Transgelin Promotes Migration and Invasion of Cancer Stem Cells

Aug 14, 2010 - prostate cancer, and colorectal cancer.5,6,8,15,16 It has been reported that HCC and .... pressure of 0-5 psi, to achieve a stable flow...
0 downloads 0 Views 412KB Size
Download PDF
Transgelin Promotes Migration and Invasion of Cancer Stem Cells Eun-Kyung Lee,† Gi-Yeon Han,† Hye Won Park,‡ Yeo-Ju Song,† and Chan-Wha Kim*,† School of Life Sciences and Biotechnology, Korea University, Seoul 138-701, Korea, and Department of Biology, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139 Received April 28, 2010

Recent studies have suggested the existence of a small subset of cancer cells called cancer stem cells (CSCs), which possess the ability to initiate malignancies, promote tumor formation, drive metastasis, and evade conventional chemotherapies. Elucidation of the specific signaling pathway and mechanism underlying the action of CSCs might improve the efficacy of cancer treatments. In this study, we analyzed differentially expressed proteins between tumerigenic and nontumorigenic cells isolated from the human hepatocellular carcinoma (HCC) cell line, Huh7, via proteomic analysis to identify proteins correlated with specific features of CSCs. The expression level of Transgelin was 25-fold higher in tumorigenic cells than nontumorigenic cells. Similar results were also observed in tumorigenic cells derived from colorectal adenocarcinoma and prostate carcinoma. More importantly, the elevated levels of Transgelin significantly increased the invasiveness of tumorigenic cells, whereas reduced levels decreased the invasive potential. Moreover, in tumors derived from Huh7-induced xenografts, Transgelin was also co-expressed with CXCR4, which is responsible for tumor invasion. Taken together, these results indicate that the metastatic potential of CSCs arises from highly expressed Transgelin. Keywords: cancer stem cell • transgelin • 2-dimensional electrophoresis • migration • invasion

Introduction Over the past decade, improvements in cancer research have contributed to enormous progress in surgical and medical therapies for cancer, which has shown promising prospects in targeting and killing cancer cells.1 However, cancer is still associated with severe mortality, mainly due to the aggressive behaviors of tumors such as metastasis and chemoresistance.2 The CSC concept, which is the hypothesis that only a small subset of cancer cells possesses the ability to initiate tumors and promote metastasis, was first suggested in previous studies on spontaneous mouse leukemias and lymphomas3 and has recently been demonstrated in many different solid tumors.4-12 Recently, CSCs have emerged as a pivotal therapeutic target to slow the progress of cancer, with a specific emphasis on their implications in tumor formation, metastasis, recurrence, and resistance to conventional therapies. Current studies have attempted to elucidate the unique mechanisms underlying the maintenance and functions of CSCs, which might provide new insights into the design of new therapeutic methods. At present, ABC drug transporters and the Akt/PKB survival pathway are known to be associated with the increased chemoresistance of CSCs.9,13 However, despite extensive research efforts, there is little understanding of how CSCs form tumors, cause metastasis, and evade conventional therapies, which has been * Corresponding author: Chan-Wha Kim, Professor, School of Life Sciences and Biotechnology, Korea University, 5-ga Anam-dong, Sungbuk-ku, Seoul 136-701, Korea. Tel: 82-2-3290-3439. Fax: 82-2-3290-3957. E-mail; cwkim@ korea.ac.kr. † Korea University. ‡ Massachusetts Institute of Technology.

5108 Journal of Proteome Research 2010, 9, 5108–5117 Published on Web 08/14/2010

suggested to be a major obstacle to the application of the CSC concept to the clinical management of cancer. CD133, also called AC133 and Prominin-1, is a 5 transmembrane glycoprotein highly conserved in human and mouse. It is expressed in a subpopulation of CD34+ hematopoietic stem and progenitor cells derived from human fetal liver and bone marrow14 and in some tumor tissues such as brain tumor, prostate cancer, and colorectal cancer.5,6,8,15,16 It has been reported that HCC and its cell lines CD133+ cells have a better ability to self-renew, differentiate into different lineages, and form tumors as compared to CD133- cells.16,17 In the present study, differentially expressed proteins between CD133+ cells and CD133- cells isolated from a HCC cell line, Huh7, were analyzed via 2-dimensional electrophoresis (2-DE) to systematically elucidate specifically activated signaling pathways and the molecular mechanism of CSCs. Among the identified proteins, Transgelin, a 23-kDa actin-binding protein related to epithelial cell migration in lung fibrosis,18 was highly expressed in CD133+ cells compared to CD133- cells. We also observed a high level of Transgelin expressed in cancer stem like cells derived from other organs. More importantly, experimental manipulation of Transgelin expression significantly influenced invasion of CD133+ and CD133- cells. This study provides a distinct mechanism of tumor metastasis, which was associated with a high level of Transgelin expression in CSCs.

Materials and Methods Materials and Apparatus for Two-Dimensional Electrophoresis (2-DE) Analyses. In the 2-DE analyses, the IPGphor IEF system, and Ettan DALT II SDS system with 24 cm 10.1021/pr100378z

 2010 American Chemical Society

Transgelin Promotes Migration and Invasion of CSCs Immobiline DryStrips (pH 3-10) were obtained from GE Healthcare (Uppsala, Sweden). Urea, immobilized pH gradient (IPG) buffer (pH 3-10), and dithiothreitol (DTT) were acquired from GE Healthcare (Uppsala, Sweden). CHAPS, Tris, glycine, acrylamide, SDS, and ammonium persulfate were purchased from Bio-Rad (Hercules, CA). Iodoacetamide (IAA), TEMED, glycerol, bromophenol blue (BPB), silver nitrate, thiourea, acetone, and ammonium bicarbonate were all provided by the Sigma Chemical Co. (St. Louis, MO). The protease inhibitor cocktail (PIC) was acquired from Roche (Indianapolis, IN). All chemicals used in the 2-DE were of either electrophoresis-grade or analytic-grade. All buffers were prepared using Milli-Q water. Isoelectric Focusing (IEF) and 2-DE. Immobiline DryStrips (24 cm, pH 3-10) were rehydrated with the samples, 50 µg of total protein, in 450 mL of a solubilization solution containing 8 M urea, 2% CHAPS, 1% IPG buffer (pH 3-10), 13 mM DTT, and a trace of bromophenol blue, for 5 h without current and another 2 h with a 100 V current. IEF was conducted using the IPGphor system (GE Healthcare) at 200 V for 30 min, 200-500 V for 1 min, 500-8000 V for 1 h, and a constant of 8000 V until approximately 122 kVh was reached. The next steps were performed as described previously.19 Silver Staining and Image Analysis. Proteins were visualized via silver staining. The gels were fixed in 50% methanol, 12% acetic acid for at least 2 h. The fixed gels were rinsed with 50% ethanol three times for 20 min each, then again sensitized with 0.02% sodium thiosulfate for 1.5 min followed by washings three times with DW each for 20 s. The gels were immersed in 0.1% silver nitrate and 0.075% formaldehyde for 20 min, and rinsed with DW twice for 20 s each. The gels were developed with 6% sodium carbonate and 0.05% formaldehyde. Finally, the reaction was terminated by fixing with 50% methanol and 12% acetic acid. The six CD133+ and seven CD133- Huh7 2-DE images were analyzed using ImageMaster 2D Platinum Software (version 6.0, Amersham Biosciences). Expression levels of the spots were determined by the volume of each spot divided by the total volume of all of the spots in the gel; this technique is called Total Spot Volume Normalization. For each spot, the relative volume intensity was averaged and expressed as a mean ( standard error of the mean (SEM). The spots differentially expressed with statistical difference were selected by Mann-Whitney’s U-test (p < 0.05) and identified with ESIQ-TOF MS/MS. Identification of Proteins by ESI-Q-TOF MS/MS: In-Gel Digestion. Proteins were subjected to in-gel trypsin digests. Silver-stained protein spots of interest from four independent gels were excised from polyacrylamide gels, and then pooled gel pieces were destained for 5 min with 100 uL of destaining solution, with agitation. After the solution was removed, the gel spots were incubated for 20 min with 200 mM ammonium bicarbonate. The gel pieces were then dehydrated with 100 µL of acetonitrile and dried with a vacuum centrifuge. The dried gel pieces were then rehydrated with 20 µL of 50 mM ammonium bicarbonate, containing 0.2 µg of modified trypsin (Promega) for 45 min, on ice. After the removal of the solution, 30 µL of 50 mM ammonium bicarbonate was added. Digestion was then conducted overnight at 37 °C. Protein identification by ESI-Q-TOF MS/MS was performed as described previously.19 MS/MS analysis of the peptides generated by in-gel digestion was conducted via nanoESI on a Q-TOF mass spectrometer (Micromass, Manchester, U.K.). The source temperature was 80 °C. A 1 kV potential was applied to precoated borosilicate nanoelectrospray needles (EconoTip,

research articles New Objective) in the ion source, coupled with a nitrogen backpressure of 0-5 psi, to achieve a stable flow rate (10-30 nL/ min). The cone voltage was 40 V. The quadrupole analyzer was utilized in the selection of precursor ions for fragmentation in the hexapole collision cell. The collision gas used was Ar, at a pressure of (6-7) × 10-5 mbar, with a collision energy of 20-30 V. The product ions were then analyzed with an orthogonal TOF analyzer, fitted with a reflector, a microchannel plate detector, and a time-to-digital converter. Data were processed using a Mass Lynx Windows NT PC system (Micromass, Manchester, U.K.). Protein Identification. For protein identification, all MS/ MS spectra recorded on the tryptic peptides derived from the spots were searched against the protein sequences in the NCBInr databases (version, 20080809; 6,863,213 sequences), using the MASCOT search program (version 2.0). The search parameters were as follows: MS/MS Ion Search for search type, trypsin in enzyme, carbamidomethyl (c) in fixed modifications, oxidation (M) in variable modifications, monoisotopic mass values, (1.2 Da for peptide mass tolerance, (0.8 Da for fragment mass tolerance, and 1 for maximum missed cleavage. Mascot uses a probability-based “Mowse score” to evaluate data. Mowse scores are reported as -10 × log10 (p) where p is the probability that the observed match between the experimental data and the database sequence is a random event. Mowse scores greater than 44 are considered significant (p < 0.05). The highest score hits among MASCOT search results were selected. Cell Culture. Huh7 cells were grown as monolayer cultures in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10% FBS, penicillin (100 units/mL), and streptomycin (100 µg/mL). PLC/ PRF5, Hep 3B, HT-29, DU 145, and LNCaP cells were maintained in RPMI 1640 with 10% FBS, penicillin (100 units/mL), and streptomycin (100 µg/mL). The cells were incubated at 37 °C in a humidified atmosphere with 5% CO2. Magnetic Cell Sorting (MACS). Cells were labeled with primary CD133/1-PE antibody (Miltenyi Biotec), then labeled with anti-PE microbeads (Miltenyi Biotec) and isolated on a MACS LS column (Miltenyi Biotec). All procedures were performed according to the manufacturer’s instructions. Isotype-matched mouse immunoglobulins (Miltenyi Biotec) served as controls. The purity of sorted cells was evaluated by flow cytometry and Western blotting. Flow cytometry was done using a BD FACSCalibur. Data were analyzed by BD FACSCalibur software, which is provided with the system. Fluorescence Activated Cell Sorting (FACS). Cells were labeled with primary CD133/1-PE antibody (Miltenyi Biotec) or CD44-FITC (BD biosciences). All procedures were performed according to the manufacturer’s instructions. Isotype-matched mouse immunoglobulins (Miltenyi Biotec) served as controls. Cells were sorted by using a BD FACSAria. Data were analyzed by BD FACSAria software, which is provided with the system. Semiquantitative RT-PCR. Total RNA was isolated using an RNeasy mini kit (Qiagen) and cDNA was synthesized with 1 µg of total RNA using the Superscript II system (Invitrogen) in accordance with the manufacturer’s instructions. After synthesis, cDNA products were used for the PCR reaction. For all RT-PCR analysis, GAPDH or 18S RNA was used as a loading control. The primers are listed in Supplemental Table 1. Western Blotting. Twenty micrograms of total protein lysates was resolved on SDS-PAGE gel, transferred onto PVDF membranes, and then immumoblotted with mouse anti-human CD133 (Abcam), mouse anti-Transgelin (Abcam), and rabbit Journal of Proteome Research • Vol. 9, No. 10, 2010 5109

research articles anti-CXCR4 (Abcam). The membranes were incubated with horseradish peroxidase-conjugated secondary antibody. β-Actin was reprobed as a loading control. Sphere Formation Assay. Each cell was diluted to a density of 103 cells/mL with serum-free medium (SFM). SFM was DMEM (Gibco-Invitrogen) supplemented with 10 ng/mL fibroblast growth factor (R&D Systems, Minneapolis, MN), 10 ng/mL epidermal growth factor (R&D Systems), and 2.75 ng/ mL selenium (insulin-transferrin-selenium solution; Invitrogen, Carlsbad, CA).10 Then, the 100 µL of the diluted cell suspension was seeded onto each well in a 96-well plate at a density of 102 cells/well. The medium was supplemented with fresh growth factors once a week. At day 21, spheres larger than 40 µm were obtained through a 40-µm cell strainer (BD Biosciences) and counted. Xenograft Tumorigenicity Assay. Four-week-old male BALB/c nude mice were purchased from OrientBio (Korea). The mice were randomly divided into groups and maintained under standard conditions and cared for according to the institutional guidelines for animal care. All animal experiments were approved by the Committee for the Care and Use of Laboratory Animals of Korea University. Initially, to evaluate the capacity to generate tumor nodules, 2 × 106 Huh7 cells/100 µL PBS/ Matrigel (BD) (1:1) were injected subcutaneously in both flanks. Then, unseparated CD133+ and CD133- purified cells, suspended in 100 µL of PBS/Matrigel (1:1), were injected subcutaneously into both flanks of BALB/c nude mice. Tumor formation was monitored once a week. After 10 weeks, all of the mice were sacrificed and then the tumor volume was measured. Removed tumors were fixed in a 10% formalin solution (Sigma) and paraffin embedded for immunohistochemistry. Preparation of Single-Cell Suspensions of Tumor Cells. Xenogrft tumors were cut up into small pieces and then minced completely using sterile blades. To obtain single cell suspensions, tumor pieces were mixed with ultrapure collagenase IV and allowed to incubate at 37 °C for 2 h. Pipetting with a 10 mL pipet was done every 15-20 min. At the end of the incubation, cells were filtered through a 100-µm nylon mesh and washed with HBSS/20% FBS and then washed twice with HBSS. Transgelin Cloning and Transfection. The 611 bp BamHIHindIII fragment of Transgelin full-lenth cDNA was cloned to the plasmid pEGFP N1. Sorted cells using MACS were transiently transfected with the plasmids harboring Transgelin or vector only using Lipofectamine 2000 (Invitrogen). One day before transfection, the cells were plated on 6-well plates with antibiotic-free serum. At the time of transfection, the cell confluence was 50%. All procedures were performed according to the manufacturer’s instructions. The cells were incubated at 37 °C in a humidified atmosphere with 5% CO2 for 24 h. After 24 h, the cells were evaluated by Western blotting, or sequentially used in the invasion assay. Small Interfering RNA (siRNA) Transfection. The siRNA duplexes targeting human Transgelin mRNA (NM_001001522) and scrambled siRNA were obtained from Samchuli Pharm (Korea). The oligonucleotide sequences of the target sequences for human Transgelin were as follows: sense, CCAAAAUCGAGAAGAAGUAUU; antisense for Transgelin mRNA, P-UACUUCUUCUCGAUUUUGGUU.18 One day before transfection, the cells were plated on 6-well plates with antibiotic-free serum. Then, 33 pmol/L siRNA was added using Lipofectamine 2000 (Invitrogen) as a transfection reagent according to the manu5110

Journal of Proteome Research • Vol. 9, No. 10, 2010

Lee et al. facturer’s protocol. After 24 h of incubation with siRNA, the cells were evaluated by Western blotting, or sequentially used in the invasion assay. Invasion Assay. Sorted cells each transfected with Transgelin siRNA, scrambled siRNA, Transgelin plasmid, and vector plasmid were seeded at a density of 105 cells/well onto 24 well Transwell (8.0 µm, Corning), which was coated with the Basement Membrane Extract (Trevigen) and Coating Buffer (Trevigen). All procedures were performed according to the manufacturer’s instructions. Briefly, one day before seeding onto the 24 well Transwell, the medium was changed to serumfree medium. Cells transfected with Transgelin siRNA, scrambled siRNA, Transgelin plasmid, and vector plasmid in serum-free DMEM were placed in the upper chambers. DMEM containing 10% FBS was used as a chemoattractant in the lower chamber. The invasion assay was performed at 37 °C in a humidified atmosphere with 5% for 24 or 48 h in triplicate. After 24 or 48 h, cells were fixed and stained using a crystal violet solution and nonmigrated cells were removed by cotton swabbing. The membranes were solubilized with 36% acetic acid and the absorbance was measured at 620 nm.20 Immunohistochemistry. Immunohistochemistry was performed using the anti-Transgelin antibody (Abcam) and CXCR4 (Abcam) After deparaffinization and dehydration, the sections were immersed in methanol containing 3% hydrogen peroxide for blocking, and microwave antigen retrieval was performed in citrate buffer (0.01M, pH 6.0). Sections were incubated sequentially with primary antibody and peroxidase-conjugated secondary antibody. Slides were developed with DAKO Liquid DAB+ Substrate-Chromogen System (DAKO, Carpinteria, CA). For fluorescent immunohistochemistry, Alexa Fluor 568conjugated antibody and FITC-conjugated antibody were used as secondary antibodies, and finally all sections were counterstained with DAPI. Statistical Analysis. The Mann-Whitney’s U-test was used to determine the statistical significance of the results and to compare the means of the two groups. The data were expressed as means ( standard deviations. P < 0.05 was accepted as statistically significant.

Results CD133+ Huh7 Cells Are More Tumorigenic Than CD133Huh7 Cells. CD133+ cells and CD133- cells were sorted from the HCC cell line, Huh7, using MACS and analyzed by flow cytometry before and after MACS for purity, which ranged from 85 to 90% and 90 to 95%, respectively (Figure 1A). Western blot analysis was also performed to further confirm the purity (Figure 1B). Then, a sphere formation assay was conducted to determine the ability of the CD133+ Huh7 cells to form tumors (Figure 1C). CD133+ cells formed at least 4 times as many tumor spheres as CD133- cells. This tumorigenic potential of CD133+ Huh7 cells was also validated by assessing tumor development in BALB/c nude mice. In our pilot studies, 2 × 106 unsorted Huh7 cells formed tumors within 1 month after subcutaneous inoculation [data not shown]. By contrast, the subcutaneous injection of 5 × 104 CD133+ cells generated a large tumor in BALB/c nude mice, while the same number of CD133- cells was not tumorigenic (Figure 1D). It should be noted that 5 × 104 CD133+ cells were sufficient for consistent tumor development in the nude mice, whereas at least 60 times as many CD133- cells were necessary to obtain tumor development (Table 1). Therefore, CD133+ Huh7 cells

Transgelin Promotes Migration and Invasion of CSCs

research articles

Figure 1. Tumorigenic potential of CD133+ cells and CD133- cells isolated from Huh7. (A) A flow cytometry histogram after MACS with an anti-CD133 antibody. (light green, isotype control; blue, CD133- Huh7 cells; red, CD133+ Huh7 cells). (B) Western blotting. CD133 expression was analyzed in the sorted CD133+ and CD133- Huh7 cells. β-Actin was used as a loading control. (C) Sphere formation assay. The purified cells were seeded at a density of 100 cells/well onto 96-well plates, and spheres larger than 40 µm were obtained using a 40-µm cell strainer (BD Biosciences) and counted at day 21. The data are reported as mean ( standard error of the mean (SEM). (D) Comparison of tumorigenicity between CD133+ Huh7 cells and CD133- Huh7 cells in BALB/c nude mice. Table 1. In Vivo Tumor Formation from CD133+ and CD133Huh7 Cells cell type +

CD133 Huh7 cells

CD133- Huh7 cells

cell numbers injected

tumor incidence

5000 10000 50000 300000 1000000 3000000 5000 10000 50000 300000 1000000 3000000

1/6 2/6 4/4 5/5 5/5 5/5 0/6 0/6 0/4 2/5 3/5 5/5

possessed a much greater capability for tumor formation in vitro and in vivo than the CD133- counterparts. Differently Expressed Proteins Are Detected between CD133+ Cells and CD133- Cells. Since CD133+ Huh7 cells were more tumorigenic than CD133- Huh7 cells (Figure 1), it was suspected that CD133+ Huh7 cells have differently expressed proteins, which function as critical factors for their distinct features. To systematically examine this, we employed proteomics techniques. Master 2-DE maps showed several spots up- or down-regulated in CD133+ Huh7 cells and CD133- Huh7 cells (Figure 2A). The differently expressed spots were selected using ImageMaster 2D Platinum Software and analyzed by Mann-Whitney’s U-test (p < 0.05), and then their relative intensity was measured (Figure 2B,C). Among the 33 spots differentially expressed between CD 133+ cells and CD 133cells, six spots, which showed either 50% down-regulation or 100% up-regulation (p < 0.05) in CD133+ cells as compared to those of CD133- cells, were identified via ESI-Q-TOF MS/MS. Table 2 shows five down-regulated proteins and one upregulated protein in CD133+ Huh7 cells. A uniquely upregulated protein was identified as Transgelin, a cytoskeletonassociated protein related to TGF-β/Smad3-dependent migration

of epithelial cells.18 The protein level of Transgelin was 25-fold higher in CD133+ cells than CD133- cells. The down-regulated proteins consisted of the COP9 complex subunit 4 (49.18 ( 11.99 versus 162.56 ( 27.12), unnamed protein product (63.64 ( 14.37 versus 148.31 ( 31.639), p64 CLCP (43.45 ( 4.45 versus 116.18 ( 4.94), thioredoxin peroxidase (60.42 ( 18.01 versus 144.19 ( 28.01), and beta-subunit (54.44 ( 14.58 versus 126.03 ( 24.75). Transgelin Is Highly Expressed in Tumorigenic Cells. We verified the up-regulation of Transgelin in CD133+ Huh7 cells by RT-PCR and Western blotting. As shown in Figure 3A, both Transgelin mRNA and protein were strongly expressed in CD133+ Huh7 cells, whereas rarely detected in CD133- cells. This strong expression of Transgelin was also observed in Huh7 cell-derived tumor nodules (Figure 3B). It should be noted that Transgelin was localized to both the cytoplasm and nucleus of the tumor sections. In addition, CD133+ cells isolated from short-term culture of cells derived from Huh7-induced xenograft tumors expressed significantly increased levels of Trangelin as compared to their corresponding CD133- counterparts (Figure 3C and Supplemental Figure 1). To determine whether Transgelin is also highly expressed in tumorigenic cells derived from different cell lines or other organs, we examined its level in tumorigenic cells isolated from two HCC cell lines PLC/PRF5 and Hep 3B, a colorectal adenocarcinoma cell line HT-29, and two prostate carcinoma cell lines DU 145 and LNCaP (Figure 3D). Since CD133+ colon cancer cells have been known to be tumorigenic,8 HT-29 cells, as well as PLC/PRF5 and Hep 3B cells, were isolated with an anti-CD133 antibody. By contrast, DU 145 and LNCaP cells were purified with an anti-CD44 antibody (Supplemental Figure 1), based on a previous study demonstrating that CD44+ prostate cancer cells have properties of CSCs.21 The protein levels of Transgelin were much higher in the tumorigenic cells of Hep 3B, HT-29, DU 145, and LNCaP than the nontumorigenic cells. Interestingly, Transgelin was not detected in both tumorigenic and nontumorigenic cells from PLC/PRF5. ThereJournal of Proteome Research • Vol. 9, No. 10, 2010 5111

research articles

Lee et al.

Figure 2. Differently expressed proteins between CD133+ Huh7 cells and CD133- Huh7 cells. (A) Representative 2-DE maps of CD133+ and CD133- Huh7 cells. (B and C) Relative volume intensity of differentially expressed spots. Each bar represents the mean ( SEM of each spots. Significant differences were determined using the Mann-Whitney’s U-test (*p < 0.05, **p < 0.01, ***p < 0.001). Table 2. Differently Expressed Proteins in CD133+ Huh7 Cells Compared to CD133- Huh7 Cells spot no.

accession no.

name

mass (dalton)

pI

sequence coverage (%)

score

580 754 799 848 962 902

AAD43021 AK027037 CAA61020 NP_006397 ABD77240 M95787

COP9 complex subunit 4 Unnamed protein product p64 CLCP Thioredoxin peroxidase beta-subunit (AA 1-312) Transgelin

46169 37675 23813 30749 38629 22461

5.57 7.99 5.12 5.86 4.90 8.56

4 8 8 9 6 5

90 90 102 96 73 59

fore, except for PLC/PRF5 cells, Transgelin was strongly expressed in CSCs, regardless of where the organ tumorigenic cells were from. Transgelin Regulates Migration and Invasion of Tumorigenic Cells. CSCs are responsible for tumor metastasis.11,22 Since Transgelin has been suggested to be a direct target of TGF-β/Smad3-dependent cell migration in lung fibrosis,18 we hypothesized that Transgelin plays a vital role in the migration and invasion of CSCs. As a first step to determine if Transgelin regulates the metastasis of tumerigenic cells, we compared the migratory and invasive abilities of CD133+ Huh7 cells and CD133- Huh7 cells using Transwell coated with Basement Membrane Extract, a basement membrane model used to estimate metastatic potential in vitro. As illustrated in Figure 4A, CD133+ cells, which highly express Transgelin, invaded the basement membrane at least 2-fold more than CD133- cells. 5112

Journal of Proteome Research • Vol. 9, No. 10, 2010

fold

1 1 1 1 1 2

3.32 2.33 2.67 2.38 2.31 25.77

Next, to directly evaluate whether Transgelin affects the migration and invasion of tumorigenic cells, Transgelin was down- and up-regulated using small interfering (si) RNA and pEGFP N1-Tansgelin (Tagln), respectively. Tagln siRNA significantly interfered with the invasiveness of CD133+ Huh7 cells (Figure 4B). While the scrambled siRNA showed no effect, Tagln siRNA decreased the invasivenss by 80%. Interestingly, CD133+ cells transfected with Tagln siRNA were even less invasive than CD133- cells. However, Tagln siRNA did not influence the invasiveness of CD133- cells, which might be due to the low expression levels of Transgelin. The contribution of Transgelin to the cell migration and invasion was also verified in pEGFP N1-Tagln transfected cells. pEGFP N1-Tagln transfected cells showed markedly enhanced invasive ability. Overexpressed Transgelin allowed both tumorigenic and nontumrigenic cells to effectively invade the BME coated membrane (Figure 4C).

research articles

Transgelin Promotes Migration and Invasion of CSCs

Figure 3. Expression of Transgelin in tumorigenic cells. (A) The expression levels of Transgelin in CD133+ and CD133- Huh7 cells were measured by RT-PCR (left) and Western blotting (right). GAPDH and β-actin served as the loading controls. (B) Illustrations of hematoxylin and eosin staining (H&E) and immunohistochemistry with an anti-Transgelin antibody on Huh7 cell-derived tumor sections. Pictures were taken at 10× and 40× magnification, respectively. (C) The expression levels of Transgelin in CD133+ and CD133- cells isolated from Huh7-induced xenograft tumors were measured by Western blotting. (D) The protein levels of Transgelin in tumorigenic cells sorted from DU 145, LNCaP, PLC/PRF5, Hep 3B, and HT-29 cell lines were analyzed by Western blotting. β-Actin served as a loading control.

Taken together, we concluded that Transgelin is directly associated with the migratory and invasive ability of tumorigenic cells, which implies that it plays a vital role in tumor metastasis caused by CSCs. Tumorigenic Cells Highly Express Epithelial to Mesenchymal Transition (EMT)-Associated Genes and CXCR4. Transgelin has been known to be a direct target of TGF-β signaling by which cells undergo some phenotypic and morphologic alterations related with EMT.23 Since Transgelin was highly expressed in CD133+ Huh7 cells (Figures 2 and 3), we evaluated the expression of EMT-associated genes, an epithelial marker, E-cadherin, and mesenchymal markers such as N-cadherin, Vimentin, Slug, and Twist. Compared to CD133- cells, Ecadherin was down-regulated in CD133+ cells, and mesenchymal markers, except for Twist, were up-regulated (Figure 5A). On the basis of the fact that EMT is an early event in tumor metastasis, we concluded that CSCs could facilitate initiation of metastasis by prompting the expression of EMT-related genes including Transgelin. CXCR4, a receptor of stromal cell-derived factor 1 (SDF-1), has been known to mediate cell migration,24 and cells expressing both CXCR4 and CD133 have been considered CSCs, determining tumor growth and metastasis.11 Since CD133+ Huh7 cells were tumorigenic and invasive (Figures 1 and 4), we investigated whether CXCR4 is also expressed in CD133+ Huh7 cells. As shown in Figure 5B, CXCR4 was highly expressed in CD133+ cells, whereas almost no or little expression was observed in CD133- cells. The strong expression of CXCR4 was also observed in the tumor nodules derived from Huh7-induced xenografts (Figure 5C). More importantly, Transgelin and CXCR4 were not only co-expressed in CD133+ cells, but also co-localized in some cells. These results suggest that Transgelin is a pivotal factor that regulates the metastatic ability of CSCs.

Discussion CSCs have been reported to possess the ability to initiate malignancies, promote tumor formation, drive metastasis, and evade conventional chemotherapies. Therefore, therapeutic approaches specifically targeted at CSCs hold great promise in the treatments of cancer. Large-scale analysis of molecular mechanisms underlying the maintenance and functions of CSCs via proteomic techniques might be a rational strategy to provide reasonable targets for CSC-targeted therapies. In this study, we isolated tumorigenic CD133+ cells from a HCC cell line, Huh7, and analyzed their proteome to systematically identify proteins correlated with specific properties of CSCs (Figures 1 and 2). Proteomic analysis revealed that Transgelin was highly expressed in the tumorigenic CD133+ Huh7 cells. The strong expression of Transgelin was also observed in other types of tumerigenic cells that originated from colorectal and prostate cancer (Figure 3). However, almost no or little expression of Transgelin was detected in all types of nontumorigenic cells tested. These results suggest a close correlation between the high expression of Transgelin and maintenance and/or functions of CSCs. Metastasis is the main cause of lethality in cancer patients. Recent studies have suggested that not all cells in tumors have the ability to metastasize to other organs, and CSCs are responsible for tumor invasion, the first step to metastasis.22,25 The metastatic potential of CSCs is known to rely on diverse factors that determine the growth, survival, angiogenesis, and invasion of tumors. Transgelin seemed to be directly associated with the migratory and invasive ability of tumorigenic cells (Figure 4). The overexpression of transgelin increased the invasiveness of both tumorigenic and nontumorigenic cells, whereas suppressed expression remarkably decreased the Journal of Proteome Research • Vol. 9, No. 10, 2010 5113

research articles

Lee et al.

Figure 4. Effect of Transgelin on the migration and invasion of CD133+ and CD133- Huh7 cells. (A) The invasive ability of CD133+ and CD133- Huh7 cells was determined in 24-well transwells with 8.0-µm filters coated with Basement Membrane Extract. (B) Effect of Transgelin knockdown by siRNA treatment. CD133+ and CD133- Huh7 cells were transfected with 33nM scrambled (scr) or Transgelin siRNA. Untransfected cells (none) or scrambled treated cells (scr) served as negative controls. (C) Invasion ability of Transgelinoverexpressing CD133+ and CD133- Huh7 cells. Untransfected cells (none) or vector tranfected cells (pEGFP N1) served as negative controls. Data are presented as the means ( standard deviations of three independent experiments performed. Pictures were taken at 10× magnification.

invasiveness of tumorigenic cells. Furthermore, Transgelin was co-expressed with CXCR4 (Figure 5). CXCR4, a receptor for chemokine SDF1, has been suggested as a critical factor for the metastatic potential of CSCs and tumor invasion.26,27 It increases organ-specific metastasis of pancreatic cancer cells,24 and CD133+CXCR4+ cells isolated from pancreatic cancer cell lines show in vivo metastatic activity in the liver.11 The observation that both Transgelin and CXCR4 were not only highly expressed in the cytoplasm of tumorigenic cells, but also 5114

Journal of Proteome Research • Vol. 9, No. 10, 2010

co-localized in some cells indicates that a specific interaction may occur between Transgelin and CXCR4 in CSCs to modulate tumor metastasis; however, further studies will be necessary to confirm this hypothesis. Taken together, our results indicate that Transgelin is one of the major regulators of the metastatic ability of CSCs. In the metastatic process, EMT, which is involved in the disruption of epithelial cell features and the gain of migratory mesenchymal phenotypes, is considered to be a crucial event.

Transgelin Promotes Migration and Invasion of CSCs

research articles

Figure 5. Expression of EMT related genes and CXCR4 in CD133+ and CD133- Huh7 cells. (A) The mRNA levels of EMT related genes were measured by RT-PCR. (B) The mRNA (top) and protein (bottom) expression of CXCR4 were analyzed by RT-PCR and Western blotting, respectively. GAPDH and β-actin served as the loading controls. (C) Co-localization of Transgelin and CXCR4 in Huh7 cellderived tumor sections. Double immunofluorescence in the same tissue section shows staining for Transgelin in green and staining for CXCR4 in red. Blue staining of nuclei can be seen in the third picture and an overlay of all three is seen in the last picture. Arrows indicate cells co-expressing Transgelin and CXCR4. Bar ) 10 µm.

Recent reports have shown that stem-like cells isolated from mammary carcinomas express EMT markers28,29 and that cells undergoing EMT partially have characteristics of metastatic cancer cells.28 This is in agreement with our findings that in tumorigenic and invasive CSCs an epithelial marker E-cadherin was down-regulated, and mesenchymal markers were upregulated (Figure 5). On the basis of previous reports demonstrating that Transgelin, which is a direct target of TGF-β signaling, is involved in TGF-β/Smad3-dependent epithelial cell migration18 and EMT-related phenotypic and morphologic alterations,23 we concluded that tumorigenic and invasive CSCs overexpress Transgelin, which regulates EMT associated genes.30 In addition, it should be noted that, although Twist has been known as a master regulator of metastasis by promoting EMT through the TGF-β signaling pathway,31,32 no detectable Twist mRNA was found in the Huh7 cells in this study, which is also consistent with other reports.33 On the basis of these findings, it is our hypothesis that Transgelin may replace Twist as a key regulator of TGF-β signaling at least in Huh7 tumorigenic cells undergoing EMT. Taken together, CSCs might exert their specific actions at least in part through the ability to induce the expression of EMT-related genes by modulating signal cascades including TGF-β and Transgelin. As one of the actin-binding proteins that controls cell motility through a direct interaction with the actin cytoskeleton,34,35 Transgelin is known to be present in the cytoplasm of fibroblasts and some epithelial cells. Transgelin-2 is also known to exist on the surface of human embryonic stem cells.36 It would be worthwhile to note that Transgelin was observed both in the cytoplasm and nucleus of tumor sections derived from xenografts (Figure 3). This result seems to run parallel to a previous study suggesting that Transgelin might function as a transcription factor, considering that actin plays an important role in nuclear processes connected with transcription37,38 and that Transgelin influences the expression levels of EMT related

genes.30 It is possible that Transgelin functions as both a regulator for cellular plasticity in the cytoplasm and a transcriptional factor in the nucleus. The expression patterns of Transgelin have been reported to be various depending on tumor types. Increased expression of Transgelin has been reported in esophageal squamous cell carcinoma, hepatocellular carcinoma, gastric cancer, pancreatic cancer, and colon cancer.30,39-43 This up-regulation has been referred to as a diagnostic marker of transformation.40 Moreover, recent researches, including our data (Figure 4), have shown that the reduced expression of Transgelin markedly interferes with the invasiveness.18 In contrast, it has been also suggested that Transgelin expression is significantly reduced in human breast, and Transgelin can inhibit prostate cancer cell growth.44,45 In addition, a previous study documented that the increased Transgelin expression resulted in low invasive ability of human fibrosarcoma by negatively regulating the expression of MMP-9.46 With these contradictory data, Transgelin has been considered as both a tumor suppressor and a tumor biomarker.30,42,45,47 These paradoxical roles of Transgelin would result from the organ-specific mechanism or the diverse functions of the TGF-β signaling pathway, which not only prevents tumor progression but also mediates migration.48-50 Besides Transgelin, we also identified several other proteins through proteomic analysis (Table 2). Among the proteins differentially expressed in CD133+ Huh7 cells, the COP9 complex subunit 4, a subunit of the COP9 signalosome, is involved in transcriptional regulation by occupying the target gene promoters of the Drosophila Retinoblastoma family (Rbf). It has been reported that the COP9 signalosome plays a vital role in Rbf1 and Rbf2 stability, which is involved at multiple steps in cell cycle control during development,51 and regulates Cullin-containing ubiquitin E3 ligases, which are central mediators of diverse cellular functions essential during cancer progression.52 There was a recent report that showed an inverse Journal of Proteome Research • Vol. 9, No. 10, 2010 5115

research articles

Lee et al. 53

correlation between CSCs and Rb. This study suggested that a mutation in Rb might contribute to the transformation of CSCs from normal stem cells in that RB-deficient cells are more proliferative, tumorigenic, and resistant to hormonal therapies.53,54 Consistent with this report, we found that the COP9 complex subunit 4, which regulates Rb stability, is expressed at low levels in CD133+ Huh7 cells. Although further study is needed, we believe that the properties of CSCs are partly caused by the low levels of the COP9 complex subunit 4 resulting in decreased Rb stability. While rapid development of the CSC field has allowed for the identification and characterization of CSCs, little is known about the cellular mechanisms affecting their distinct functions. In this study, Transgelin was shown to be highly expressed in CSCs. More importantly, the research summarized in the present study provides a distinct mechanism underlying the tumor metastasis caused by CSCs: the metastatic potential of CSCs arises from the elevated levels of Transgelin. Although a large-scale clinical study is necessary to confirm the significance and effectiveness, the development of Transgelintargeted therapies might have potential as a rational therapeutic strategy against tumor formation and metastasis in the progress of cancer.

Acknowledgment. This study was supported by BK21 (Brain Korea 21). E.-K.L. was supported in part by a Seoul Science Fellowship. Supporting Information Available: RT-PCR primers used in this study; isolation of cancer stem cells from DU 145, LNCaP, Hep 3B, PLC/PRF5, HT-29, and xenograft tumors using FACS. This material is available free of charge via the Internet at http://pubs.acs.org. References (1) Sawyers, C. Targeted cancer therapy. Nature 2004, 432 (7015), 294–7. (2) Parkin, D. M.; Bray, F.; Ferlay, J.; Pisani, P. Global cancer statistics, 2002. CA Cancer J. Clin. 2005, 55 (2), 74–108. (3) Visvader, J. E.; Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat. Rev. Cancer 2008, 8 (10), 755–68. (4) Al-Hajj, M.; Wicha, M. S.; Benito-Hernandez, A.; Morrison, S. J.; Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc. Natl. Acad. Sci. U.S.A. 2003, 100 (7), 3983–8. (5) Singh, S. K.; Hawkins, C.; Clarke, I. D.; Squire, J. A.; Bayani, J.; Hide, T.; Henkelman, R. M.; Cusimano, M. D.; Dirks, P. B. Identification of human brain tumour initiating cells. Nature 2004, 432 (7015), 396–401. (6) Collins, A. T.; Berry, P. A.; Hyde, C.; Stower, M. J.; Maitland, N. J. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res. 2005, 65 (23), 10946–51. (7) Li, C.; Heidt, D. G.; Dalerba, P.; Burant, C. F.; Zhang, L.; Adsay, V.; Wicha, M.; Clarke, M. F.; Simeone, D. M. Identification of pancreatic cancer stem cells. Cancer Res. 2007, 67 (3), 1030–7. (8) O’Brien, C. A.; Pollett, A.; Gallinger, S.; Dick, J. E. A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature 2007, 445 (7123), 106–10. (9) Ma, S.; Lee, T. K.; Zheng, B. J.; Chan, K. W.; Guan, X. Y. CD133+ HCC cancer stem cells confer chemoresistance by preferential expression of the Akt/PKB survival pathway. Oncogene 2008, 27 (12), 1749–58. (10) Hong, S. P.; Wen, J.; Bang, S.; Park, S.; Song, S. Y. CD44-positive cells are responsible for gemcitabine resistance in pancreatic cancer cells. Int. J. Cancer 2009, 125 (10), 2323–31. (11) Hermann, P. C.; Huber, S. L.; Herrler, T.; Aicher, A.; Ellwart, J. W.; Guba, M.; Bruns, C. J.; Heeschen, C. Distinct populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer. Cell Stem Cell 2007, 1 (3), 313–23. (12) Yu, S. C.; Bian, X. W. Enrichment of cancer stem cells based on heterogeneity of invasiveness. Stem Cell Rev. 2009, 5 (1), 66–71.

5116

Journal of Proteome Research • Vol. 9, No. 10, 2010

(13) Dean, M.; Fojo, T.; Bates, S. Tumour stem cells and drug resistance. Nat. Rev. Cancer 2005, 5 (4), 275–84. (14) Miraglia, S.; Godfrey, W.; Yin, A. H.; Atkins, K.; Warnke, R.; Holden, J. T.; Bray, R. A.; Waller, E. K.; Buck, D. W. A novel fivetransmembrane hematopoietic stem cell antigen: isolation, characterization, and molecular cloning. Blood 1997, 90 (12), 5013– 21. (15) Kasper, S. Identification, characterization, and biological relevance of prostate cancer stem cells from clinical specimens. Urol. Oncol. 2009, 27 (3), 301–3. (16) Ma, S.; Chan, K. W.; Hu, L.; Lee, T. K.; Wo, J. Y.; Ng, I. O.; Zheng, B. J.; Guan, X. Y. Identification and characterization of tumorigenic liver cancer stem/progenitor cells. Gastroenterology 2007, 132 (7), 2542–56. (17) Yin, S.; Li, J.; Hu, C.; Chen, X.; Yao, M.; Yan, M.; Jiang, G.; Ge, C.; Xie, H.; Wan, D.; Yang, S.; Zheng, S.; Gu, J. CD133 positive hepatocellular carcinoma cells possess high capacity for tumorigenicity. Int. J. Cancer 2007, 120 (7), 1444–50. (18) Yu, H.; Konigshoff, M.; Jayachandran, A.; Handley, D.; Seeger, W.; Kaminski, N.; Eickelberg, O. Transgelin is a direct target of TGFbeta/Smad3-dependent epithelial cell migration in lung fibrosis. FASEB J. 2008, 22 (6), 1778–89. (19) Kim, H. J.; Cho, E. H.; Yoo, J. H.; Kim, P. K.; Shin, J. S.; Kim, M. R.; Kim, C. W. Proteome analysis of serum from type 2 diabetics with nephropathy. J. Proteome Res. 2007, 6 (2), 735–43. (20) Mayoral, R.; Fernandez-Martinez, A.; Bosca, L.; Martin-Sanz, P. Prostaglandin E2 promotes migration and adhesion in hepatocellular carcinoma cells. Carcinogenesis 2005, 26 (4), 753–61. (21) Patrawala, L.; Calhoun, T.; Schneider-Broussard, R.; Li, H.; Bhatia, B.; Tang, S.; Reilly, J. G.; Chandra, D.; Zhou, J.; Claypool, K.; Coghlan, L.; Tang, D. G. Highly purified CD44+ prostate cancer cells from xenograft human tumors are enriched in tumorigenic and metastatic progenitor cells. Oncogene 2006, 25 (12), 1696–708. (22) Klarmann, G. J.; Hurt, E. M.; Mathews, L. A.; Zhang, X.; Duhagon, M. A.; Mistree, T.; Thomas, S. B.; Farrar, W. L. Invasive prostate cancer cells are tumor initiating cells that have a stem cell-like genomic signature. Clin. Exp. Metastasis 2009, 26 (5), 433–46. (23) Christiansen, J. J.; Rajasekaran, A. K. Reassessing epithelial to mesenchymal transition as a prerequisite for carcinoma invasion and metastasis. Cancer Res. 2006, 66 (17), 8319–26. (24) Saur, D.; Seidler, B.; Schneider, G.; Algul, H.; Beck, R.; Senekowitsch-Schmidtke, R.; Schwaiger, M.; Schmid, R. M. CXCR4 expression increases liver and lung metastasis in a mouse model of pancreatic cancer. Gastroenterology 2005, 129 (4), 1237–50. (25) Sheridan, C.; Kishimoto, H.; Fuchs, R. K.; Mehrotra, S.; BhatNakshatri, P.; Turner, C. H.; Goulet, R., Jr.; Badve, S.; Nakshatri, H. CD44+/CD24- breast cancer cells exhibit enhanced invasive properties: an early step necessary for metastasis. Breast Cancer Res. 2006, 8 (5), R59. (26) Miller, R. J.; Banisadr, G.; Bhattacharyya, B. J. CXCR4 signaling in the regulation of stem cell migration and development. J. Neuroimmunol. 2008, 198 (1-2), 31–8. (27) Krohn, A.; Song, Y. H.; Muehlberg, F.; Droll, L.; Beckmann, C.; Alt, E. CXCR4 receptor positive spheroid forming cells are responsible for tumor invasion in vitro. Cancer Lett. 2009, 280 (1), 65–71. (28) Mani, S. A.; Guo, W.; Liao, M. J.; Eaton, E. N.; Ayyanan, A.; Zhou, A. Y.; Brooks, M.; Reinhard, F.; Zhang, C. C.; Shipitsin, M.; Campbell, L. L.; Polyak, K.; Brisken, C.; Yang, J.; Weinberg, R. A. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008, 133 (4), 704–15. (29) Mani, S. A.; Yang, J.; Brooks, M.; Schwaninger, G.; Zhou, A.; Miura, N.; Kutok, J. L.; Hartwell, K.; Richardson, A. L.; Weinberg, R. A. Mesenchyme Forkhead 1 (FOXC2) plays a key role in metastasis and is associated with aggressive basal-like breast cancers. Proc. Natl. Acad. Sci. U.S.A. 2007, 104 (24), 10069–74. (30) Lin, Y.; Buckhaults, P. J.; Lee, J. R.; Xiong, H.; Farrell, C.; Podolsky, R. H.; Schade, R. R.; Dynan, W. S. Association of the actin-binding protein transgelin with lymph node metastasis in human colorectal cancer. Neoplasia 2009, 11 (9), 864–73. (31) Yang, J.; Mani, S. A.; Donaher, J. L.; Ramaswamy, S.; Itzykson, R. A.; Come, C.; Savagner, P.; Gitelman, I.; Richardson, A.; Weinberg, R. A. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 2004, 117 (7), 927–39. (32) Pozharskaya, V.; Torres-Gonzalez, E.; Rojas, M.; Gal, A.; Amin, M.; Dollard, S.; Roman, J.; Stecenko, A. A.; Mora, A. L. Twist: a regulator of epithelial-mesenchymal transition in lung fibrosis. PLoS One 2009, 4 (10), e7559. (33) Matsuo, N.; Shiraha, H.; Fujikawa, T.; Takaoka, N.; Ueda, N.; Tanaka, S.; Nishina, S.; Nakanishi, Y.; Uemura, M.; Takaki, A.; Nakamura, S.; Kobayashi, Y.; Nouso, K.; Yagi, T.; Yamamoto, K.

research articles

Transgelin Promotes Migration and Invasion of CSCs

(34)

(35) (36)

(37) (38)

(39) (40)

(41)

(42)

(43)

(44)

Twist expression promotes migration and invasion in hepatocellular carcinoma. BMC Cancer 2009, 9, 240. Lawson, D.; Harrison, M.; Shapland, C. Fibroblast transgelin and smooth muscle SM22alpha are the same protein, the expression of which is down-regulated in many cell lines. Cell Motil. Cytoskeleton 1997, 38 (3), 250–7. Shapland, C.; Hsuan, J. J.; Totty, N. F.; Lawson, D. Purification and properties of transgelin: a transformation and shape change sensitive actin-gelling protein. J. Cell Biol. 1993, 121 (5), 1065–73. Harkness, L.; Christiansen, H.; Nehlin, J.; Barington, T.; Andersen, J. S.; Kassem, M. Identification of a membrane proteomic signature for human embryonic stem cells independent of culture conditions. Stem Cell Res. 2008, 1 (3), 219–27. Vartiainen, M. K.; Guettler, S.; Larijani, B.; Treisman, R. Nuclear actin regulates dynamic subcellular localization and activity of the SRF cofactor MAL. Science 2007, 316 (5832), 1749–52. Hofmann, W. A.; Stojiljkovic, L.; Fuchsova, B.; Vargas, G. M.; Mavrommatis, E.; Philimonenko, V.; Kysela, K.; Goodrich, J. A.; Lessard, J. L.; Hope, T. J.; Hozak, P.; de Lanerolle, P. Actin is part of pre-initiation complexes and is necessary for transcription by RNA polymerase II. Nat. Cell Biol. 2004, 6 (11), 1094–101. Qi, Y.; Chiu, J. F.; Wang, L.; Kwong, D. L.; He, Q. Y. Comparative proteomic analysis of esophageal squamous cell carcinoma. Proteomics 2005, 5 (11), 2960–71. Shi, Y. Y.; Wang, H. C.; Yin, Y. H.; Sun, W. S.; Li, Y.; Zhang, C. Q.; Wang, Y.; Wang, S.; Chen, W. F. Identification and analysis of tumour-associated antigens in hepatocellular carcinoma. Br. J. Cancer 2005, 92 (5), 929–34. Li, N.; Zhang, J.; Liang, Y.; Shao, J.; Peng, F.; Sun, M.; Xu, N.; Li, X.; Wang, R.; Liu, S.; Lu, Y. A controversial tumor marker: is SM22 a proper biomarker for gastric cancer cells. J. Proteome Res. 2007, 6 (8), 3304–12. Huang, Q.; Chen, W.; Wang, L.; Lin, W.; Lin, J.; Lin, X. Identification of transgelin as a potential novel biomarker for gastric adenocarcinoma based on proteomics technology. J. Cancer Res. Clin. Oncol. 2008, 134 (11), 1219–27. Mikuriya, K.; Kuramitsu, Y.; Ryozawa, S.; Fujimoto, M.; Mori, S.; Oka, M.; Hamano, K.; Okita, K.; Sakaida, I.; Nakamura, K. Expression of glycolytic enzymes is increased in pancreatic cancerous tissues as evidenced by proteomic profiling by two-dimensional electrophoresis and liquid chromatography-mass spectrometry/ mass spectrometry. Int. J. Oncol. 2007, 30 (4), 849–55. Shields, J. M.; Rogers-Graham, K.; Der, C. J. Loss of transgelin in breast and colon tumors and in RIE-1 cells by Ras deregulation of

(45)

(46)

(47)

(48)

(49)

(50)

(51) (52) (53) (54)

gene expression through Raf-independent pathways. J. Biol. Chem. 2002, 277 (12), 9790–9. Yang, Z.; Chang, Y. J.; Miyamoto, H.; Ni, J.; Niu, Y.; Chen, Z.; Chen, Y. L.; Yao, J. L.; di Sant’Agnese, P. A.; Chang, C. Transgelin functions as a suppressor via inhibition of ARA54-enhanced androgen receptor transactivation and prostate cancer cell growth. Mol. Endocrinol. 2007, 21 (2), 343–58. Nair, R. R.; Solway, J.; Boyd, D. D. Expression cloning identifies transgelin (SM22) as a novel repressor of 92-kDa type IV collagenase (MMP-9) expression. J. Biol. Chem. 2006, 281 (36), 26424– 36. Zhang, Y.; Ye, Y.; Shen, D.; Jiang, K.; Zhang, H.; Sun, W.; Zhang, J.; Xu, F.; Cui, Z.; Wang, S. Identification of transgelin-2 as a biomarker of colorectal cancer by laser capture microdissection and quantitative proteome analysis. Cancer Sci. 2010, 101 (2), 523–9. Becker, C.; Fantini, M. C.; Schramm, C.; Lehr, H. A.; Wirtz, S.; Nikolaev, A.; Burg, J.; Strand, S.; Kiesslich, R.; Huber, S.; Ito, H.; Nishimoto, N.; Yoshizaki, K.; Kishimoto, T.; Galle, P. R.; Blessing, M.; Rose-John, S.; Neurath, M. F. TGF-beta suppresses tumor progression in colon cancer by inhibition of IL-6 trans-signaling. Immunity 2004, 21 (4), 491–501. Qiu, P.; Ritchie, R. P.; Gong, X. Q.; Hamamori, Y.; Li, L. Dynamic changes in chromatin acetylation and the expression of histone acetyltransferases and histone deacetylases regulate the SM22alpha transcription in response to Smad3-mediated TGFbeta1 signaling. Biochem. Biophys. Res. Commun. 2006, 348 (2), 351–8. Qiu, P.; Feng, X. H.; Li, L. Interaction of Smad3 and SRF-associated complex mediates TGF-beta1 signals to regulate SM22 transcription during myofibroblast differentiation. J. Mol. Cell. Cardiol. 2003, 35 (12), 1407–20. Ullah, Z.; Buckley, M. S.; Arnosti, D. N.; Henry, R. W. Retinoblastoma protein regulation by the COP9 signalosome. Mol. Biol. Cell 2007, 18 (4), 1179–86. Richardson, K. S.; Zundel, W. The emerging role of the COP9 signalosome in cancer. Mol. Cancer Res. 2005, 3 (12), 645–53. Hwang-Verslues, W. W.; Chang, K. J.; Lee, E. Y.; Lee, W. H. Breast cancer stem cells and tumor suppressor genes. J. Formosan Med. Assoc. 2008, 107 (10), 751–66. Bosco, E. E.; Wang, Y.; Xu, H.; Zilfou, J. T.; Knudsen, K. E.; Aronow, B. J.; Lowe, S. W.; Knudsen, E. S. The retinoblastoma tumor suppressor modifies the therapeutic response of breast cancer. J. Clin. Invest. 2007, 117 (1), 218–28.

PR100378Z

Journal of Proteome Research • Vol. 9, No. 10, 2010 5117