Transcription-Dependent Formation of Nuclear Granules Containing

Subscriber access provided by University of Rhode Island | University Libraries

Article

Transcription-dependent formation of nuclear granules containing FUS and RNA Pol II Valery F Thompson, Rachel A. Victor, Andres A. Morera, Mahta Moinpour, Meilani N. Liu, Conner C. Kisiel, Kaitlyn Pickrel, Charis E. Springhower, and Jacob Schwartz Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.8b01097 • Publication Date (Web): 29 Nov 2018 Downloaded from http://pubs.acs.org on November 30, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Transcription-dependent formation of nuclear granules containing FUS and RNA Pol II

Valery F. Thompson1, Rachel A. Victor1, Andres A. Morera1,2, Mahta Moinpour1, Meilani N. Liu1,2, Conner C. Kisiel1, Kaitlyn Pickrel1, Charis E. Springhower1,2, Jacob C. Schwartz1* 1Department

of Chemistry and Biochemistry and 2Department of Molecular Cell Biology, University of Arizona, Tucson, AZ 85721, USA

Running Title: Nuclear granules containing FUS and RNA Pol II * Correspondence: [email protected] Keywords: FUS, RNA Polymerase II, transcription, phase separation, hydrogel, granule

ACS Paragon Plus Environment

1

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 40

ABSTRACT

Purified recombinant FUsed in Sarcoma (FUS) assembles into an oligomeric state in an RNAdependent manner to form large condensates. FUS condensates bind and concentrate the Cterminal domain, CTD, of RNA polymerase II (RNA Pol II). We asked whether a granule in cells contained FUS and RNA Pol II as suggested by the binding of FUS condensates to the polymerase. We developed crosslinking protocols to recover protein particles containing FUS from cells and separated them by size exclusion chromatography. We found a significant fraction of RNA Pol II in large granules containing FUS with diameters more than 50 nm or twice that of the RNA Pol II holoenzyme. Inhibition of transcription prevented the polymerase from associating with the granules. Taken together, we find physical evidence for granules containing FUS and RNA Pol II in cells that possess properties comparable to in vitro FUS condensates.


2

Page 3 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

INTRODUCTION The RNA-binding protein FUsed in Sarcoma, FUS (also referred to as TLS), is a general transcription regulator in cells and forms higher-order protein assemblies in vitro1, 2. We have previously demonstrated that these condensates, sometimes referred to as droplets, form in an RNA-dependent manner and bind the C-terminal domain, CTD, of RNA polymerase II (RNA Pol II)2-6. We have also shown the FUS binds the CTD in cells and co-localizes with RNA Pol II on at least two-thirds of expressed genes2, 4, 5. Point mutations in FUS that prevent condensate formation also block its ability to regulate transcription5. These results predict a model that the oligomeric form of FUS binds RNA Pol II in cells. The network of protein:protein interactions in FUS condensates resemble cellular granules, such as nucleoli, paraspeckles, and stress granules7-10. In cells, granules concentrate proteins and nucleic acids out of the cellular milieu, appear fluid during assembly and disassembly, and maintain their integrity without lipid membranes. Terms describing these properties include hydrogels, phase-separation, liquid droplets, aggregates, and condensates4,

5, 7, 8, 11-18.

Multiple

factors in cells modify the physical properties of granules, including their heterogeneous makeup7, 14.

Post-translational modifications and protein or RNA interactions have been shown to prevent

FUS condensates from forming, providing evidence that the cell may have the means to control whether FUS can oligomerize and then bind the polymerase9, 10. The condensates of FUS shown to bind RNA Pol II in vitro are quite large and nothing of comparable size, such as a cellular granule, has been found bound to FUS and the polymerase11, 19.

FUS has been detected in cellular granules, including stress granules and paraspeckles, but what

role it plays, if any, remains obscure20, 21. A model proposed of a protein body that serves a function


3

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 40

analogous to a granule is that of transcription factories22-24. This model maintains that a protein assembly aids the organization and translocation of the polymerase. Like a granule, transcription factories concentrate scores of transcription and RNA processing factors required for transcription initiation and elongation. Factories are not presently classified as granules and their identification in cells remains an active area of study11, 25, 26. Our goal was to test if FUS occupied a nuclear granule bound to RNA Pol II and was connected to gene transcription. We used formaldehyde to crosslink the weak protein:protein interactions in granules27 and separate these by size exclusion chromatography, SEC. Our second goal was to identify physical properties of granules that are shared by FUS condensates. The link between transcription and the presence of FUS and RNA Pol II in granules is consistent with the model that nuclear FUS associates with RNA Pol II in its oligomerized form.

MATERIALS AND METHODS Cell Culture. HEK293T/17 and human fibroblast cells were obtained from ATCC (catalog# CRL-11268) or gifts from the laboratories of K. Eggan (Harvard University) or H. Zhu (University of Kentucky) and cultured as previously described6, 28. HeLa-Kyoto cells stably expressing LAPFUS were gifts from the laboratory of A. Hyman (Max Plank Institute). LAP-tagged FUS or TDP43 contained in a pcDNA5 plasmid were gifts from the D. Cleveland lab (UCSD) and stable cell lines were generated using Flp-In™ HEK293 (Thermo Fisher Scientific). siRNA transfection. siRNA sequences are given here for their sense strands followed by 2 nucleotide

overhangs:

siA1,

GGAGGUGGAUGCAGCUAUGUU;

siAB,

GGAACUACUACGAACAAUGUU; siFUS, CGGACAUGGCCUCAAACGAdTdT; siTDP1, GCGGGAAAAGUAAAAGAUGUU; siTDP2, GGAUGAGACAGAUGCUUCAUU. These


4

Page 5 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

were annealed to their antisense complements leaving the 3’ overhangs and transfected into HEK293T/17 cells with RNAiMax™ (Invitrogen, catalog # 13778150) in Optimem (Invitrogen, catalog # 31985070). Media was changed to DMEM (5% FBS) at 24 hours and cells harvested at 72 hours. Cells were lysed in 50 mM Tris-HCl, pH 8.0, 250 mM NaCl, 0.5% NP-40, 1 mM EDTA, 1 mM DTT, 1x protease inhibitors (Gold Biotechnology, catalog # GB-108-5) and lysates analyzed by western using antibodies from ELISA assays described below and also anti-H2B (Millipore Sigma, catalog # 05-1352). Protein Purification and Condensate Formation. Protein purification for FUS and RNA Pol II CTD was performed essentially as previously described, with FUS eluted in phosphate buffered saline, PBS, with 100 mM imidazole4, 29. Dynamic light scattering (DLS) was performed using a Wyatt DynaPro Nanostar. To form condensates, FUS (> 10 M) was incubated in PBS at room temperature for up to 24 hours. Condensates were crosslinked with 1% formaldehyde for 20 minutes and quenched with 1.5 mM glycine. Condensates were removed by filtration using 0.22 m Costar SpinX® centrifuge tube filters. In vitro Transcription. In vitro transcription reactions were preformed using nuclear extract from HEK293T/17 cells prepared per established protocols30. 500 ng of DNA plasmids containing a GFP construct were added to a reaction mix containing α-32P labeled GTP. RNA transcripts produced were phenol:chloroform extracted and separated by PAGE using 6% acrylamide gels with 7M urea. RNA was transferred to nylon membranes and detected by phosphorimaging with a Pharos FX Plus Phosphorimager. Freshly purified FUS or BSA in transcription buffer (20mM HEPES, pH 7.9, 100mM KCl, 0.2mM EDTA, 0.5 mM DTT, and 20% glycerol) was added to reactions, for a total reaction volume of 25 L.


5

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 40

Cell Lysate Preparation and Size Exclusion Chromatography. Cells grown to confluency in 150mm dishes were collected by scraping and washed twice with cold PBS. Nuclei were extracted in hypotonic lysis buffer (10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM NaCl, 0.5 mM DTT, and 1x protease inhibitors (Sigma catalog #P8340)) and passed through a 27-gauge needle. Nuclei were washed with Buffer C (20mM HEPES, pH 7.9, 5% glycerol, 0.2 mM EDTA, 0.5 mM DTT, 1.5 mM MgCl2, and 1x protease inhibitors) and resuspended in one-half packed nuclear volume (pnv) of Buffer C. 100 U of benzonase (EMD Millipore, catalog #707463) was added and samples were incubated for 10 min at RT. Nuclear protein was extracted by adding NaCl to Buffer C to reach 800 mM NaCl. To crosslink cells, these were grown to confluency in 150mm dishes, incubated with 1% formaldehyde for 15 minutes, then quenched with 1.5 mM glycine. Cells were harvested by scraping, washed with PBS, and resuspended in 2 to 5 volumes of Buffer C with 400 mM NaCl and 6 M urea. These were sonicated for 30 min in a Bioruptor® Pico (Diagenode) with 30 second pulses at 4°C. Samples were centrifuged at 19,980 x g for 30 min and filtered through a Costar Spin-X 0.45 µm (catalog # 8163) filter. Protein concentration was monitored by A280 using a BioTeck Epoch 2 microplate reader with a TAKE3 plate. Size Exclusion chromatography was performed using a Sepharose CL-2B 10/300 column (Sigma-Aldrich, catalog #CL2B300-100mL) injected with lysates from HeLa-Kyoto cells (1.5-2.0 mg protein) or human fibroblasts (0.5-1.0 mg protein). Columns were run in Buffer A (100 mM NaCl, 20 mM HEPES, pH 7.9, 0.2 mM EDTA, 5% glycerol, and 0.5 mM DTT). For crosslinked samples, Buffer A was supplemented with 6M urea.


6

Page 7 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Silver Stain of SEC fractions. NaCl was added to eluted samples for a final concentration of 200 mM and heated overnight at 65°C to reverse crosslinking. Samples were then heated 10 min at 95°C in LDS-Sample Buffer with 50 mM DTT and electrophoresed on 12.5% polyacrylamide gels. Silver staining was performed with a Pierce Silver Stain for Mass Spec kit (Thermo Fisher, catalog # 24600) according to manufacturer’s instructions. ELISA assays. ELISAs were performed in 96-well Lumitrac 600 white plates (Greiner BioOne, catalog# 655074). In most cases, proteins were detected by indirect ELISAs, for which wells were coated with samples collected from SEC or eluted from immunoprecipitation experiments, then washed with Tris-buffered saline containing 0.1% Tween 20 (TBS-T) and blocked with 5% nonfat dry milk in TBS-T. FUS and RNA Pol II concentrations were determined using nuclear lysates prepared by hypotonic lysis as described above and using sandwich ELISAs, for which plates were first coated with 1.25 g/mL polyclonal FUS antibody (Bethyl Labs, catalog# A300294A) or 0.5 μg/mL RNA Pol II antibody (Abcam, catalog #ab26721) in 0.2M Na2CO3/NaHCO3, pH 9.4. Immobilized proteins were detected by the following antibodies in 2.5% non-fat dry milk in TBS-T: FUS 4H11 (Santa Cruz, catalog# sc-47711), RNA Pol II CTD4H8 for indirect ELISA (EMD Millipore, catalog #05-623), RNA Pol II 8WG16 for sandwich ELISA (Abcam, catalog# ab817), hnRNPA1 4B10 (Novus Biologicals, catalog #NB100-672), hnRNPA2B1 DP3B3 (Santa Cruz Biotechnology, catalog #sc-32316), and TDP-43 polyclonal (Proteintech, catalog #10782-2AP). After removing primary antibodies, wells were washed 4 times with TBS-T for 5 minutes each then incubated with secondary, goat anti-mouse IgG HRP (Fisher, catalog #PI31432) or goat anti-rabbit IgG HRP (Fisher, catalog #PI31462). The wells were washed 4 times for 5 minutes each time and proteins were detected by incubation with a chemiluminescent substrate (Thermo


7

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 40

Fisher Scientific, catalog #PI37074). Luminescence was read using a BMG POLARstar Omega plate reader. Transmission Electron Microscopy. Column fractions or particles immunoprecipitated with anti-RNA Pol II CTD4H8 antibodies (EMD Millipore, catalog# 05-623) were spotted on Formvar Film 150 Mesh Copper grids (Electron Microscopy Sciences, catalog # FF150-CU) and stained with 1% uranyl acetate (Electron Microscopy Sciences, catalog # 22400-1). Negative control IP experiments were performed in cell lysates with 15 mg Normal Mouse IgG (Millipore, catalog# 12-371). Images were acquired on a FEI Tecnai Spirit 120S transmission electron microscope. Immunoprecipitation of crosslinked particles. Immunoprecipitations were performed from crosslinked whole cell and nuclear lysates, or from SEC fractions that were pooled from 9-15 mL. Pooled fractions were dialyzed into 0.02% SDS in TBS (IP buffer). IP’s from cell lysates were diluted 1/10 into IP buffer. 15 g of anti-FUS 4H11 (Santa Cruz Biotechnology, catalog# sc47711) or 5 g of anti-RNA Pol II CTD4H8 (EMD Millipore, catalog# 05-623) was incubated overnight at 4°C with gentle rotation. Protein A/G beads (Pierce, catalog #20421) or Protein G Dynabeads (Invitrogen, Cat# 10003D) were washed in IP buffer and 50 L (packed bead volume) was added to each sample. Incubation was continued for 2 hours at room temperature. The beads were washed once with IP buffer, twice with IP buffer containing 500 mM NaCl, followed by two washes with IP buffer. Protein was eluted by incubating beads with 2 x 100 L of buffer (3.6 M MgCl2, 20 mM MES, pH 6.5) and combining both eluates. FUS and RNA Pol II were detected in eluates and supernatants by ELISA using polyclonal anti-FUS (Bethyl Labs, catalog# A300-294A) or polyclonal anti-RNA Pol II (Abcam, catalog# ab26721). The amount of protein recovered was


8

Page 9 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

determined by dividing the signals for eluted protein over the total, eluted + supernatant. The fraction of protein bound was corrected for the amount of targeted protein immunoprecipitated. Co-immunoprecipitation and western analysis. Co-immunoprecipitation, co-IP, of LAPFUS and LAP-TDP-43 were performed in Flp-In™ 293 cells expressing LAP-tagged TDP-43 or LAP-tagged FUS. Confluent 150 mm plates of cultured cells were lysed in 2mL of Co-IP buffer (1mM Tris pH 7.5, 150mM NaCl, 0.5mM EDTA, and protease inhibitor) with 1% NP-40 and 50U benzonase. Lysates were centrifuged and combined with 250µL of anti-GFP beads (Chromotek) suspended in 3mL Co-IP buffer and incubated for 1 hour at 4°C. Beads were washed three times with 1mL Co-IP buffer. RNA Pol II co-IP used the CTD4H8 antibody and negative control IP experiments were performed in cell lysates with 15 mg Normal Mouse IgG (Millipore, catalog# 12-371). Bound protein was eluted at 90°C for 10 minutes into elution buffer (100mM NaHCO3, 1% SDS). Eluted samples were probed using western blotting analysis using anti-hnRNPA1 4B10 (Novus Biologicals, catalog #NB100-672) and TDP-43 polyclonal (Proteintech, catalog #107822-AP). DNA and RNA Quantitation with DAPI and SYBR Gold. DNA or RNA was detected by incubating samples from SEC fractions in black 96-well plates with DAPI at 0.12 g/mL (SigmaAldrich, catalog #D9542) or SYBR Gold at 1/10,000 dilution (Invitrogen, catalog #S11494) in 100 mM NaCl, 20 mM HEPES, pH 7.9, 10 mM EDTA. Fluorescence was measured with a BMG PolarSTAR Omega plate reader using λex = 350nm and λem = 475 nm for DAPI and λex = 485 nm and λem = 535 nm for SYBR Gold. Proteins were digested with 20 g of Proteinase K (Amresco, catalog #0706) at 37 ºC for 1 hour, and nucleic acids with DNase I (Worthington Biochemical, catalog #LS006353) or RNase A (Sigma-Aldrich, catalog #R4642) at room temperature for 1 hour.


9

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 40

RESULTS In vivo concentrations of FUS strongly affect RNA Pol II transcription in vitro. We used formaldehyde crosslinking to identify protein complexes containing FUS, RNA Pol II, and other hnRNP proteins. Because crosslinked complexes cannot be analyzed usefully by western blotting, we used ELISA assays to characterize our protein targets. All antibodies used for ELISAs were validated by western blot of proteins from cells with and without siRNA knockdown of FUS, hnRNPA1, hnRNPA2B1, and TDP-43 (Figure S1A–D). Each antibody detected signals of the expected molecular weight, which was reduced by siRNA knockdown. For RNA Pol II, we confirmed the absence of non-specific bands but did not use siRNAs to confirm specificity because RNA Pol II is an essential protein. Each of these antibodies had also been extensively used in published ChIP-seq, CLIP-seq, and co-IP studies6, 31, 32. Based on these qualifications, we chose these antibodies to develop of our ELISA assays. We next tested whether ELISAs could measure nuclear concentrations for FUS and RNA Pol II near those previously published. We standardized our ELISAs using purified recombinant protein: FUS with an N-terminal maltose binding protein tag, MBP-FUS (Figure 1A), and CTD with an N-terminal green fluorescent protein tag, GFP-CTD (Figure 1B). By ELISA, titrations of recombinant protein proved linear for several orders of magnitude. Previously reported cellular concentrations for FUS ranged from 1.8 to 7.6 M16, 33, 34. We measured the nuclear concentration of FUS in HeLa-Kyoto cells as 6.1 ± 1.2 M. RNA Pol II nuclear concentrations have recently been reported between 60 to 180 nM34-36. ELISA assays yielded an RNA Pol II concentration of 80 ± 40 nM in nuclear lysates (Figure 1C). These findings revealed a high molar excess of FUS


10

Page 11 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

over RNA Pol II in the nucleus and that our ELISA assays could confirm published protein concentrations.

Figure 1. Representative standard titrations for recombinant (A) MBP-FUS or (B) GFP-CTD using quantitative ELISAs. (C) Nuclear concentrations of FUS and RNA Pol II measured by ELISA from HeLa cell lysates and published values. (D) -32P labeled GFP transcripts were produced in HEK293T/17 nuclear lysates with either no template (–), no protein added (CTL), 2.4 M FUS (FUS), or 2.4 M BSA (BSA).

FUS can stimulate RNA Pol II transcription but previous in vitro transcription assays tested much lower FUS concentrations than found in cells37, 38. The micromolar concentrations could alter FUS behavior because of the potential to form condensates. We added purified, recombinant MBP-FUS to cell lysates to determine changes in in vitro transcription for a Green Fluorescent Protein, GFP, gene construct under a cytomegalovirus, CMV, promoter. RNA transcript levels increased dramatically upon addition of 2.4 M FUS. This greatly exceeded the activation by FUS observed in previous reports37,

38.

Changes to transcription were undetectable at lower FUS


11

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 40

concentrations (Figure 1D, Figure S1E). Bovine serum albumin, BSA, was added as an inert, soluble protein control and had no effect on transcription. This result revealed that cellular concentrations of FUS had a greater potential to activate transcription. Crosslinking stabilizes weak interactions that comprise FUS condensates. In contrast to many protein aggregates or amyloids, FUS condensates are readily dissociated by mild detergents or organic solvents27, 39. Similarly, granules described to be liquid-like cannot withstand gentle cell lysis protocols27. We chose to employ formaldehyde, a small molecule that crosslinks primary and secondary amines, to stabilize these weak interactions as it reacts quickly and is commonly used in many purification and enrichment protocols40. We adapted our formaldehyde crosslinking protocol from one we had previously used for ChIP-seq of FUS6, 41. We tested the ability for formaldehyde to stabilize MBP-FUS condensates. Because FUS condensates change their properties with age16, 42, freshly purified protein was allowed to form soluble condensates in phosphate buffered saline, PBS, at a moderately high MBP-FUS concentration (10 to 15 M) and without RNA. For repeated protein purifications, no precipitate or turbidity was seen but a large fraction of MBP-FUS was retained as condensates by a 0.2 m filter (Figure S2A). In contrast, a high concentration of soluble BSA (5 mM) passed readily through the filter (Figure S2B). Treatment of MBP-FUS condensates with 1% SDS before filtration disassembled them to allow most of the protein to pass (Figure 2A, filtered samples labeled “F”). Crosslinking MBP-FUS condensates with 1% formaldehyde stabilized these against SDS and MBP-FUS was again retained during filtration (Figure 2A, crosslinked, filtered samples labeled “F+FA”). Crosslinking consistently stabilized condensates formed from multiple fresh protein purifications (Figure S2C).


12

Page 13 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Although formaldehyde crosslinks over a short distance, < 3 Å, a crowded cellular environment, estimated at 300 mg/mL protein, may allow non-specific crosslinks to accumulate from casual molecular collisions43,

44.

We tested whether 300 mg/mL BSA, 5 mM, might

accumulate non-specific crosslinks to form aggregates as large as condensates. Formaldehyde did not crosslink BSA in particles that could be retained by filtration (Figure 2B, Figure S2D). This revealed the basis for our crosslinking specificity was due to the protein:protein interactions found in the condensates. We examined FUS condensates under phase contrast microscopy to investigate whether partial degradation of crosslinked condensates under denaturing conditions was observed. Condensates formed overnight to an average of ~200 nm in diameter and were allowed to adhere at the bottom of 96-well plates to allow buffer exchanges. As previously reported4, the condensates appeared amorphous, in part, because their immobility hindered fusion into droplet shapes (Figure S2E, magnified images)7, 14, 16, 42, 45, 46. Condensates disappeared when treated with 8 M urea (Figure 2C). Crosslinking produced no measurable change in morphology or size of the condensates but prevented their dissolution in urea (Figure 2C). From these observations, we concluded that formaldehyde crosslinking could stabilize granules with structures like those of FUS condensates.


13

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 40

Figure 2. Formaldehyde crosslinking stabilizes in vitro formed FUS condensates. (A) Soluble condensates prepared from freshly purified FUS were incubated in 1% SDS then passed through a 0.2 m filter. Two replicates shown here are from the same FUS purification. Those from additional purifications are found in Figures S2C and D. Concentrations before filtration, UF, and after filtration, F, were measured by UV/visible spectroscopy. When stabilized with formaldehyde crosslinking (F+FA) the condensates resisted SDS dissolution and were retained by the 0.2 m filter. (B) A high concentration of BSA (5 mM) passed readily through filters after 1% SDS was added. Two replicates shown here are from one preparation of a 5 mM BSA solution. BSA crosslinked with formaldehyde also readily passed through the 0.2 m filter. (C) Condensates were grown to ~200 nm diameter on a solid substrate and visualized by phase contrast microscopy. After treatment with 8M urea, condensates not crosslinked readily dissolve but formaldehyde crosslinked condensates remained stable with their size and shape unchanged. Scale bars are 1 m. Images are shown in high contrast for clarity. Expanded images found in Figure S2E.


14

Page 15 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Size exclusion chromatography revealed RNA Pol II and FUS in large particles. We next lysed cells for fractionation by SEC. For uncrosslinked cells, we used a gentle lysis to minimize disruption of protein complexes. For crosslinked samples, we included 6 M urea in the lysis and SEC running buffers to mitigate uncrosslinked protein interactions or aggregation. We also treated cell lysates with nucleases and, for crosslinked samples, sonication to eliminate DNA or RNA that may tether protein complexes and appear like protein granules based on their size. We confirmed that nucleic acid binding proteins FUS, hnRNPA1, and H2B, were not lost during centrifugation or filtration, indicating that their associated complexes were predominately soluble and less than 0.45 m (Figure S3A-C). We interpreted the effects of the stringent buffers applied to crosslinked samples in light of our observation that 6M urea readily dissociated uncrosslinked FUS condensates and that sonication is standardly used to breakdown nucleic acids in assays such as ChIP. Therefore, we considered that shifts in SEC toward smaller particles for crosslinked compared to uncrosslinked samples would likely represent complexes not crosslinked and dissociated under the stringent conditions. A shift towards larger particles would most likely be from stabilization of protein interactions through crosslinking. We fractionated lysates from HeLa-Kyoto and two human fibroblast cell lines (Fib1 and Fib2) using a CL2B column that could resolve particles up to 150 nm in diameter. The size of particles collected during elution was established using dynamic light scattering (DLS) and transmission electron microscopy (TEM). Average particle diameters found in eluted fractions ranged from 150 nm to 14 nm (Figure 3A). Under TEM, large particles appeared roughly spherical or flattened circular shapes. We hypothesized the flattened particles resulted from their desiccation under the vacuum during TEM (Figure S4A).


15

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 40

Figure 3. Separation of crosslinked protein particles by size-exclusion chromatography, SEC. (A) The average particle sizes contained in cell lysates and eluted during SEC were quantified using DLS and TEM (error shown as standard deviation, SD, for 3 to 4 DLS measurements or 30 to 50 particles measured in each TEM image). Elution profiles determined by ELISA are shown for RNA Pol II and FUS for no crosslink (B) and crosslinked (C) cells (N = 10, per treatment). Profiles are averaged across samples from 3 cell lines: two human fibroblast lines (Fib1 and Fib2, N=3 each) and HeLa-Kyoto cells (HeLa, N=4). Elution profiles for each cell line used are shown for (D) uncrosslinked and (E) crosslinked samples. Thin dashed lines represent standard error of the mean (SEM).

We tested SEC fractions for RNA Pol II using ELISA (Figures 3B and 3C, N=10 per treatment). For cells not crosslinked, RNA Pol II eluted maximally as particles between 25 and 50


16

Page 17 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

nm diameter for all three cell lines (Figure 3B, averages shown in blue, standard error shown in thin blue lines)16, 28, 34. The elution volume, EV, was between 15 and 20 mL. Almost two-thirds of RNA Pol II eluted in particles with diameters equal or greater than the expected 25 nm, based on solved structures of the holoenzyme (calculated as area under the curve, AUC)47. RNA Pol II eluting as particles less than 25 nm were interpreted to be incomplete holoenzymes in cells or those broken apart after cell lysis (EV > 20 mL). Each of the three cell lines exhibited a similar RNA Pol II profile with most of the polymerase eluting between 25 to 50 nm particles or larger (Figure 3D, N=3 or 4 per cell line). SEC fractionation of lysates from crosslinked cells had shifted elution profiles for RNA Pol II. More than 40% of the polymerase eluted as large particles with diameters of 50 nm or greater (Figure 3C, EV < 16 mL). The necessity of crosslinking to reveal the large particles was consistent with the hypothesis that particles containing RNA Pol II were formed from weak interactions. The sharp shoulder observed near the benchmarked size of the polymerase, 25 nm (EV of 20 mL), suggested that little protein could be captured during polymerase assembly or as monomeric subunits. For crosslinked HeLa-Kyoto cells, almost no RNA Pol II eluted as smaller than 25 nm. A considerable portion, ~50%, eluted in large particles more than 50 nm in diameter (Figure 3E, N=3 or 4 per cell line). Thus, the presence of RNA Pol II in large particles was confirmed. We tested whether the bulk of cellular proteins were shifted to elute in early fractions, as found for RNA Pol II. Silver-stained SDS-PAGE gels and the UV absorbances at 280 nm, A280, of the SEC fractions revealed the majority of uncrosslinked proteins eluted as particles smaller than 25 nm (Figure S4B, EV > 20 mL). In earlier fractions, silver-staining and A280 only detected protein in the void volume fraction. Crosslinked proteins also eluted as small complexes or monomers but some increase was observed for protein particles larger than 25 nm (Figure S4C, EV < 20 mL).


17

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 40

Significant smearing was observed, indicating that crosslink reversal by heat was insufficient to allow accurate protein migration in SDS-PAGE. The distributions of cellular protein revealed only a minor fraction were in assemblies or large particles (>50 nm) where RNA Pol II was found to elute. We also tested the fractions for the presence of nucleic acids using the small molecule dyes, DAPI and SYBR, as these might make nucleic acid binding proteins appear larger in SEC (Figure S5A). Fluorescence was detected to indicate small amounts of nucleic acids were eluting between 17 and 21 mL (Figure S5B). Treating these with DNase, RNase, or both initially did not abolish the nucleic acid signals (Figure S5C). By pre-treating samples with Proteinase K, DNase could eliminate signals but RNase had no effect, indicating these to be DNA protected during our sample preparation by bound proteins (Figure S5D). However, structures indicate that RNA Pol II envelopes a DNA fragment of 82 base pairs, bp, suggesting that tethering two or more polymerases would require a larger fragment47. Using a fragment analyzer, we found the lengths of DNA eluted to be less than 85 bp (Figure S5E). Therefore, if DNA fragments had bound RNA Pol II, they would not be expected to cause the polymerase to appear > 50 nm by SEC. We next compared the elution profiles of FUS to those of RNA Pol II. Uncrosslinked FUS eluted in particles smaller in size than the minimal RNA Pol II holoenzyme with a peak at 14 nm (Figure 3C, EV = 24 mL, shown in red). In each cell line, less than a third of FUS eluted as more than 25 nm (Figure 3D, EV < 20 mL, calculated as AUC). More than 80% of crosslinked FUS eluted as larger than 25 nm and 75% larger than 50 nm. The maximal elution was as particles of 150 nm or larger (Figure 3C). The elution of crosslinked FUS was consistent across all cell lines (Figure 3E). From the dramatic shift in protein elution caused by crosslinking, we interpreted that


18

Page 19 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

the majority of FUS was in particles of a size expected of a granule and likely formed of weak protein:protein interactions27, 39.

Figure 4. hnRNPA1 and hnRNPA2B1, but not TDP-43, elute as large particles upon crosslinking. Uncrosslinked (A) and crosslinked (B) SEC elution profiles were averaged from 3 human cell lines (N = 10, per treatment). Fractions were probed by ELISA for RNA Pol II (blue), FUS (red), hnRNPA1 (green), hnRNPA2B1 (gold), and TDP-43 (purple). On top, absorbance at 280 nm (UV ABS, black) is shown. UV absorbance is plotted as relative absorbance units (AU) and ELISAs as relative luminescence units (RLU). Thin dashed lines represent standard error of the mean (SEM).

Other hnRNP proteins are found in large particles. Like FUS, other hnRNP proteins possess LC domains, form condensates in vitro, and for some, their association with previously known cellular granules has been better established than for FUS9,

10, 13, 42, 46.

We chose to

investigate hnRNPA1, hnRNPA2B1, and TDP-43 because these share with FUS an association with neurodegenerative disease48, 49. Without crosslinking, hnRNPA1 and hnRNPA2B1 elutions


19

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 40

were similar to FUS with a peak at ~14 nm (EV = 24 to 25 mL). hnRNPA2B1 had a second peak overlapping with RNA Pol II (Figure 4A, N=10). Crosslinking shifted more than two-thirds of hnRNPA1 and hnRNPA2B1 to elute as large particles >50 nm in diameter (Figure 4B, EV < 16 mL). Interestingly, TDP-43 elution differed from other hnRNP proteins. Uncrosslinked TDP-43 eluted as a broad peak between FUS and RNA Pol II (Figure 4A, EV = 21 to 24 mL). Crosslinking produced little change to its elution profile and only 36% of TDP-43 eluted as particles larger than 50 nm (Figure 4B, calculated as AUC). Co-immunoprecipitation assays, co-IP, were used to compare interactions between hnRNP proteins and with RNA Pol II. LAP-tagged FUS or TDP-43 could each co-IP with hnRNPA1, suggesting that these two proteins share in their protein interaction partners (Figure S6A). However, co-IP of RNA Pol II did not recover TDP-43, suggesting that TDP-43 does not directly bind the polymerase and agrees with the SEC data that these likely do not occupy the same particles (Figure S6B). Transcription allows FUS and RNA Pol II to combine in large particles. We next investigated whether transcription affected the size of particles associated with the polymerase or FUS. We used HeLa-Kyoto cells treated with the transcription inhibitor flavopiridol and determine changes in the elution of RNA Pol II and FUS during SEC. Flavopiridol prevents RNA Pol II transcription by inhibiting the kinase P-TEFb, which phosphorylates Ser2 on the CTD or elongation factors, including DRB Sensitive Inducing Factor, DSIF, and Negative Elongation Factor, NELF50. Treatment with 1 M flavopiridol for 1 hour depleted RNA Pol II from particles larger than 50 nm. Treated polymerases eluted maximally at 25 nm (Figure 5A and 5B). This suggested that without P-TEFb activity, which permits the polymerase to enter into elongation, RNA Pol II could no longer associate with the granule-sized particles. Conversely, FUS continued to elute as large


20

Page 21 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

particles, despite the depletion of RNA Pol II from these fractions (Figure 5A). A slight shift of FUS elution could be seen towards smaller particles compared to the crosslinked HeLa-Kyoto cells not treated with flavopiridol (Figure 5B).

Figure 5. The transcription inhibitor, flavopiridol, prevents RNA Pol II from associating with large granules in HeLa-Kyoto cells. (A) SEC profiles for crosslinked cell lysates following treatment with 1 M flavopiridol for 1 hour (N=3) were compared to (B) crosslinked samples not treated with the inhibitor (N=4, reproduce from Figure 3E). Little change was observed for FUS elution (red) and no change in total protein elution (UV ABS, black). Thin dashed lines represent standard error of the mean (SEM). (C) Quantitative ELISAs of RNA Pol II (Pol II) eluted from a FUS IP or FUS eluted from RNA Pol II IP (N = 3). Controls are for ELISAs without primary antibodies added. Table shows the calculated percentages of Pol II bound to FUS or FUS to Pol II from large


21

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 40

particles collected from early SEC fractions (>70 nm part., N=3) or from whole cell lysates (N=3). Error bars represent standard deviation, SD. (D) Quantification by ELISA of FUS crosslinked and immunoprecipitated with RNA Pol II from HeLa-Kyoto cells treated with flavopiridol (N=3) or untreated (N=5). ELISAs without primary antibodies added are indicated as (–) 1º Ab. Error bars represent SD.

The separation in the peak elutions of FUS and RNA Pol II appeared to disagree with the expectation that these occupy the same granule. We asked whether two classes of FUS particles may exist: those that contain RNA Pol II and those that do not. We tested this using immunoprecipitation assays from crosslinked samples and quantified by ELISA the amounts of FUS and RNA Pol II pulled down or in the supernatant. From these, the portion of each bound to the other was calculated. The IP for FUS from whole cell lysates indicated 87 ± 13% of RNA Pol II to be crosslinked to FUS (Figure 5C, N=3). We also performed immunoprecipitations of FUS using SEC fractions containing the large particles, > 70 nm, and similarly found the majority, 69 ± 6%, of RNA Pol II crosslinked to FUS (N=3). We then determined the fraction of FUS bound to the polymerase. An RNA Pol II immunoprecipitation detected FUS well above controls without primary antibody added to the ELISA. Signals indicated 21 ± 5% of cellular FUS was crosslinked to RNA Pol II (Figure 5C, N=3). Western analysis likewise confirmed the presence of FUS (Figure S6C). The pulldown from whole cell lysates confirmed that most of the polymerase in cells was bound to FUS and the pulldown from SEC fractions with particles >75 nm (EV < 15 mL) confirmed that the large particles contained both FUS and RNA Pol II. In fact, 69 ± 6% of RNA Pol II found in large particles was bound to FUS.


22

Page 23 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

We next tested whether the inhibition of transcription had reduced the amount of FUS bound to RNA Pol II. We performed our immunoprecipitation assays for RNA Pol II using flavopiridoltreated and crosslinked samples and those not treated with the drug. ELISA analysis indicated 9 ± 6% of FUS was crosslinked to RNA Pol II in cells treated with flavopiridol, compared to 21 ± 5% for those not treated (Figure 5D). Although fractions with the most RNA Pol II, contained little of the total FUS, FUS had been found to be 75-fold higher abundance that RNA Pol II (Figure 1C). Thus, 10 to 20% of FUS found in these fractions (EV = 15 to 20 mL) still allowed for a 2 to 4-fold molar excess of FUS over the polymerase. For this reason, most or all of the FUS bound to the polymerase after inhibition of transcription could have been in the smaller particles (< 50 nm). RNA Pol II particles resemble cell granules. We sought to extract and image the particles containing RNA Pol II by TEM. We immunoprecipitated RNA Pol II from crosslinked cell lysates and negative stained the eluted samples for TEM. We resolved small particles between 15 and 25 nm in diameter, consistent with solved structures of the holoenzyme (Figure 6A, H)47. We also observed large, round forms collapsed on the grid (Figure 6A, G). No particles of similar size were found in negative control IPs from a non-specific antibody (Figure S7A). Treating samples with proteinase K eliminated the particles, indicating a protein-based composition (Figure S7B). The largest RNA Pol II particle observed was 270 nm in diameter (Figure 6A, top). Particles were also easily distinguishable between 50 to 75 nm in diameter (Figure 6A, bottom). We hypothesized these were likely to have been spherical in solution but had a large water content that was removed during TEM, similar to particles imaged from early SEC fractions of cell lysates (Figure S4A). This agreed with our SEC findings that large proteinaceous particles were associated with the polymerase.


23

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 40

Figure 6. Transmission electron microscopy imaging of large RNA Pol II granules. (A) TEM image of immunoprecipitated RNA Pol II granules. The largest found was 270 nm in diameter (top). Desiccated granules appeared flattened in TEM, G. Also seen are RNA Pol II holoenzymes with expected diameters of 15 to 25 nm, H. Granules were also observed to be near 50 and 75 nm in diameter (bottom). (B) Diameters of imaged particles larger than the minimal RNA Pol II holoenzyme (> 27 nm) were measured (N=53) to have a median diameter of 54 nm. (C) An equal sized sample (N=53) of particle diameters near or less than that of RNA Pol II holoenzyme (≤ 27 nm) were measured (N=53), revealing a median diameter of 22 nm (N=53). (D) Condensates of FUS formed in vitro also possess a large water content. The volume of small FUS condensates was visualized in phase contrast microscopy (i). These diminished to nearly invisible when dehydrated (ii), and then returned upon rehydration (iii). Scale bar is 1 m.


24

Page 25 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

We divided particles into two groups, those larger than the polymerase, > 27 nm, and those comparable in size to the polymerase, < 27nm. We measured diameters for the larger particles and found their median to be 54 nm (Figure 6B, N=53). Particles of comparable size to the holoenzyme had a median diameter of 22 nm and the minimal particle distinguished was 14 nm in diameter (Figure 6C, N=53). Images collected varied considerably in the relative densities of granules and holoenzymes, providing a significant challenge to draw comparisons across large and small particles (Figure S7C–E). Selecting an image with a mixture of granules and holoenzymes, we calculated a median of 24 nm (Figure S7F). It was noted that measurements of particles distributions by TEM could differ from those for SEC based on at least two differences in methodology: SEC was not preceded by an IP step and the number of polymerases within each granule was not visible in TEM. Taken together, both methods identified particles containing RNA Pol II in the same range of sizes between 20 and 200 nm in diameter. From these observations, we tentatively referred to particles larger than the holoenzyme as granules, since their size greatly exceeded the polymerase and their flattened appearance suggested they lacked a solid protein makeup. We tested whether this principle extended to FUS condensates in vitro. Condensates were grown to an average diameter of 220 nm with freshly prepared protein (Figure 6D, i. left). These were then dried in air by removing their buffer. The dried condensates had diminished until almost undetectable by microscopy (Figure 6D, ii. center). Once the buffer was replaced, they rehydrated to their original size and shape in less than 1 hour (Figure 6D, iii. right). The conclusion that condensates were not solid suggested that these should contain protein concentrations low enough to leave much of their volume as water. We washed and dissolved FUS condensates up to 1 cm in diameter in SDS and measured the concentration of FUS by UV


25

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 40

absorbance to be 1.8 mM (Supplemental Figure S8A). This value agreed with reported estimates of millimolar concentrations of protein in droplets formed by phase-separation14, 20, 42, 45, 51. It could be calculated that 1.8 mM MBP-FUS condensates were 5% protein and 95% water by volume (Figure S8B), which also agreed with published estimates42. To compare this value to a solidly packed structure, such as a crystal, we determined the observable radius of MBP-FUS by DLS to be 4.2 nm, indicating an elongated shape (Figure S8C). Using 4.2 nm as the longest radius of an ellipsoid and taking the protein density as 1.22 g/cm3, we estimated the volume of FUS. The water content for a simple cubic stacking of FUS was calculated to be only 52% (Figure S8D). This suggests that condensates and possibly granules are comprised of an internal structure that maintains their integrity without the need for a solid protein packing. Finally, granules are often defined by certain key constituents that are enriched over their average cellular concentrations3, 8, 42, 46. If oligomers in granules included direct binding between FUS monomers, this would require multiple FUS proteins per granule. We estimated an amount for FUS in granules by taking each SEC fraction to have 69% of RNA Pol II bound to FUS (Figure 5C). By this assumption, we calculated the ratio of FUS to polymerase within particles could range from 10 to 55 as the diameter of granules increased (Figure S9A). In determining whether this indicated an enrichment of FUS, we first calculated FUS concentrations for granules containing a single polymerase. However, the concentrations of FUS decreased sharply for large granules, indicating little enrichment (Figure S9B). By allowing the number of polymerases per granule to increase linearly as a function of particle diameter, the computed concentration of FUS could remain above 300 M. At these FUS concentrations, only a handful of proteins with similar levels of enrichment could provide the remaining total protein concentration to match that for in vitro condensates.


26

Page 27 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

In summary, we found that FUS occupied granules with RNA Pol II in a transcriptiondependent manner. The granules were comprised of weak protein:protein interactions and found to be loosely packed, leaving much of their volume to be water. These same features were noted for FUS condensates in vitro. Finally, although FUS concentrations in the cell are high, the amount of FUS bound to the polymerase does not predict FUS to be the sole constituent of granules but allows that FUS could be significantly enriched in them, especially if multiple polymerases could occupy the same granule (Figure S9C). These findings suggest that interactions of FUS condensates with RNA Pol II can be useful predictors of properties to be investigated for their granule counterparts in cells.

DISCUSSION Nuclear particles containing FUS and RNA Pol II form in a transcription-dependent manner. We have presented evidence that RNA Pol II and FUS are in large nuclear granules, that most RNA Pol II in granules is bound to FUS, and properties observed for these granules could be replicated by FUS condensates in vitro2, 4-6. The majority of RNA Pol II in cells was found in particles larger than the 2.5 MDa RNA Pol II holoenzyme. While surprising, this does not contradict published reports because the CL-2B matrix used here resolves particles much larger than the S6 column previously used. From crosslinked cells, a significant fraction of polymerase, and most FUS, was eluted as particles larger than 50 nm in diameter. For the early SEC fractions, two-thirds of RNA Pol II was crosslinked and immunoprecipitated with FUS. Conversely, less than a quarter of total FUS bound RNA Pol II, which suggests FUS also enters granules that do


27

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 40

not contain the polymerase. Nuclear paraspeckles are one such granule containing FUS that are not known to contain RNA Pol II21, 52-54. We find that inhibition of transcription prevented RNA Pol II from associating with granules. This also reduced the proportion of FUS bound to the polymerase. Since flavopiridol inhibits RNA production and the phosphorylation of polymerase subunits, two explanations exist that are not mutually exclusive. Either the transcription product, RNA, or the phosphorylation of the polymerase could promote binding to granules. The interaction between phosphorylated CTD and FUS is complex and remains poorly understood2. Phosphorylation of CTD weakens binding to the LC domain of FUS5. Full length FUS does bind phosphorylated CTD, possibly through other domains in FUS4. These findings suggest FUS interactions with the polymerase are altered by its phosphorylation status. FUS can also prevent inappropriate phosphorylation of the CTD by PTEFb at transcription start sites6. However, it remains unknown what triggers FUS to switch from inhibition to permitting P-TEFb to phosphorylate the CTD before, or during, the transition of RNA Pol II into elongation. The RNA-dependence for FUS to bind the CTD could also explain the requirement of transcription for the polymerase to associate with granules. Flavopiridol allows transcription of short nascent transcripts during initiation50, 55, 56. Hence, RNA may promote FUS to remain bound to the polymerase after this treatment. An RNA-dependent model suggests that an increase in RNA production may enhance FUS oligomerization and thereby produce a larger granule. The RNAdependence of FUS activity can also provide a mechanism to regulate granule growth, since high RNA concentrations destabilize FUS oligomers4, 33. While the RNA density in the granules must not be so high as to destabilize them, transcripts of sufficient length or a high local concentration of RNA may release the polymerase from FUS granules and prevent further granule growth. The


28

Page 29 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

ability for cellular RNA to restrain FUS oligomerization is highlighted by a recent report showing that FUS depleted of RNA interactions forms assemblies of enormous size that occupy much of the nucleus33. Apart from co-factors and post-translational modifications, the opposing activities of RNA on FUS oligomerization may provide an additional and simple mechanism to regulate the ability for FUS granules to bind RNA Pol II. Defining RNA Pol II particles as granules. Granules can be considered to be non-membrane bound bodies with localized concentrations of certain proteins and nucleic acids above that of their surroundings8, 57-59. The biochemical approach used here was motivated, in part, by previously reported challenges with standard fluorescence-based microscopy techniques to detect FUS granules above the background of high concentrations in the nucleus20,

28, 60.

By this study’s

method, four practical criteria to define granules are considered. First, granules are considerably larger than the protein complexes they contain, such as the RNA Pol II holoenzyme. Second, granules rely on networks of weak protein:protein interactions that require crosslinking to stabilize them from disassociating27. Next, granules have rounded forms, which under TEM imaging are inferred to have been originally spherical. For a body formed by weak interactions, a sphere offers the largest internal volume with the lowest surface area, which reduces strain to the granule boundary39, 51. Finally, granules are not solid protein aggregates, but instead have a loose structure with a large internal volume of water. This hints at a more sophisticated internal organization that maintains its integrity while still allowing proteins to freely diffuse within4, 5, 61. This study identified comparable physical features for in vitro FUS condensates and granules isolated from cells. The round but flattened granules observed in TEM are consistent with our demonstration that condensates are not solid protein masses but structures whose volume depends on their water content. This feature is inherent to the definition for a hydrogel, a description used


29

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 40

in first reports, but does not conflict with the multivalent model for phase separation9, 10. The low millimolar protein concentrations in the condensates provides ample aqueous volume in condensates compared to a solid packed protein structure. On the other hand, the network of protein interactions comprising a granule is needed to explain their stabilization by crosslinking, which distinguishes a granule from the casual interactions of a protein in a crowded solution. In cells, all known granules are comprised of a variety of proteins, many of which can assemble into homogeneous condensates in vitro9,

10, 14, 20, 42.

Therefore, the concentration of FUS in a

heterogeneous granule in cells cannot be expected to be that of an in vitro condensate. Based on the findings of this study, our estimates are that FUS may be considerably enriched if a limit is not assumed for one polymerase per granule. Granules more than 50 nm in diameter possess sufficient volume to fit many more polymerases than considered in our estimates. Although this was not validated in this study, this hypothesis would also be consistent with the model for FUS enhancement of transcription by concentrating polymerases to active genes2-5. The relevance of granules to transcription models. The transcription factory model proposes a protein scaffold concentrates transcription machineries to sites of transcription, which is similar to functions that granules perform22-24. Whether the particles containing FUS and RNA Pol II observed in this study are part of the transcription factory model remains to be seen. Developments in microscopy methodologies that push the boundaries of resolution in cells may answer if FUS granules stay assembled on genes, similar to a type of static transcription factory, or appear intermittently as the gene alternates between resting and actively transcribed47, 62-65. If the granules described in this study are found to comprise a part of transcription factories, this may modify or enhance understanding of the transcription factory model.


30

Page 31 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Recent evidence for bursting kinetics during transcription also has relevance to interpretation of data presented in this study11, 63, 66-70. Published reports of RNA Pol II clusters formed during a transcriptional burst present compelling evidence for many polymerases concentrated in foci of approximately 200 to 300 nm66, 68. The data presented here reveals RNA Pol II in particles of similar size. Answers to two questions may help determine the relationship of the granules described here to the model of transcriptional bursting: how many polymerases are in a granule and how fast can granules assemble and disassemble. Additionally, the method of enriching granules used here could help to identify and inventory their protein constituents, providing new avenues to study the role of granules in transcription25, 62, 71.

AUTHOR INFORMATION Corresponding Author *

Jacob

C.

Schwartz,

1041

E.

Lowell

St.,

Tucson

AZ

85721.

Email:

[email protected] Author Contributions V.F.T. designed, conducted, and analyzed experiments. R.A.V. designed and conducted in vitro experiments with recombinant protein. A.A.M. and M.M. performed coimmunoprecipitations and assisted with cell culture. M.N.L., C.C.K., K.P., and C.E.S. designed and conducted experiments quantifying proteins and nucleic acids, as well as DLS experiments. J.C.S. designed and conducted experiments, analyzed data, and wrote the manuscript. Authors declare no competing financial interests.


31

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 40

Funding Sources This work was supported by the National Institute of Health, NS082376, to J.C.S. R.A.V. was additionally supported by the Initiative to Maximize Student Diversity/NIH program R25 GM062584 and the Sloan Scholar, Sloan Foundation’s Indigenous Graduate Partnership (SIGP) Program. Research reported in this publication was supported by the Office of the Director, National Institutes of Health of the National Institutes of Health under award number S10OD013237. ABBREVIATIONS BSA,

bovine

serum

immunoprecipitation

albumin and

(UniProtKB

sequencing;

CMV,

P02769);

ChIP-seq,

cytomegalovirus;

chromatin co-IP,

co-

immunoprecipitation; CTD, C-terminal domain of RNA polymerase II; DLS, dynamic light scattering; ELISA, enzyme-linked immunosorbent assay; FUS, FUsed in Sarcoma (UniProtKB P35637); GFP, green fluorescent protein; H2B, histone protein 2B (UniProtKB Q99879); hnRNPA1, heterogeneous nuclear ribonucleoprotein A1 (UniProtKB P09651); hnRNPA2B1, heterogeneous nuclear ribonucleoprotein A2B1 (UniProtKB P22626); LAP, localization and affinity purification; MBP, maltose binding protein; PBS, phosphate buffered saline; p-TEFb, positive transcription elongation factor; RNA Pol II, RNA polymerase II (major subunit RBP1 UniProtKB P24928); SDS, sodium dodecyl sulfate; SEC, size exclusion chromatography; TDP-43, Tar DNA binding protein 43 kD (UniProtKB Q13148); TEM, transmission electron microscopy.


32

Page 33 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

SUPPORTING INFORMATION Figure S1. Validation of specificity of antibodies and also replicates of in vitro transcription assays. Figure S2. Replicates for crosslinking of FUS condensates and for treatment of 5 mM BSA. Figure S3. Proteins studied are not lost during centrifugation or filtration. Figure S4. TEM of eluted particles and elution profiles of total lysate proteins during SEC. Figure S5. DNA eluting from SEC is too short to tether large particles or polymerases. Figure S6. FUS and TDP-43 co-IP hnRNPA1 but RNA Pol II does not co-IP TDP-43. Figure S7. Additional TEM images and controls. Figure S8. Measurement of protein concentration and water content in FUS condensates. Figure S9. Calculation of predicted FUS concentrations in granules.

REFERENCES [1] Ozdilek, B. A., Thompson, V. F., Ahmed, N. S., White, C. I., Batey, R. T., and Schwartz, J. C. (2017) Intrinsically disordered RGG/RG domains mediate degenerate specificity in RNA binding, Nucleic Acids Res 45, 7984-7996. [2] Schwartz, J. C., Cech, T. R., and Parker, R. R. (2015) Biochemical Properties and Biological Functions of FET Proteins, Annu Rev Biochem 84, 355-379.


33

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 40

[3] Burke, K. A., Janke, A. M., Rhine, C. L., and Fawzi, N. L. (2015) Residue-by-Residue View of In Vitro FUS Granules that Bind the C-Terminal Domain of RNA Polymerase II, Mol Cell 60, 231-241. [4] Schwartz, J. C., Wang, X., Podell, E. R., and Cech, T. R. (2013) RNA seeds higher-order assembly of FUS protein, Cell Rep 5, 918-925. [5] Kwon, I., Kato, M., Xiang, S., Wu, L., Theodoropoulos, P., Mirzaei, H., Han, T., Xie, S., Corden, J. L., and McKnight, S. L. (2013) Phosphorylation-regulated binding of RNA polymerase II to fibrous polymers of low-complexity domains, Cell 155, 1049-1060. [6] Schwartz, J. C., Ebmeier, C. C., Podell, E. R., Heimiller, J., Taatjes, D. J., and Cech, T. R. (2012) FUS binds the CTD of RNA polymerase II and regulates its phosphorylation at Ser2, Genes Dev 26, 2690-2695. [7] Banani, S. F., Lee, H. O., Hyman, A. A., and Rosen, M. K. (2017) Biomolecular condensates: organizers of cellular biochemistry, Nat Rev Mol Cell Biol 18, 285298. [8] Zhu, L., and Brangwynne, C. P. (2015) Nuclear bodies: the emerging biophysics of nucleoplasmic phases, Curr Opin Cell Biol 34, 23-30. [9] Kato, M., Han, T. W., Xie, S., Shi, K., Du, X., Wu, L. C., Mirzaei, H., Goldsmith, E. J., Longgood, J., Pei, J., Grishin, N. V., Frantz, D. E., Schneider, J. W., Chen, S., Li, L., Sawaya, M. R., Eisenberg, D., Tycko, R., and McKnight, S. L. (2012) Cell-free formation of RNA granules: low complexity sequence domains form dynamic fibers within hydrogels, Cell 149, 753-767. [10] Han, T. W., Kato, M., Xie, S., Wu, L. C., Mirzaei, H., Pei, J., Chen, M., Xie, Y., Allen, J., Xiao, G., and McKnight, S. L. (2012) Cell-free formation of RNA granules: bound RNAs identify features and components of cellular assemblies, Cell 149, 768-779. [11] Hnisz, D., Shrinivas, K., Young, R. A., Chakraborty, A. K., and Sharp, P. A. (2017) A Phase Separation Model for Transcriptional Control, Cell 169, 13-23. [12] Wu, H., and Fuxreiter, M. (2016) The Structure and Dynamics of Higher-Order Assemblies: Amyloids, Signalosomes, and Granules, Cell 165, 1055-1066. [13] Bergeron-Sandoval, L. P., Safaee, N., and Michnick, S. W. (2016) Mechanisms and Consequences of Macromolecular Phase Separation, Cell 165, 1067-1079. [14] Banani, S. F., Rice, A. M., Peeples, W. B., Lin, Y., Jain, S., Parker, R., and Rosen, M. K. (2016) Compositional Control of Phase-Separated Cellular Bodies, Cell 166, 651663. [15] Xiang, S., Kato, M., Wu, L. C., Lin, Y., Ding, M., Zhang, Y., Yu, Y., and McKnight, S. L. (2015) The LC Domain of hnRNPA2 Adopts Similar Conformations in Hydrogel Polymers, Liquid-like Droplets, and Nuclei, Cell 163, 829-839. [16] Patel, A., Lee, H. O., Jawerth, L., Maharana, S., Jahnel, M., Hein, M. Y., Stoynov, S., Mahamid, J., Saha, S., Franzmann, T. M., Pozniakovski, A., Poser, I., Maghelli, N., Royer, L. A., Weigert, M., Myers, E. W., Grill, S., Drechsel, D., Hyman, A. A., and


34

Page 35 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Alberti, S. (2015) A Liquid-to-Solid Phase Transition of the ALS Protein FUS Accelerated by Disease Mutation, Cell 162, 1066-1077. [17] Guo, L., and Shorter, J. (2015) It's Raining Liquids: RNA Tunes Viscoelasticity and Dynamics of Membraneless Organelles, Mol Cell 60, 189-192. [18] Elbaum-Garfinkle, S., and Brangwynne, C. P. (2015) Liquids, Fibers, and Gels: The Many Phases of Neurodegeneration, Dev Cell 35, 531-532. [19] Xie, S. Q., Martin, S., Guillot, P. V., Bentley, D. L., and Pombo, A. (2006) Splicing speckles are not reservoirs of RNA polymerase II, but contain an inactive form, phosphorylated on serine2 residues of the C-terminal domain, Mol Biol Cell 17, 1723-1733. [20] Jain, S., Wheeler, J. R., Walters, R. W., Agrawal, A., Barsic, A., and Parker, R. (2016) ATPase-Modulated Stress Granules Contain a Diverse Proteome and Substructure, Cell 164, 487-498. [21] West, J. A., Mito, M., Kurosaka, S., Takumi, T., Tanegashima, C., Chujo, T., Yanaka, K., Kingston, R. E., Hirose, T., Bond, C., Fox, A., and Nakagawa, S. (2016) Structural, super-resolution microscopy analysis of paraspeckle nuclear body organization, J Cell Biol 214, 817-830. [22] Rieder, D., Trajanoski, Z., and McNally, J. G. (2012) Transcription factories, Front Genet 3, 221. [23] Edelman, L. B., and Fraser, P. (2012) Transcription factories: genetic programming in three dimensions, Curr Opin Genet Dev 22, 110-114. [24] Cook, P. R. (2010) A model for all genomes: the role of transcription factories, J Mol Biol 395, 1-10. [25] Sabari, B. R., Dall'Agnese, A., Boija, A., Klein, I. A., Coffey, E. L., Shrinivas, K., Abraham, B. J., Hannett, N. M., Zamudio, A. V., Manteiga, J. C., Li, C. H., Guo, Y. E., Day, D. S., Schuijers, J., Vasile, E., Malik, S., Hnisz, D., Lee, T. I., Cisse, II, Roeder, R. G., Sharp, P. A., Chakraborty, A. K., and Young, R. A. (2018) Coactivator condensation at superenhancers links phase separation and gene control, Science 361. [26] Sutherland, H., and Bickmore, W. A. (2009) Transcription factories: gene expression in unions?, Nat Rev Genet 10, 457-466. [27] Kroschwald, S., Maharana, S., Mateju, D., Malinovska, L., Nuske, E., Poser, I., Richter, D., and Alberti, S. (2015) Promiscuous interactions and protein disaggregases determine the material state of stress-inducible RNP granules, Elife 4, e06807. [28] Schwartz, J. C., Podell, E. R., Han, S. S., Berry, J. D., Eggan, K. C., and Cech, T. R. (2014) FUS is sequestered in nuclear aggregates in ALS patient fibroblasts, Mol Biol Cell 25, 2571-2578. [29] Wang, X., Schwartz, J. C., and Cech, T. R. (2015) Nucleic acid-binding specificity of human FUS protein, Nucleic Acids Res 43, 7535-7543.


35

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 40

[30] Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei, Nucleic Acids Res 11, 1475-1489. [31] Jones, J. C., Phatnani, H. P., Haystead, T. A., MacDonald, J. A., Alam, S. M., and Greenleaf, A. L. (2004) C-terminal repeat domain kinase I phosphorylates Ser2 and Ser5 of RNA polymerase II C-terminal domain repeats, J Biol Chem 279, 24957-24964. [32] Heidemann, M., Hintermair, C., Voss, K., and Eick, D. (2013) Dynamic phosphorylation patterns of RNA polymerase II CTD during transcription, Biochim Biophys Acta 1829, 55-62. [33] Maharana, S., Wang, J., Papadopoulos, D. K., Richter, D., Pozniakovsky, A., Poser, I., Bickle, M., Rizk, S., Guillen-Boixet, J., Franzmann, T. M., Jahnel, M., Marrone, L., Chang, Y. T., Sterneckert, J., Tomancak, P., Hyman, A. A., and Alberti, S. (2018) RNA buffers the phase separation behavior of prion-like RNA binding proteins, Science 360, 918-921. [34] Hein, M. Y., Hubner, N. C., Poser, I., Cox, J., Nagaraj, N., Toyoda, Y., Gak, I. A., Weisswange, I., Mansfeld, J., Buchholz, F., Hyman, A. A., and Mann, M. (2015) A human interactome in three quantitative dimensions organized by stoichiometries and abundances, Cell 163, 712-723. [35] Steurer, B., Janssens, R. C., Geverts, B., Geijer, M. E., Wienholz, F., Theil, A. F., Chang, J., Dealy, S., Pothof, J., van Cappellen, W. A., Houtsmuller, A. B., and Marteijn, J. A. (2018) Live-cell analysis of endogenous GFP-RPB1 uncovers rapid turnover of initiating and promoter-paused RNA Polymerase II, Proc Natl Acad Sci U S A 115, E4368-E4376. [36] Zhao, Z. W., Roy, R., Gebhardt, J. C., Suter, D. M., Chapman, A. R., and Xie, X. S. (2014) Spatial organization of RNA polymerase II inside a mammalian cell nucleus revealed by reflected light-sheet superresolution microscopy, Proc Natl Acad Sci U S A 111, 681-686. [37] Tan, A. Y., Riley, T. R., Coady, T., Bussemaker, H. J., and Manley, J. L. (2012) TLS/FUS (translocated in liposarcoma/fused in sarcoma) regulates target gene transcription via single-stranded DNA response elements, Proc Natl Acad Sci U S A 109, 6030-6035. [38] Tan, A. Y., and Manley, J. L. (2010) TLS inhibits RNA polymerase III transcription, Mol Cell Biol 30, 186-196. [39] Hyman, A. A., Weber, C. A., and Julicher, F. (2014) Liquid-liquid phase separation in biology, Annu Rev Cell Dev Biol 30, 39-58. [40] Park, P. J. (2009) ChIP-seq: advantages and challenges of a maturing technology, Nat Rev Genet 10, 669-680.


36

Page 37 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

[41] Fong, N., Saldi, T., Sheridan, R. M., Cortazar, M. A., and Bentley, D. L. (2017) RNA Pol II Dynamics Modulate Co-transcriptional Chromatin Modification, CTD Phosphorylation, and Transcriptional Direction, Mol Cell 66, 546-557 e543. [42] Lin, Y., Protter, D. S., Rosen, M. K., and Parker, R. (2015) Formation and Maturation of Phase-Separated Liquid Droplets by RNA-Binding Proteins, Mol Cell 60, 208-219. [43] Richter, K., Nessling, M., and Lichter, P. (2008) Macromolecular crowding and its potential impact on nuclear function, Biochim Biophys Acta 1783, 2100-2107. [44] Zimmerman, S. B., and Minton, A. P. (1993) Macromolecular crowding: biochemical, biophysical, and physiological consequences, Annu Rev Biophys Biomol Struct 22, 27-65. [45] Murakami, T., Qamar, S., Lin, J. Q., Schierle, G. S., Rees, E., Miyashita, A., Costa, A. R., Dodd, R. B., Chan, F. T., Michel, C. H., Kronenberg-Versteeg, D., Li, Y., Yang, S. P., Wakutani, Y., Meadows, W., Ferry, R. R., Dong, L., Tartaglia, G. G., Favrin, G., Lin, W. L., Dickson, D. W., Zhen, M., Ron, D., Schmitt-Ulms, G., Fraser, P. E., Shneider, N. A., Holt, C., Vendruscolo, M., Kaminski, C. F., and St George-Hyslop, P. (2015) ALS/FTD Mutation-Induced Phase Transition of FUS Liquid Droplets and Reversible Hydrogels into Irreversible Hydrogels Impairs RNP Granule Function, Neuron 88, 678-690. [46] Molliex, A., Temirov, J., Lee, J., Coughlin, M., Kanagaraj, A. P., Kim, H. J., Mittag, T., and Taylor, J. P. (2015) Phase separation by low complexity domains promotes stress granule assembly and drives pathological fibrillization, Cell 163, 123-133. [47] He, Y., Yan, C., Fang, J., Inouye, C., Tjian, R., Ivanov, I., and Nogales, E. (2016) Nearatomic resolution visualization of human transcription promoter opening, Nature 533, 359-365. [48] Taylor, J. P., Brown, R. H., Jr., and Cleveland, D. W. (2016) Decoding ALS: from genes to mechanism, Nature 539, 197-206. [49] Renton, A. E., Chio, A., and Traynor, B. J. (2014) State of play in amyotrophic lateral sclerosis genetics, Nat Neurosci 17, 17-23. [50] Rahl, P. B., Lin, C. Y., Seila, A. C., Flynn, R. A., McCuine, S., Burge, C. B., Sharp, P. A., and Young, R. A. (2010) c-Myc regulates transcriptional pause release, Cell 141, 432-445. [51] Li, P., Banjade, S., Cheng, H. C., Kim, S., Chen, B., Guo, L., Llaguno, M., Hollingsworth, J. V., King, D. S., Banani, S. F., Russo, P. S., Jiang, Q. X., Nixon, B. T., and Rosen, M. K. (2012) Phase transitions in the assembly of multivalent signalling proteins, Nature 483, 336-340. [52] Fox, A. H., Nakagawa, S., Hirose, T., and Bond, C. S. (2018) Paraspeckles: Where Long Noncoding RNA Meets Phase Separation, Trends Biochem Sci 43, 124-135. [53] Kawaguchi, T., and Hirose, T. (2015) Chromatin remodeling complexes in the assembly of long noncoding RNA-dependent nuclear bodies, Nucleus 6, 462-467.


37

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 40

[54] Hennig, S., Kong, G., Mannen, T., Sadowska, A., Kobelke, S., Blythe, A., Knott, G. J., Iyer, K. S., Ho, D., Newcombe, E. A., Hosoki, K., Goshima, N., Kawaguchi, T., Hatters, D., Trinkle-Mulcahy, L., Hirose, T., Bond, C. S., and Fox, A. H. (2015) Prion-like domains in RNA binding proteins are essential for building subnuclear paraspeckles, J Cell Biol 210, 529-539. [55] Chao, S. H., and Price, D. H. (2001) Flavopiridol inactivates P-TEFb and blocks most RNA polymerase II transcription in vivo, J Biol Chem 276, 31793-31799. [56] Chao, S. H., Fujinaga, K., Marion, J. E., Taube, R., Sausville, E. A., Senderowicz, A. M., Peterlin, B. M., and Price, D. H. (2000) Flavopiridol inhibits P-TEFb and blocks HIV1 replication, J Biol Chem 275, 28345-28348. [57] Van Treeck, B., and Parker, R. (2018) Emerging Roles for Intermolecular RNA-RNA Interactions in RNP Assemblies, Cell 174, 791-802. [58] Protter, D. S. W., Rao, B. S., Van Treeck, B., Lin, Y., Mizoue, L., Rosen, M. K., and Parker, R. (2018) Intrinsically Disordered Regions Can Contribute Promiscuous Interactions to RNP Granule Assembly, Cell Rep 22, 1401-1412. [59] Mittag, T., and Parker, R. (2018) Multiple Modes of Protein-Protein Interactions Promote RNP Granule Assembly, J Mol Biol 430, 4636-4649. [60] Wheeler, J. R., Matheny, T., Jain, S., Abrisch, R., and Parker, R. (2016) Distinct stages in stress granule assembly and disassembly, Elife 5. [61] Robinson, P. J., Trnka, M. J., Bushnell, D. A., Davis, R. E., Mattei, P. J., Burlingame, A. L., and Kornberg, R. D. (2016) Structure of a Complete Mediator-RNA Polymerase II Pre-Initiation Complex, Cell 166, 1411-1422 e1416. [62] Chong, S., Dugast-Darzacq, C., Liu, Z., Dong, P., Dailey, G. M., Cattoglio, C., Heckert, A., Banala, S., Lavis, L., Darzacq, X., and Tjian, R. (2018) Imaging dynamic and selective low-complexity domain interactions that control gene transcription, Science 361. [63] Tantale, K., Mueller, F., Kozulic-Pirher, A., Lesne, A., Victor, J. M., Robert, M. C., Capozi, S., Chouaib, R., Backer, V., Mateos-Langerak, J., Darzacq, X., Zimmer, C., Basyuk, E., and Bertrand, E. (2016) A single-molecule view of transcription reveals convoys of RNA polymerases and multi-scale bursting, Nat Commun 7, 12248. [64] Chen, H., and Larson, D. R. (2016) What have single-molecule studies taught us about gene expression?, Genes Dev 30, 1796-1810. [65] Choubey, S., Kondev, J., and Sanchez, A. (2015) Deciphering Transcriptional Dynamics In Vivo by Counting Nascent RNA Molecules, PLoS Comput Biol 11, e1004345. [66] Cho, W. K., Jayanth, N., English, B. P., Inoue, T., Andrews, J. O., Conway, W., Grimm, J. B., Spille, J. H., Lavis, L. D., Lionnet, T., and Cisse, II. (2016) RNA Polymerase II cluster dynamics predict mRNA output in living cells, Elife 5.


38

Page 39 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

[67] Martin, R. M., Rino, J., Carvalho, C., Kirchhausen, T., and Carmo-Fonseca, M. (2013) Live-cell visualization of pre-mRNA splicing with single-molecule sensitivity, Cell Rep 4, 1144-1155. [68] Cisse, II, Izeddin, I., Causse, S. Z., Boudarene, L., Senecal, A., Muresan, L., DugastDarzacq, C., Hajj, B., Dahan, M., and Darzacq, X. (2013) Real-time dynamics of RNA polymerase II clustering in live human cells, Science 341, 664-667. [69] Revyakin, A., Zhang, Z., Coleman, R. A., Li, Y., Inouye, C., Lucas, J. K., Park, S. R., Chu, S., and Tjian, R. (2012) Transcription initiation by human RNA polymerase II visualized at single-molecule resolution, Genes Dev 26, 1691-1702. [70] Vargas, D. Y., Shah, K., Batish, M., Levandoski, M., Sinha, S., Marras, S. A., Schedl, P., and Tyagi, S. (2011) Single-molecule imaging of transcriptionally coupled and uncoupled splicing, Cell 147, 1054-1065. [71] Lu, H., Yu, D., Hansen, A. S., Ganguly, S., Liu, R., Heckert, A., Darzacq, X., and Zhou, Q. (2018) Phase-separation mechanism for C-terminal hyperphosphorylation of RNA polymerase II, Nature 558, 318-323.


39

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 40

For Table of Contents use only


40

Transcription-Dependent Formation of Nuclear Granules Containing

Recommend Documents