTS
We are grateful to Mr. Wenbin Wei and Dr. Jiajia Xue for assistance with confocal fluorescent microscopy. We are also grateful for an initial gift of siRNA from Integrated DNA Technologies for pilot studies. E
DOI: 10.1021/acs.chemmater.8b02993 Chem. Mater. XXXX, XXX, XXX−XXX
Article
Chemistry of Materials ties as a Function of Molecular Weight. Macromolecules 2008, 41 (14), 5216−5222. (13) Williams, S. R.; Long, T. E. Recent advances in the synthesis and structure−property relationships of ammonium ionenes. Prog. Polym. Sci. 2009, 34 (8), 762−782. (14) Albuzat, T.; Keil, M.; Ellis, J.; Alexander, C.; Wenz, G. Transfection of luciferase DNA into various cells by cationic cyclodextrin polyrotaxanes derived from ionene-11. J. Mater. Chem. 2012, 22 (17), 8558−8565. (15) Fischer, W.; Calderón, M.; Haag, R. Hyperbranched Polyamines for Transfection. In Nucleic Acid Transfection; Bielke, W., Erbacher, C., Eds.; Springer: Berlin, Heidelberg, 2010; pp 95−129. (16) Luo, K.; He, B.; Wu, Y.; Shen, Y.; Gu, Z. Functional and biodegradable dendritic macromolecules with controlled architectures as nontoxic and efficient nanoscale gene vectors. Biotechnol. Adv. 2014, 32 (4), 818−830. (17) Kadlecova, Z.; Rajendra, Y.; Matasci, M.; Baldi, L.; Hacker, D. L.; Wurm, F. M.; Klok, H.-A. DNA delivery with hyperbranched polylysine: A comparative study with linear and dendritic polylysine. J. Controlled Release 2013, 169 (3), 276−288. (18) Synatschke, C. V.; Schallon, A.; Jérôme, V.; Freitag, R.; Müller, A. H. E. Influence of Polymer Architecture and Molecular Weight of Poly(2-(dimethylamino)ethyl methacrylate) Polycations on Transfection Efficiency and Cell Viability in Gene Delivery. Biomacromolecules 2011, 12 (12), 4247−4255. (19) Qi, M.; Duan, S.; Yu, B.; Yao, H.; Tian, W.; Xu, F.-J. PGMAbased supramolecular hyperbranched polycations for gene delivery. Polym. Chem. 2016, 7 (26), 4334−4341. (20) Duan, S.; Yu, B.; Gao, C.; Yuan, W.; Ma, J.; Xu, F.-J. A Facile Strategy to Prepare Hyperbranched Hydroxyl-Rich Polycations for Effective Gene Therapy. ACS Appl. Mater. Interfaces 2016, 8 (43), 29334−29342. (21) Huang, Y.; Ding, X.; Qi, Y.; Yu, B.; Xu, F.-J. Reductionresponsive multifunctional hyperbranched polyaminoglycosides with excellent antibacterial activity, biocompatibility and gene transfection capability. Biomaterials 2016, 106, 134−143. (22) Weil, E. D.; Smith, K. J.; Gruber, R. J. Transannular Addition of Sulfur Dichloride to Cyclooctadienes. J. Org. Chem. 1966, 31 (6), 1669−1679. (23) Corey, E. J.; Block, E. New Synthetic Approaches to Symmetrical Sulfur-Bridged Carbocycles. J. Org. Chem. 1966, 31 (6), 1663−1668. (24) Lautenschlaeger, F. THE REACTION OF SULFUR DICHLORIDE WITH cis,cis-1,5-CYCLOOCTADIENE. Can. J. Chem. 1966, 44 (23), 2813−2817. (25) Vincent, J. A. J. M.; Schipper, P.; de Groot, A.; Buck, H. M. Neighboring group participation of sulfur in carbonium ions. Observation of a sulfurane-like intermediate. Tetrahedron Lett. 1975, 16 (24), 1989−1992. (26) Converso, A.; Burow, K.; Marzinzik, A.; Sharpless, K. B.; Finn, M. G. 2,6-Dichloro-9-thiabicyclo[3.3.1]nonane: A Privileged, Bivalent Scaffold for the Display of Nucleophilic Components. J. Org. Chem. 2001, 66 (12), 4386−4392. (27) Accurso, A. A.; Cho, S.-H.; Amin, A.; Potapov, V. A.; Amosova, S. V.; Finn, M. G. Thia-, Aza-, and Selena[3.3.1]bicyclononane Dichlorides: Rates vs Internal Nucleophile in Anchimeric Assistance. J. Org. Chem. 2011, 76 (11), 4392−4395. (28) Geng, Z.; Finn, M. G. Fragmentable Polycationic Materials Based on Anchimeric Assistance. Chem. Mater. 2016, 28 (1), 146− 152. (29) Geng, Z.; Finn, M. G. Thiabicyclononane-Based Antimicrobial Polycations. J. Am. Chem. Soc. 2017, 139 (43), 15401−15406. (30) Namivandi-Zangeneh, R.; Kwan, R. J.; Nguyen, T.-K.; Yeow, J.; Byrne, F. L.; Oehlers, S. H.; Wong, E. H. H.; Boyer, C. The effects of polymer topology and chain length on the antimicrobial activity and hemocompatibility of amphiphilic ternary copolymers. Polym. Chem. 2018, 9 (13), 1735−1744. (31) Layman, J. M.; Borgerding, E. M.; Williams, S. R.; Heath, W. H.; Long, T. E. Synthesis and Characterization of Aliphatic
Ammonium Ionenes: Aqueous Size Exclusion Chromatography for Absolute Molecular Weight Characterization. Macromolecules 2008, 41 (13), 4635−4641. (32) Zhang, Q.-F.; Yi, W.-J.; Wang, B.; Zhang, J.; Ren, L.; Chen, Q.M.; Guo, L.; Yu, X.-Q. Linear polycations by ring-opening polymerization as non-viral gene delivery vectors. Biomaterials 2013, 34 (21), 5391−5401. (33) Ping, Y.; Wu, D.; Kumar, J. N.; Cheng, W.; Lay, C. L.; Liu, Y. Redox-Responsive Hyperbranched Poly(amido amine)s with Tertiary Amino Cores for Gene Delivery. Biomacromolecules 2013, 14 (6), 2083−2094. (34) Benjaminsen, R. V.; Mattebjerg, M. A.; Henriksen, J. R.; Moghimi, S. M.; Andresen, T. L. The Possible ″Proton Sponge″ Effect of Polyethylenimine (PEI) Does Not Include Change in Lysosomal pH. Mol. Ther. 2013, 21 (1), 149−157. (35) Wang, H.; Wang, Y.; Wang, Y.; Hu, J.; Li, T.; Liu, H.; Zhang, Q.; Cheng, Y. Self-Assembled Fluorodendrimers Combine the Features of Lipid and Polymeric Vectors in Gene Delivery. Angew. Chem., Int. Ed. 2015, 54 (40), 11647−11651. (36) Kozielski, K. L.; Tzeng, S. Y.; Hurtado De Mendoza, B. A.; Green, J. J. Bioreducible Cationic Polymer-Based Nanoparticles for Efficient and Environmentally Triggered Cytoplasmic siRNA Delivery to Primary Human Brain Cancer Cells. ACS Nano 2014, 8 (4), 3232− 3241. (37) Mennesson, E.; Erbacher, T.; Piller, V.; Kieda, C.; Midoux, P.; Pichon, C. Transfection efficiency and uptake process of polyplexes in human lung endothelial cells: a comparative study in non-polarized and polarized cells. J. Gene Med. 2005, 7 (6), 729−738. (38) Van der Aa, M. A. E. M.; Huth, U. S.; Hafele, S. Y.; Schubert, R.; Oosting, R. S.; Mastrobattista, E.; Hennink, W. E.; Peschka-Süss, R.; Koning, G. A.; Crommelin, D. J. A. Cellular Uptake of Cationic Polymer-DNA Complexes Via Caveolae Plays a Pivotal Role in Gene Transfection in COS-7 Cells. Pharm. Res. 2007, 24 (8), 1590−1598. (39) Kim, J.; Sunshine, J. C.; Green, J. J. Differential Polymer Structure Tunes Mechanism of Cellular Uptake and Transfection Routes of Poly(β-amino ester) Polyplexes in Human Breast Cancer Cells. Bioconjugate Chem. 2014, 25 (1), 43−51.
F
DOI: 10.1021/acs.chemmater.8b02993 Chem. Mater. XXXX, XXX, XXX−XXX
