Three-Dimensional Stiff Graphene Scaffold on Neural Stem Cells

Subscriber access provided by NEW YORK UNIV

Article

Three-Dimensional Stiff Graphene Scaffold on Neural Stem Cells Behavior Qinqin Ma, Lingyan Yang, Ziyun Jiang, Qin Song, Miao Xiao, Dong Zhang, Xun Ma, Tieqiao Wen, and Guosheng Cheng ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.6b12305 • Publication Date (Web): 18 Nov 2016 Downloaded from http://pubs.acs.org on December 2, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Three-Dimensional Stiff Graphene Scaffold on Neural Stem Cells Behavior

Qinqin Maa,b, Lingyan Yanga, Ziyun Jianga, Qin Songa, Miao Xiaoa, Dong Zhanga, Xun Maa, Tieqiao Wenb, Guosheng Cheng*a

a

Key Laboratory of Nano-Bio Interface, Suzhou Institute of Nano-Tech and Nano-Bionics,

Chinese Academy of Sciences, 398 Ruoshui Road, Suzhou Industrial Park, Jiangsu 215123, P. R. China b

School of Life Sciences, Shanghai University, 99 Shangda Road, Shanghai 200444, P. R.

China

Correspondence: Guosheng Cheng, Ph.D., 398 Ruoshui Road, Suzhou Industrial Park, Jiangsu 215123, P. R. China. Telephone: 0512-62872557; Fax: 0512-62872546; E-mail: [email protected].

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract: : Physical cues of the scaffolds, elasticity and stiffness, significantly guide adhesion, proliferation and differentiation of stem cells. In addressable micro-environments constructed by three-dimensional graphene foams (3D-GFs), neural stem cells (NSCs) interact and respond on structural geometry and mechanical properties of the porous scaffolds. Our studies aim to investigate NSCs behavior on the various stiffness of 3D-GFs. Two kinds of 3D-GFs scaffolds present soft and stiff properties with the elasticity moduli of 30 and 64 kPa, respectively. Stiff scaffold enhanced NSCs attachment and proliferation as vinculin and integrin gene expression were up-regulated by 2.3 and 1.5 folds, respectively, compared with the soft one. Meanwhile, up-regulated Ki67 expression and almost no variation of nestin expression in a group of the stiff scaffold were observed, implying that the stiff substrate fosters NSCs growth and keeps the cells in an active stem state. Furthermore, NSCs grown on stiff scaffold exhibited enhanced differentiation to astrocytes. Interestingly, differentiated neurons on stiff scaffold are suppressed since growth associated protein-43 expression was significantly improved by 5.5 folds.

KEYWORDS: Three-dimensional graphene scaffolds, stiffness, neural stem cells, proliferation, differentiation


Page 2 of 30

Page 3 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Neural stem cells (NSCs) have great potential to self-renew and differentiate into neurons, astrocytes and oligodendrocytes.1 NSCs are believed to be one of promising candidates to treat spinal cord injury, neurodegenerative diseases, ischemic stroke and traumatic brain injury.2-5 For cells engraftment, stem cells function and behavior are governed by native micro-environments,6 such as physical factors (topology and stiffness), chemical factors (secreted factors) and biological factors (growth factors). Physical factors such as electrical, thermal7 and flash-photo pulses8 have been demonstrated to induce NCSs proliferation and differentiation. The cells proliferation and differentiation are tuned by a complex interplay of soluble factors and substrates, as the signaling pathways are activated by integrins integrating with intracellular proteins.9 Increasing evidences have demonstrated that physical properties of substrates, such as topological cues, dimensionality and stiffness, have significantly manipulated cells adhesion, proliferation and differentiation.10-13 Mesenchymal stem cells (MSCs) prefer to adhere and proliferate on graphene films than on SiO2 substrates owing to their unique roughness and texture.14 The gene and protein expressions of cells adhesion,15 proliferation and differentiation16 are regulated by substrate mechanical properties, resembling to soluble factors mediation. Elasticity modulus, as a indicator of mechanical properties, can be used to define the 3 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

substrates stiffness in biological system. Manipulating the substrate stiffness can direct stem cells to differentiate into various cells lineage. To date, very few literatures attempt to address the relation between substrate stiffness and stem cell functions. Graphenes have attracted great attention due to their extraordinary physical and chemical properties and their great utilizations in biomedical engineering,17 such as drug delivery, cellular imaging18 and bio-analysis.19 Three-dimensional graphene foams (3D-GFs) as a novel scaffold for NSCs culture have been reported to promote differentiation of NSCs into neurons20. 3D-GFs scaffolds display a rough surface, interconnected porous network with tunable orientations,21 high porosity and specific surface area, mimicking extracellular matrix micro-environments. Unfortunately, the mechanism was not yet understood well. This work emphasizes on the effect of 3D-GFs stiffness on cells adhesion, proliferation and differentiation.

2. EXPERIMENTAL SECTION 2.1. Neural Stem Cells Cultures. Neural stem cells were obtained from the hippocampus zones of postnatal 1 day ICR mouse brains. Hippocampus were removed and collected in falcon tubes, then dissociated into trypsin (Gibco, USA) for 20 minutes at 37 oC. Tissues were gently triturated by using pipet tips to yield a cell suspension cultured in DMEM/F12 (Gibco, USA) medium containing supplemental 2% B27 (Gibco, USA), penicillin-streptomycin (Gibco, USA) and epidermal growth factor (EGF) (20 ng/mL) and


Page 4 of 30

Page 5 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fibroblast growth factor (FGF) (20 ng/mL). Before seeding NSCs, the graphenes were coated with Ploy-L-Ornithine (PLO, 10 mg/mL, 37 oC, 40 minutes, Sigma, USA) and Laminin (LN, 20 mg/mL, 37 oC, overnight, Sigma, USA), then soaked into medium before using them. The cells usually cultured in 5% CO2 humidified atmosphere at 37 oC and formed neurosphere after 4 days culture. For the proliferation, cells were seeded at a density of

15 × 104

cells/mL.

2.2. Graphene Scaffold Fabrication. The 3D-GFs in this study were synthesized following previously published work using porous Ni foam as a growth template (Alantum Advanced Technology Materials, China). Firstly, the porous Ni foam temples were extruded up to 75%. The 3D-GFs were synthesized by chemical vapor deposition (CVD) using the original and extruded Ni foam as templates. Briefly, the porous Ni template was heated up to 1000 oC and annealed for 20 min under H2 and Ar gases, followed by exposuring to H2 and CH4 for 5 min. Finally, the CVD system was cooled down to the room temperature under H2 and Ar gases. The obtained samples were seeded into FeCl3 solution for ~48 hours at room temperature to keep three-dimensional structure of the graphene scaffolds by chemically etching Ni. Then use graded hydrochloric acid solution of 1.0 and 0.1 M solution, followed by rinsing the sample by deionized water for two times. The freestanding 3D-GFs were sterilized by 75% ethylalcohol and submerged into sterile PBS. Then coat samples with PLO and LN.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The 3D-GFs fabricated with original Ni templates were defined as soft scaffold and with the extruded one as stiff scaffold.

2.3 Mechanical Properties Measurements. In order to measure the mechanical properties of 3D-GF scaffolds, soft and stiff scaffolds whith a size of ~1×1 cm were mounted on the grip of an Instron Series. A crosshead speed of 0.2 mm/min and full-scale load range of 10 N were used for the test at 23 oC and a humidity of 50%. Young’s modulus, load and displacement were recorded as indicators of the mechanical properties of the samples.22

2.4. Scanning Electron Microscopy (SEM) Examinations. After culture for 4 days, NSCs grown on 3D-GFs scaffolds were washed with PBS for 2 times, then fixed with 2.5% glutaraldehyde and 1% osmium tetroxide for 30 minutes under 4 oC. The samples were dehydrated by gradient ethanol series, 30%, 50%, 70%, 80%, 90%, followed by lyophilization, coated with gold for 2 minutes, and morphology examination by scanning electron microscopy.

2.5. Immunofluorescence Analysis. To assay the proliferation of NSCs on the scaffolds, Ki67 and BrdU were stained after 4 days of culture in proliferation medium. For Ki67 staining, NSCs were fixed in 4% Paraformaldehyde for 30 minutes, permeabilized using 0.2% Triton X-100 in PBS and blocked with 5% albumin from bovine serum albumin (BSA). Then fixed samples were incubated with primary antibody rabbit anti-Ki67 (1:1000, Abcam, USA) overnight under 4 oC, followed by incubation with rabbit secondary antibody


Page 6 of 30

Page 7 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


conjugated to Alexa Fluor 594 (1:500, Abcam, USA) for 1 hour at room temperature. Finally, 4, 6-diamidino-2 phenylindole (DAPI) (1:1000, Sigma, USA) was used to stain cells nuclei. For BrdU staining, cells were washed in PBS for 2 times after incubation for 4 days, fixed using 4% Paraformaldehyde for 20 minutes under 4 oC. After washed 2 times with PBS, samples were permeabilized by 3% hydrogen peroxide for 10 minutes, incubated using 1.0 M HCl for 10 minutes on ice and 2.0 M HCl for 30 minutes at 37 oC. Then, apply 0.1 M Borate buffer to neutralize the reaction at room temperature. The samples were washed using 0.1% Triton X-100 for 3 times, blocked by Triton X-100 and BSA mixture for 1 hour at room temperature. The primary antibody rat anti-BrdU (1:250, Sigma, USA) incubated overnight, and goat anti-rat secondary antibody (1:500, Sigma, USA) incubated for 1 hour. The DAPI staining was similar with the Ki67. The differentiations of NSCs by immunofluorescence staining with specific markers were assessed by anti-glial fibrillary acidic protein (GFAP, 1:500, Millipore, Germany) and anti-β-Ⅲ tublin (Tuj1, Millipore, Germany) antibody.

2.6. Cell Viability Assay. Cell viability was assessed by MTT assay. NSCs were seeded on two scaffolds and cultured for 4 days. After discarding the medium, each plate was added medium mixed with 0.5mg/mL MTT（Sigma, USA）and incubated for additional 4 hours at 37 oC. The medium was removed, and the resulting crystals were dissolved by adding 150 µL DMSO (Sigma, USA). The absorbance was measured at 490 nm using a Multilabel Reader (Victor X4, 2030 Multilabel Reader, PerkinElmer). The LIVE/DEAD assays was



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

applied to evaluate cell viability by LIVE/DEAD viability/cytotoxicity kit for mammalian cells (Invitrogen, USA). Three independent experiments were repeated for each assay.

2.7. Quantitative Real-time PCR and Western Blot. Total RNA and protein of NSCs proliferation (4 days) and differentiation (7 days) were extracted from NSCs cultured on 3D-GFs scaffolds by TRIzol reagent (Life Technologies Corporation, USA) according to the manufacturer’s protocol. The mRNAs were converted to cDNA in 20 µL reaction volumes using PrimeScriptTM Rtreagent Kit (Perfect Real Time, Takala, Japan). Real-time PCR reactions were performed using SYBR Premix Ex Taq TM (Takala, Japan) following the manufacturer’s instruction and run on 7500 Real-Time PCR system (Applied Biosystems, USA). The mRNAs were amplified using gene-specific PCR primer sequences for mouse in Table 1. Collected proteins were separated using 8% SDS-PAGE gel, electrobloted onto PVDF membrane, and blocked with 5% skim milk solution for 1 hour at room temperature. The samples were incubated with primary antibodies overnight at room temperature. After washing, the blots were incubated by HRP-conjugated secondary antibodies under room temperature for 1 hour. The membrane was washed three times every 10 minutes with TBST, reacted by enhanced chemiluminescence before exposure, and analyzed with gel imager (LAS4000mini).


Page 8 of 30

Page 9 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.8. Statistical Analysis. All the experiments were repeated in three times, and data were showned as the mean ± standard deviation. A one-way analysis were performed by Tukey’s tests. The level of significance was set to *p < 0.05.

3. RESULT 3.1. Morphology and Mechanical Properties of Soft and Stiff 3D-GFs Scaffolds. In this work, two kinds of 3D-GFs were defined as soft scaffold (with Ni growth template) and stiff scaffold (with extruded 75% Ni growth template). Both soft and stiff 3D-GFs scaffolds were fabricated by chemical vapor deposition. The SEM images in Fig 1a and Fig 1b showed that both of graphene scaffolds were composed of highly connected and porous network structure of carbon element. The inter-space of stiff scaffold were smaller than that of soft scaffold. From the relative frequency histogram (Fig 1c & Fig 1d), the mean pore size of stiff scaffold was ~46 µm, mainly ranging from 30 µm to 60 µm, while the mean value of soft scaffold was ~117 µm, varying from 75 µm to 130 µm. Mechanical property of the scaffolds, namely elastic modulus, load and displacement were measured by Instron Series IX Automated Materials Testing System. The results showed in Fig 1e and Fig 1f. The substrate stiffness are evaluated by elastic modulus. When a force is applied to substrate, it resists to deformation by load-displacement curve. The loads were compressed until the samples were destroyed. A load-displacement curve and an elastic modulus were obtained. It was clear that the stiff sample had an elastic modulus at 64 ± 0.40



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

kPa while the soft sample at 30 ± 0.55 kPa. As a load was similar, the stiff one resisted to a smaller displacement, enabling to withstand the stronger mechanical stress than the soft one. When the pore size of the scaffold became small, the anti-pressure ability turned big. The absence of D band, representing the graphene defect degree, revealed the 3D-GFs had very few defects in microstructure as the ratio of 2D band and G band indicated that 3D-GFs scaffolds were consisted of single or multiple layer graphenes. Meanwhile, Raman measurements demonstrated that no obvious differences were observed for both soft and stiff scaffolds.

3.2. Cell Viability Study. NSCs viability analysis on 3D-GFs scaffolds for 4 days was conducted by MTT (3-[4, 5-dimethyl-2-yl]-2, 5-diphenyltetrazolium bromide) assay. No significant differences of cell viability were observed between two 3D-GFs scaffolds. Live/dead assay revealed the neglected differences of cell viability for soft and stiff scaffolds.

3.3. Attachment of NSCs Cultured on 3D-GFs Scaffolds. Cell adhesion plays an important role in regulating cells proliferation, differentiation, migration and apoptosis.12 The SEM micrographs in Fig 2 showed that NSCs well adhered to the scaffold surface. Meanwhile, NSCs on the surface of soft scaffold showed elongated cells protuberances while spreading protuberances on stiff one (Fig 2a & Fig 2b). In order to assess NSCs adhesion on soft and stiff samples, the genes expressions of vinculin, integrin and n-cadherin were tested by quantitative real-time PCR. Using β-actin as


Page 10 of 30

Page 11 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


a control quantifying the genes expression of NSCs. Vinculin, as a cytoskeletal protein associated with focal adhesion, regulates cells proliferation. For cells cultured on stiff sample, the expression of vinculin (Fig 2c) after 4 days culturing was enhanced by 2.3 folds comparing with the soft group. Integrins is trans-membrane receptors which involve a connection between cell and substrate. In the process of signal transduction, integrins transfer the information of substrate chemical composition and mechanical property into cells. The integrins expression was increased by 1.5 folds (Fig 2d). Additionally, 1.2 folds improvement was observed in the expression of n-cadherin (Fig 2e). These results indicted stiff scaffold promoted the adhesion of NSCs. Moreover, the western bolt results (Fig 2f) re-validated the adhesive molecules of the NSCs which preferred to adhere on stiff scaffold than on soft scaffold.

3.4. Proliferation of NSCs Cultured on 3D-GFs Scaffolds. An immunostaining assessment of proliferation ability of NSCs was conducted. First, NSCs were stained by nestin, a specific stemness marker. In Fig 3, both two samples presented high expressed nestin and similar real-time PCR results. BrdU, as a marker of proliferation, replacing thymine incorporated into nuclei during DNA synthetic phase of cell cycle, was employed (Fig 4a). We calculated the percentages of BrdU staining cells grown on soft and stiff scaffolds were 50.05% and 78.59%, respectively. Ki67 is a kind of a nucleoprotein, and also involves in cell cycles. Its expression generally exhibits cell proliferation activity. NSCs



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

cultured on two scaffolds for 4 days were stained for Ki67. In Fig 4b, the positive percentage of Ki67 staining observed in NSCs was 52.08% on the soft one and 80.59% on stiff scaffold. Ki67 positive cells grown on stiff scaffold were highly improved than those grown on soft one. BrdU positive cells had analogous percentages comparing with Ki67 positive cells. The up-regulation of Ki67 in NSCs on stiff scaffold was observed compared with the soft sample. In Fig 4d, western blot analysis showed higher expression of Ki67 protein cultured on stiff scaffold than the soft one. The stiffening 3D-GFs scaffold promoted NSCs proliferation.

3.5. Differentiation of NSCs Cultured on 3D-GFs Scaffolds. The differentiation effect of two graphene scaffolds on NSCs was assayed by the expressions of anti-βIII tublin (Tuj1, red) and glial fibrillary acidic protein (GFAP, green) after 7 days cultured in differential medium with retinoic acid and B27 (Fig 5a). Tuj1, as a specific neuron marker is highly expressed in neurons. Expression of GFAP, a kind Ⅲ type intermediate filament protein in astrocytes, indicates stem cells differentiate into astrocytes. Fig 5a showed the immunostaining images of Tuj1, GFAP and DAPI (blue) expressed on soft and stiff scaffolds, respectively. To quantify the differentiations of NSCs, we performed the real-time PCR analysis for Tuj1, GFAP and growth associated protein (GAP-43) expressed in NSCs. GAP-43 mainly exists in the axons of neurons, which associated with the axons maturation and neuritis branches. Real-time PCR results showed that the GFAP and GAP-43 expressions were up-regulated by 2.0 and 5.5 folds, respectively (Fig 5c & Fig 5d). But Tuj1 expression


Page 12 of 30

Page 13 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


presented an inverse result (Fig 5b) on stiff scaffold compared to on the soft one. The western blot was performed to re-validate the expression of gene associated with cells differentiation. The differentiated neurons and differentiated glia cells of NSCs on two kinds of 3D-GFs scaffolds were further quantified based on the protein expression of Tuj-1 and GFAP with Western Blot. As shown in Fig 5f, compared with the soft group. NSCs cultured on stiff scaffold exhibited lower Tuj1 expression by 1.89 folds, while the expressions of GFAP and GAP-43 were enhanced in cells by 2.05 and 5.8 folds, respectively. Proteins expressions of Tuj1, GFAP and GAP-43 were showed in Fig 5e. The expressions of NSCs differentiation were affected by the stiffness of 3D-GFs. NSCs tended to differentiate into astrocytes on stiff 3D-GFs scaffold.

4. DISCUSSION Previous research suggested that adhesion, proliferation and differentiation of NSCs are guided by diffusible growth factors, cell-matrix adhesions and cell-cell contacts.23-25 In addition, mechanical properties of extracellular matrix (ECM) are also recognized as the critical factors for cell functions. Physical properties of ECM, such as stiffness or elasticity, has been testified to affect cell behavior.26, 27 Graphene, a 2D monolayer crystal of carbon atoms with sp2 hybrid structure, possesses unique electrical properties, physical (elasticity, stiffness, roughness and porosity of the scaffolds) and chemical properties which involve into cells proliferation and differentiation. Different physical stimulations to NSCs, for example,



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

laser, flash-photo and near infrared laser stimulations are applied for graphene to direct NSCs differentiation towards neurons. But the effect of 3D-GFs scaffolds stiffness on NSCs have hardly reported.28 In this work, we focussed on NSCs function response onto the stiffness of 3D-GFs scaffolds. The surfaces of CVD-grown 3D-GFs scaffolds have many ripples and wrinkles which mimick the natural ECM. Our lab reported that neural stem cells on 3D-GFs grew well and could promote the proliferation and differentiation of neural stem cells.29 More reports indicate that substrates stiffness have significant influence on cells adhesion, proliferation, and differentiation.30, 31 Cells respond to the intracellular contraction since the rigidity of the ECM results into the focal adhesion signaling increases in an accordance with force transmitting via cytoskeleton by generating an increased force at the cell-matrix interface, which promotes focal adhesions assembly. The shorter graphene lamellae distance is, larger the elastic modulus is.32 Here, we fabricated two kinds of 3D-GFs scaffolds in Fig 1a (soft) and Fig 1b (stiff), with pore size modification by extruding. As expected, we obtained the consistent results by examining the mechanical property by displacement-load curve and elasticity modulus. Results showed that stiff scaffold had bigger elastic muduli than soft scaffold. This fabrication method of the different 3D-GFs is simple, easily operational and low-cost. But the pores size of 3D-GFs scaffolds were not uniform and well-controlled accompaning with an alteration of stiffness. Meanwhile, stiff scaffold strengthened


Page 14 of 30

Page 15 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mechanical contacts from each other by no collapsing and even no breaking after long-time tough chemical etching. Cell adhesions usually rely on adhesive force at cell-matrix interface, which is regulated by integrins associated with the assembly of focal adhesions containing vinculin. Focal adhesions size increase with the stiffness of substrates.33 On stiff substrates, focal adhesions become spread than soft substrate. In this work, NSCs cultured on soft scaffold presented extended cells protrusions while spreading cells protrusions grew on stiff scaffold. Vinculin as a crucial part of focal adhesion involving in integrin-mediated cell-matrix adhesions and cadherin-mediated cell-cell adhesions. Previous reports revealed that vinculin as an adapter protein,34,35 regulating n-cadherin-mediated cells adhesions signaling and integrin-mediated cells adhesions signaling. The real-time PCR and Western blot results revealed that the gene and protein expressions of vinculin, integrin and n-cadherin in NSCs on stiff scaffold were up-regulated than those on soft scaffold. Hence, enhanced adhesion was observed on stiff scaffold. In addition, 3D-GFs scaffolds feature an inter-connected pore structure, high specific surface area and nano-micro-scale topographical surface, which provide suitable 3D culture surroundings for proliferation and differentiation of NSCs. It had been reported that 3D culture based on porous scaffold affects cells function, for example, cells proliferation and differentiation.20 Cells proliferation are associated with the stiffness of 3D hydrogels.13 In our



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

study, two different-stiffness 3D-GFs scaffolds presents soft and stiff structure with elasticity moduli of 30 and 64 kPa, respectively. In Fig 1c and Fig 1d, the stiff scaffold possessed smaller pore size than the soft one, which might affect cells function through regulating cell-cell crosstalking, cells secretion, receive signals and exchange nutrients cells needed in 3D culture. Stiff scaffold surface presented more dense structures through decreasing empty space. In this work, BrdU and Ki67 positive percentages by immunofluorescent assay on stiff 3D-GFs were higher than those on soft one, indicating stiff scaffold enhanced NSCs proliferation (Fig 4a & Fig 4b). Real-time PCR and Western blot analysis also revealed a similar tendency by Ki67 expression. Moreover, a very tiny change of nestin expression indicated NSCs maintaining stemness very well. Therefore, the enhanced proliferation of NSCs were observed on stiff scaffold. Focal adhesion, a mechanosensor sensing the substrate stiffness, activates transcription factor activities ascribed to their combination with growth factors to direct cell growth and differentiation.36 So the stiff scaffold promoted NSCs proliferation to regulate vinculin by controlling the assembly of integrins to interact with focal adhesion. The physical properties of the substrate should be considered as a key factor to exploit novel biomaterials. Stem cells can sense physical properties of substrate, such as elasticity modulus. For a hard substrate, MSCs differentiated into osteoblasts; on the soft substrate, the cells differentiated into nerve cells; on the medium-hard substrate, differentiated muscle cells.37 Moreover, fluid-derived


Page 16 of 30

Page 17 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


stem cells showed enhanced up-regulation of CD44, CD90 and CD105 on stiff matrix than on soft matrix.38 NSCs,

self-renewing

cells,

could

differentiate

into

neurons,

astrocytes

and

oligodendrocytes. NSCs phenotype was analyzed after 7 days cultured on stiff or soft scaffold. The NSCs stained for Tuj1, which is recognized as a specific neuron marker and highly expressed in neurons. The results that NSCs expressed Tuj1 showed cells have differentiated into neurons, but the expression was down-regulated in NSCs on stiff scaffold. GAP-43 expressed at neurite zones during axonal extension and neuronal maturation. GAP-43 is regarded as a marker of cells differentiation in embryonic stem cells (ESCs) and MSCs. Interestingly, GAP-43 expressions quantified by both real-time PCR and western blot were up-regulated. In our studies, GAP-43 was significantly high expressed in NSCs on stiff 3D-GF scaffold by 5.5 folds. The stiffness of the substrates affects cells morphology by changing cytoskeletons.39 Those up-regulation or down-regulation were modulated by the elastic modulus of the substrates. It was reported that the substrate deformability promotes the formation of neurite branches.40 Different expression of GAP-43 and Tuj1 might due to the varous number of neurite branches. It is favorable for astrocytes growth on stiff matrix.41 The cells were immunostained by GFAP. The results revealed that cells on stiff scaffold expressed GFAP, revealing NSCs had favorably differentiated into astrocytes. Astrocytes widely distribute in the mammal brain, filling in the cell body and their projections of nerve cells.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Astrocytes in the central nerve system is always accompanied by the entire development processes of neurons, have biological function of providing support and isolation, maintaining a stable blood vessels, neurons, axons and synapses structure. Differentiated neurons are suppressed since GAP-43 expression was significantly improved by 5.5 folds in NSCs cultured on stiff scaffold.

5. CONCLUSION In this study, we report a method to fabricate two kinds of 3D-GFs scaffolds through extruding Ni templates for CVD growth. The stiff scaffold with a bigger elastic modulus could enhance NSCs adhesion, growth and differentiation toward astrocytes compared to soft 3D-GFs scaffold. This provided a perspective on cells sensitive reactions on substrate flexibility and surrounding environment in 3D culture.

ACKNOWLEDGMENTS This work was partially funded by MOST (Grant No. 2014CB965003) and NSFC (Grant No. 51361130033). Prof. Mingliang Tang with Southeast University was acknowledged for insightful discussion. We are grateful for the professional services of Platforms of Characterization and Test and the Nanofabrication Facility at the Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences.


Page 18 of 30

Page 19 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCE (1) Reynolds, B. A.; Weiss, S. Generation of Neurons and Astrocytes from Isolated Cells of the Adult Mammalian Central Nervous System. Science 1992, 255, 1707-1710. (2) Gianvito, M.; Stefano, P. The Therapeutic Potential of Neural Stem Cells. Nat. Rev. Neurosci. 2006, 7, 395-406. (3) Johansson, C. B.; Momma, S.; Clarke, D. L.; Risling, M.; Lendahl, U.; Frisen, J. Identification of A Neural Stem Cell in the Adult Mammalian Central Nervous System. Cell 1999, 96, 25-34. (4) Cummings, B. J.; Uchida. N.; S. Tamaki, J.; Salazar, D. L.; Hooshmand, M.; Summer, R.; Gage, F. H.; Anderson, A. J. Human Neural Stem Cells Differentiate and Promote Locomotor Recovery in Spinal Cord-Injured Mice. Pro. Natl. Acad. Sci. USA. 2005, 102, 14069-14074. (5) Lindvall, O.; Kokaia, Z.; Martinez-Serrano, A. Stem Cell Therapy for Human Neurodegenerative Disorders-How to Make It Work. Nat Med. 2004, 10, S42-S50. (6) Cool, S. M. Managerial Prerogative and the Question of Control. J. Mol. Histol. 2007, 38, 377-379. (7) Akhavan, O.; Ghaderi, E. The Use of Graphene in The Self-Organized Differentiation of Human neural Stem Cells into Neurons under Pulsed Laser Stimulation. J. Mater. Chem. B 2014, 2, 5602-5611. (8) Akhavan, O.; Ghaderi, E. Flash Photo Stimulation of Human Neural Stem Cells on Graphene/TiO2 Heterojunction for Differentiation into Neurons. Beacon Press, 1971, 5, 5238-5247. (9) Discher, D. E.; Janmey, P.; Wang, Y. L. Tissue Cells Feel and Respond to the Stiffness of Their Substrate. Sicence 2005, 310, 1139-1143. (10) Dado, D.; Sagi, M.; Levenberg, S.; Zemel, A. Mechanical Control of Stem Cell Differentiation. Regen. Med. 2012, 7, 101-116.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(11) Debnath, J. Modelling glandular epithelial cancers in three-dimensional cultures. Nat Rev Cancer 2005, 5, 675-688. (12) Pelham, R. J.; Wang, Y. Cell locomotion and focal adhesions are regulated by substrate flexibility. Proc Natl Acad Sci USA 1997, 94, 13661-13665. (13) Abbasi, N.; Hahmoud, S. M.; Salehi, M.; Jahani, H.; Mowla, S. J.; Soleimani, M.; Hosseinkhani, H. Influence of Oriented Nanofibrous PCL Scaffolds on Quantitative Gene Expression During Neural Differentiation of Mouse Embryonic Stem Cells. J. Biomed. Mater. Res. Part A. 2016, 104, 155-164. (14) Kalbacova, M.; Broz, A.; Kong, J.; Kalbac, M. Graphene Substrates Promote Adherence of Human Osteoblasts and Mesenchymal Stromal Cells. Carbon 2010, 48, 4323-4329. (15) Klymov, A.; Prodanov, L.; Lamers, E.; Jansen, J. A. Understanding the Role of Nano-Topography on the Surface of A Bone-Implant. Biomater. Sci. 2013, 1, 135-151. (16) Cousins, B. G.; Zekonyte, J.; Doherty, P. J.; Garvey, M. J.; Williams, R. L. Manufacturing A Nanometre Scale Surface Topography With Varying Surface Chemistry to Assess the Combined Effect on Cell Behaviour. Int. J. Nano Biomater. 2008, 1, 320-338. (17) Goenka, S.; Sant, V.; Sant, S.; Graphene-based nanomaterials for drug delivery and tissue engineering. J. Control Release, 2014, 173, 75-88.. (18) Cohen-Karni, T.; Qing, Q.; Li, Q.; Fang, Y.; Lieber, C. M. Graphene and Nanowire Transistors for Cellular Interfaces and Electrical Recording. Nano Lett. 2010, 10, 1098-1102. (19) Valles, G.; Bensiamar, F.; Crespo, L., Arruebo, M.; Vilaboa, N.; Saldaria, L. Topographical Cues Regulate the Crosstalk Between MSCs and Macrophages. Biomaterials 2015, 37, 124-133. (21) Yong, T. H.; Hung, C. H. Behavior of Embryonic Rat Cerebral Cortical Stem Cells on the PVA and EVAL Substrates. Biomaterials 2005, 26, 4291-4299.


Page 20 of 30

Page 21 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(22) Duan, X.; Sheardown, H. Dendrimer crosslinked collagen as a corneal tissue engineering scaffold: Mechanical properties and corneal epithelial cell interactions. Biomaterials 2006, 27, 4608-4617. (23) Cattaneo, E.; Mckay, R. Proliferation and Differentiation of Neuronal Stem Cells Regulated by Nerve Growth Factor. Nature 1990, 347, 762-765. (24) Ciccolini, F.; Svendsen, C. N. Fibroblast Growth Factor 2 (FGF-2) Promotes Acquisition of Epidermal Growth factor (EGF) Responsiveness in Mouse Striatal Precursor Cells: Identification of Neural Precursors Responding to Both EGF and FGF-2. J. Neurosci. 1998, 18, 7869-7880. (25) Discher, D. E.; Mooney, D. J.; Zandstra, P. W. Growth Factors, Matrices, and Forces Combine and Control Stem Cells. Science 2009, 324, 1673-1677. (26) Wang, J.; Leach, J.; Brown, X. Balance of Chemistry, Topography, and Mechanics at The Cell–Biomaterial Interface: Issues and Challenges for Assessing the Role of Substrate Mechanics on Cell Response. Surf. Sci. 2004, 570, 119-133. (27) Georges, P. C.; Janmey, P. A. Cell Type-Specific Response to Growth on Soft Materials. J. Appl. Physiol. 2005, 98, 1547-1553. (28) Akhavan, O. Graphene Scaffolds in Progressive Nanotechnology/Stem Cell-Based Tissue Engineering of Nervous Systems. J. Mater. Chem. B 2016, 4, 3169-3190. (29) Li, N.; Zhang, X. M.; Song, Q.; Su, R. G.; Zhang, Q.; Kong, T.; Liu, L. W.; Jin, G.; Tang, M. L.; Cheng, G. S. The Promotion of Neurite Sprouting and Outgrowth of Mouse Hippocampal Cells in Culture by Graphene Substrates. Biomaterials 2011, 32, 9374-9382. (30) Ming, R. H.; Ding, Y. H.; Chang, F. H.; He, X.; J. Feng, Q.; Wang, C. F.; Zhang, P. Humidity-Dependant Compression Properties of Graphene Oxide Foams Prepared by Freeze-Drying Technique. Micro Nano Lett. 2013, 8, 66-67.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(31) Geiger, B.; Tokuyasu, K. T.; Dutton, A. H.; Singer, S. J. Vinculin, an Intracellular Protein Localized at Specialized Sites Where Microfilament Bundles Terminate at Cell Membranes. Proc. Natl. Acad. Sci. USA. 1980, 77, 4127-4131. (32) Rudiger, M. Vinculin and Alpha-Catenin: Shared and Unique Functions in Adherens Junctions. Bioessays 1998, 20, 733-740. (33) Fuso, S.; Panzetta, V.; Embrione, V.; Netti, P. A. Crosstalk Between Focal Adhesions and Material Mechanical Properties Governs Cell Mechanics and Functions. Acta Biomater. 2015, 23, 63-71. (34) Giancotti, F. G.; Ruoslahti, E. Integrin Signaling.

Science 1999, 285, 1028-1032.

(35) Schaller, M. D.; Hildebrand, J. D.; Shannon, J. D.; Fox, J. W.; Vines, R. R.; Parsons, J. T. Autophosphorylation of The Focal Adhesion Kinase, Pp125FAK, Directs SH2-Dependent Binding of Pp60src. Mol. Cell. Biol. 1994, 14, 1680-1688. (36) Skardal, A.; Mack, D.; Atala, A.; Soker, S.; Mech, J. Substrate Elasticity Controls Cell Proliferation, Surface Marker Expression and Motile Phenotype in Amniotic Fluid-Derived Stem Cells. Behav. Biomed. Mater. 2013, 17, 307-316. (37) Even-Ram, S.; Artym, V.; Yamda, K. M. Matrix Control of Stem Cell Fate. Cell 2006, 126, 645-647. (38) Flanagan, L. A.; Ju, Y. E; Marg, B.; Osterfied, M.; Janmey, P. A. Neurite Branching on Deformable Substrates. Neuroreport 2003, 13, 2411-2415. (39) Saha, K.; Keung, A. J.; Irwin, E. F.; Li, Y.; Little, L.; Schaffer, D. V.; Healy, K. E. Substrate Modulus Directs Neural Stem Cell Behavior. Biophys. J. 2008, 95, 4426-4438. (40) Wozniak, M. A.; Radhika, D.; Solski, P. A.; Der, C. J.; Keely, P. J. ROCK-Generated Contractility Regulates Breast Epithelial Cell Differentiation in Response to the Physical Properties of A Three-Dimensional Collagen Matrix. J. Cell Biol. 2003, 163, 583-595. (41) Engler, A. J.; Sen, S.; Sweeney, H. L. Discher, D. E. Matrix Elasticity Directs Stem Cell Lineage Specification. Cell 2006, 126, 677-689. 22 ACS Paragon Plus Environment

Page 22 of 30

Page 23 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig 1. Morphology, pore size distribution, mechanical properties and Raman spectrum of 3D-GFs scaffolds. SEM micrographs illustrated the interconnected porous network structures of soft (Fig 1a) and stiff scaffolds (Fig 1b). The frequency histogram showed that the mean pore size of soft scaffold was ~117 µm, mainly varying from 75 µm to 130 µm (Fig 1c) while stiff one was ~46 µm ranging from 30 µm to 60 µm (Fig 1d). Load and displacement of mechanical properties were measured (Fig 1e). Elastic moduli of the soft and stiff scaffolds 23 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

were 30 ± 0.55 and 64 ± 0.40 kPa, respectively (Fig 1f). Typical Raman spectrum of 3D-GFs were detected (Fig 1g). Scale bar is 500 µm. The datas are presented as mean ± standard deviation, *p < 0.05.


Page 24 of 30

Page 25 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig 2. SEM images and the expression of adhesive molecules of NSCs cultured on both soft and stiff scaffolds after 4 days (Fig 2a-2b). mRNA expressions of vinculin (Fig 2c) and integrin (Fig 2d) on soft and stiff scaffolds were up-regulated by 2.3 and by 1.5 folds, respectively. N-cadherin expression was increase by 1.2 folds (Fig 2e). Protein levels of adhesive molecules in NSCs analyzed by western blot after 4 days cultured on soft and stiff scaffolds (Fig 2f). Scale bar is 10 µm (Fig 2a & Fig 2b). The datas are presented as mean ± standard deviation, *p < 0.05.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fig 3. Immunofluorescence images and gene expressions of NSCs cultured on soft or stiff scaffolds at 4 days. NSCs were stained with Nestin (green), DAPI (blue) and merge images are shown (Fig 3a). mRNA expressions of Nestin of NSCs grown on soft and stiff scaffolds at 4 days (Fig 3b). The viability of NSCs cultured on soft and stiff scaffolds were tested by MTT (Fig 3c) and live/dead (Fig 3d& Fig 3e) assays. Scale bar is 60 µm.


Page 26 of 30

Page 27 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig 4. Immunofluorescence stainings of Ki67 and BrdU, and expressions of Ki67 of NSCs on soft and stiff scaffolds at 4 days. Fig 4a showed the expressions of BrdU while Ki67 expression was observed in Fig 4b. Gene (Fig 4c) and protein (Fig 4d) expressions levels of Ki67 were analyzed. Scale bar is 60 µm. The datas are presented as mean ± standard deviation, *p < 0.05.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fig 5. Immunofluorescence images of NSCs stained with Tuj1, GFAP and DAPI implying that NSCs have differentiated into neural lineages (Fig 5a). mRNA expressions of Tuj1 (Fig 5b), GFAP (Fig 5c) and GAP-43 (Fig 5d) were assessed by quantitative real-time PCR. Western blots showed the proteins expressions of the differentiation (Fig 5e). The protein expressions of Tuj-1, GAP-43 and GFAP with Western Blot were quantified (Fig 5f). Scale bar is 60 µm. The datas are presented as mean ± standard deviation, *p﹤0.05.


Page 28 of 30

Page 29 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1: Primers used for quantitative real-time PCR Gene Ki67

Nestin

Vinculin

N-cadherin

Integrin

GAP-43

Tuj1

GFAP

β-actin

Primer

Sequence

Forward (5’-3’)

CCTGCCTGTTTGGAAGGAGT

Reverse (5’-3’)

ATTGCCTCTTGCTCTTTGACT

Forward (5’-3’)

CCCTGAAGTCGAGGAGCTG

Reverse (5’-3’)

CTGCTGCACCTCTAAGCGA

Forward (5’-3’)

GGAATCCTTTCTGGCACATCTG

Reverse (5’-3’)

ACCTCTGCCACTGTAAGATATTCCA

Forward (5’-3’)

CCTGAGTTTCTGCACCAGGTTT

Reverse (5’-3’)

TTGGATCATCCGCATCAATG

Forward (5’-3’)

GGTGGTATTGTTTTACCCAATGATG

Reverse (5’-3’)

GAACAAGGTGAGCAATTGAAGGA

Forward (5’-3’)

GGGACAACTTTGCACAGGAC

Reverse (5’-3’)

GCTTCATCTGCCTCCTGTCT

Forward (5’-3’)

TGGACAGTGTTCGGTCTGG

Reverse (5’-3’)

CCTCCGTATAGTGCCCTTTGG

Forward (5’-3’)

GGGACAACTTTGCACAGGAC

Reverse (5’-3’)

GCTTCATCTGCCTCCTGTCT

Forward (5’-3’)

ACGGCCAGGTCATCACTATTC

Reverse (5’-3’)

AGGAAGGCTGGAAAAGAGCC



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

TOC graphic 83x35mm (300 x 300 DPI)

ACS Paragon Plus Environment

Page 30 of 30

Three-Dimensional Stiff Graphene Scaffold on Neural Stem Cells

Recommend Documents