Tuftsin-Modified Alginate Nanoparticles as a Noncondensing

Article pubs.acs.org/Biomac

Tuftsin-Modified Alginate Nanoparticles as a Noncondensing Macrophage-Targeted DNA Delivery System Shardool Jain and Mansoor Amiji* Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, Massachusetts 02115, United States ABSTRACT: The main objective of this study was to evaluate macrophage-targeted alginate nanoparticles as a noncondensing gene delivery system for potential anti-inflammatory therapy. An external gelation method was employed to form plasmid DNA-encapsulated alginate nanoparticles. The nanoparticle surface was modified with a peptide sequence containing tuftsin (TKPR), and transfection efficiency was determined in J774A.1 macrophages. The effect of transfected mIL-10 in blocking expression of tumor necrosis factor-alpha (TNF-α) was evaluated in lipopolysaccharide (LPS)-stimulated cells. Scrambled peptide- and tuftsin-modified cross-linked alginate nanoparticles efficiently encapsulated plasmid DNA and protected against DNase I degradation. The transgene expression efficiencies, measured using GFP and mIL-10 expressing plasmid DNA, were highest with tuftsin-modified nanoparticles. Levels of TNF-α were significantly lower (p < 0.0001) in LPSstimulated cells that were transfected with mIL-10 using alginate nanoparticles. The results of the study show that noncondensing alginate nanoparticles can efficiently deliver plasmid DNA, leading to sustained in vitro gene expression in macrophages.

■

INTRODUCTION The gene therapy approach is based on the concept that transfer of genetic material to specific cells of the body can lead to up-regulation in expression of the gene product (i.e., gain of function) or down-regulation in the production of the product (i.e., loss of function)1,2 The largest bottleneck for gene therapy has been the development of safe and efficacious delivery systems. The roadmap of effective transgene expression includes delivery of the nucleic acid construct to the targeted site, cellular-internalization and processing, and continuous production of the transgene product at the desired therapeutic levels and duration.3,4 Some of the polymer based systems that have been used for gene therapy include Chitosan, PEI, poly(Llysine), PEG, PEO, poly(D,L-lactic-co-glycolic acid) (PLGA), gelatin, alginate, and some cellulose derivatives and PEO/PPO/ PEO triblock copolymers (i.e., polaxamers or Pluronics). PEGand PEO-based polymers encapsulate DNA by forming hydrogen bonds with the nucleic acid bases.5−7 The advantage of employing polymers such as alginate or gelatin is that it facilitates in the controlled release of DNA from the polymer matrix system. Also, physical encapsulation of DNA enables protection from the enzymes and other plasma proteins during its transit from blood to the site of action. Cellular uptake is facilitated, since masking the negative charge of DNA prevents electrostatic repulsion between negatively charged DNA and the negatively charged cell surface. In addition, opsonization by IgM and an innate immune response are not favored in the case of noncondensing polymers because of their neutral or slightly negatively charged state.5−8 Alginate is a block copolymer that is made up of (1 → 4) linked β-D-mannuronic acid (M) and α-L-guluronic acid (G) residues and occurs in nature as a structural component of © 2012 American Chemical Society

marine brown algae (Phaeophyceae), comprising 40% of the dry matter. It also occurs as capsular polysaccharides in soil bacteria.9 Alginate is considered by the United States Food and Drug Administration as a “generally regarded as safe” or GRAS material and has found applications in various industries, including the food, pharmaceutical, and cosmetic industries.10 Furthermore, the polymer has the ability to form a cross-linked gel-like structure in the presence of multivalent cations such as Ca2+. To form calcium-alginate particles, the cross-linking ions have to be introduced in a very controlled fashion using the diffusion (external gelation) method. In this technique, Ca2+ ions are allowed to diffuse from a large outer reservoir into alginate solution.11 This technique exhibits rapid gelation kinetics and is suitable for immobilization purposes, where each drop of alginate forms a single gel bead with entrapped bioactive agent. The formulation parameters, such as sodium alginate molecular weight and concentration, stirring conditions, and rate of Ca2+ ions addition can be further optimized to form particles in the nanometer range.12 In this study, we have developed tuftsin-modified crosslinked alginate nanoparticles with encapsulated reporter (green fluorescent protein, GFP) and murine interleukin-10 (mIL-10) expressing plasmid DNA. Tuftsin is a tertapeptide made up of 13 L-threonine, L-lysine, L-proline, and L-arginine. The peptide is formed by enzymatic cleavage of the Fc portion of the immunoglobulin (IgG) molecule (residues 289−292).14,15 Tuftsin is known to stimulate the immune function of various cells, including macrophages (primarily), neutrophils, and Received: December 16, 2011 Revised: February 25, 2012 Published: March 2, 2012 1074

dx.doi.org/10.1021/bm2017993 | Biomacromolecules 2012, 13, 1074−1085

Biomacromolecules

Article

Figure 1. (A) Schematic illustration of the tuftsin-peptide modified plasmid DNA containing alginate nanoparticle. (B) Graph of the ζ potential values of tuftsin peptide-modified alginate nanoparticles as a function of increasing nanoparticle concentrations when modified with 1 mg/mL of the peptide in aqueous solution. Transmission electron micrograph depicting the particle morphology and size of the tuftsin-peptide modified nanoparticle (C). of 9 mM calcium chloride solution was added dropwise to the alginate solution using a peristaltic pump while stirring at 800 rpms. After an hour of Ca2+ ion induced cross-linking, the nanoparticles were dialyzed overnight and freeze-dried. Blank nanoparticles were prepared similarly without the addition of any plasmid DNA. As shown in Figure 1a, following the preparation of blank and DNA-encapsulated nanoparticles, the surface of the particles was modified using 1 mg/mL of the peptide sequences with tuftsin and scrambled amino acid residues. The peptides had six positively charged L-arginine (i.e., RRRRRR) residues for anchoring to the negatively charged alginate nanoparticle surface, four L-glycine (i.e., GGGG) spacer residues, and either TKPR residues of tuftsin or PTKR residues of the scrambled sequence. The peptide-functionalized alginate nanoparticles were then purified with a washing step and freeze-dried. Characterization of the Nanoparticle Formulations. Particle Size, Surface Charge, and Morphological Analyses. The particle size and surface charge (ζ potential) of the unmodified and peptide modified alginate nanoparticle were measured using the Malvern Instruments (Westborough, MA) ZS90 Zetasizer Nano in deionized−distilled water at 90° scattering angle and a temperature of 25 °C. For analysis of particle morphology, transmission electron microscopy (TEM) was performed. The freeze-dried nanoparticle sample was placed on Formwarcoated copper grids (Electron Microscopy Science, Hatfield, PA) and negatively stained with 50 μL of 1% (w/v) uranyl acetate. After draining off the excess liquid with a Whatman filter paper, the grid containing the nanoparticle sample was observed with a JEOL 100X transmission electron microscope (Peabody, MA). Determination of the Peptide-Density on the Surface of the Nanoparticles. Peptide conjugated NPs were centrifuged at 13,000 rpms for 30 min, and the supernatant was collected for quantification of the peptide via gradient reverse phase HPLC (Waters Corp., model 2487, Milford, MA). The instrument consisted of two pumps, an autosampler, and a UV-detector used for the analysis. The LC system

monocytes. It has been found to increase the macrophagemediated phagocytosis, macrophage-migration index, splenocytes proliferation, and bactericidal and tumoricidal activities. It has been shown that there are 72,000 binding sites available on the surface of macrophages for this peptide, and the binding equilibrium dissociation constant was found to be 5.3 × 10−8 M.16 Tuftsin has been shown to interact with Fc and neuropilin-1 (NP-1) receptors on macrophages.

■

MATERIALS AND METHODS

Materials. Medium viscosity grade sodium alginate and calcium chloride dihydrate were purchased from Sigma Aldrich (St. Louis, MO) and dissolved in deionized distilled water. The peptide (MW ∼1666 Da) sequences containing tuftsin and scrambled motifs were custom synthesized at the Tufts University’s Peptide Synthesis Core Facility (Boston, MA). Plasmid DNA expressing enhanced green fluorescence protein (i.e., EGFP-N1, 4.7 kb) was purchased from Clontech and amplified and purified by Elim Biopharmaceuticals (Hayward, CA). A disk of lyophilized GT100 E. coli transformed with pORF5-mIL10 plasmid DNA (3.7 kb) encoding the murine cytokine IL-10 (mIL10) was obtained from Invivogen (San Diego, CA). The transformed E. coli were grown in culture, and the plasmid was harvested and purified using a HiSpeed plasmid purification maxi kit supplied by Qiagen (Valencia, CA). Rhodamine-B dextran (mol wt 70 kDa) and the supercoiled DNA ladders (2−16 kb and 100 bp) were all purchased from Invitrogen (Carlsbad, CA). Lastly, the primers specific for IL-10, TNF-α, and β-actin were purchased from Eurofins MWG Operon (Huntsville, AL). Preparation and Surface Modification of DNA-Encapsulated Alginate Nanoparticles. An external gelation method was used to form the optimized blank and DNA-encapsulated calcium alginate nanoparticles. Briefly, 10 mL of sodium-alginate (0.1% w/v) solution was premixed with the plasmid DNA (EGFP-N1 or mIL-10) and 2 mL 1075


Biomacromolecules

Article

was interfaced with the Empower software for instrument control, data acquisition, and processing. The mobile phase consisted of (A) 0.1% trifluoroacetic acid (TFA) in water and (B) 0.1% TFA in acetonitrile. Gradient elution was carried out at a constant rate of 1 mL/min, from 96% A to 65% A (corresponding to 4% B to 35% B) for 15 min. All separations were carried out using Grace/Vydac HPLC protein and a peptide C18 column (particle size 5 μm, 4.6 mm × 250 mm), and tuftsin peptide elution was monitored at the wavelength 220 nm. The peptide density was calculated as follows:

postadministration of the nanoparticle samples, glass coverslips placed in the 6-well microplate were removed and rinsed with sterile PBS and inverted on a clean slide for qualitative analysis of uptake and cellular internalization using fluorescence microscopy. Bright field and fluorescence images were acquired with a BX51-TRF Olympus (Center Valley, PA) inverted microscope at 40× original magnification. Cytotoxicity Analysis Using MTS Reagent. Various amounts ranging from 0.2 mg to 1 mg of unmodified, scrambled peptidemodified, and tuftsin-modified plasmid DNA-encapsulated alginate nanoparticles were incubated with 10,000 J774A.1 macrophages in 96well microplates for cytoxicity analysis in the presence of DMEM supplemented with 10% FBS conditions. The 3-(4,5-dimethylthiazol2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium reagent (MTS; Promega, Madison, WI) that is converted to watersoluble formazan derivative by viable cells was used to assess the cytotoxicity of the formulations. Untreated cells were used as negative control, while poly(ethyleneimine) (PEI; mol wt Ten kDa), a known cytotoxic cationic polymer at a concentration of 1 mg/mL, was used as a positive control. A known amount of nanoparticle sample was suspended in 200 μL of culture media and incubated with the cells for 1 h. Following a washing step with sterile PBS, the wells were treated with MTS reagent and the absorbance of the chromogenic formazan product in viable cells was measured with a 490 nm BioTek Synergy HT microplate reader. The percent cell viability was calculated from the absorbance values relative to those of untreated cells. The samples were tested with n = 8 replicates. Plasmid DNA Transfection Studies. Reporter EGFP Plasmid DNA Transfection Studies. Unmodified, scrambled peptidemodified, and tuftsin-modified alginate nanoparticles with encapsulated plasmid DNA expressing reporter GFP (i.e., EGFP-N1) were added to J774A.1 macrophages in a 6-well microplate, in the presence of DMEM supplemented with 10% FBS, at a dose equivalent to 20 μg of DNA per 200,000 cells. Naked plasmid DNA and DNA-complexed with the cationic lipid transfection reagent Lipofectin (Invitrogen, Carlsbad, CA) were used as controls. Following 1 h of incubation, the wells were rinsed with sterile PBS to remove excess particles, and 2 mL of FBS supplemented DMEM was added. Periodically, starting from 12 to 96 h postadministration, quantitative analysis of transgene expression was carried out with a GFPspecific enzyme-linked immunosorbent assay (ELISA). Transfected cells were harvested and lysed, and the cell extract was used for determination of GFP concentrations relative to the total intracellular protein concentration obtained using a BCA (Thermo Scientific-Pierce, Rockford, IL). A 96-well microplate was coated with 100 μL of anti-GFP mouse monoclonal antibody (Novus Biologicals, Littleton, CO) diluted at a concentration of 1:2,400 and incubated for 2 h at 25 °C. The antibody-coated microplate was then washed 5-times with PBST washing buffer (Sigma-Aldrich, St. Louis, MO) and then blocked with 200 μL of blocking buffer (Thermo ScientificPierce, Rockford, IL) for 2 h at room temperature. The microplate was again washed 5-times, and 100 μL of cell lysate was added and incubated at 4 °C overnight. Following extensive rinsing with the washing buffer, 100 μL of polyclonal secondary antibody conjugated to alkaline phosphatase (Novus Biologicals, Littleton, CO) was added and incubated for 1 h at room temperature. Lastly, 100 μL of the substrate was added to the wells and the chromogen was measured at 409 nm using the microplate reader. A calibration curve was constructed using GFP (BioVision, Mountain View, CA), and the levels of transfected GFP in macrophages were calculated as nanograms per milligram of total cellular protein. Qualitative analysis of GFP expression as a function of time after incubation of J774A.1 macrophages with EGFP-N1 plasmid DNAencapsulated control and tuftsin-modified alginate nanoparticles was determined by fluorescence microscopy. Naked plasmid DNA and DNA-complexed with Lipofectin were used as controls. Following treatment with 20 μg of an equivalent dose of DNA per 200,000 cells

[(peptide amount added to nanoparticles) − (peptide amount recovered in supernatant)]/ (total nanoparticle surface area) The total surface area of the 1 mg of nanoparticles was calculated by multiplying the surface area of each nanoparticle with the number of particles in the sample determined via a ZS90 Zetasizer Nano instrument. The amount of peptide bound to the peptide was reported in micromoles (μmol)/cm2 or number of peptide molecules/cm2. Determination of Plasmid DNA Loading and Stability. The plasmid DNA encapsulation efficiency was measured using a PicoGreen dsDNA fluorescence assay (Invitrogen) following digestion of the polymer matrix with the enzyme alginate lyase for 12 h in phosphate-buffered saline (PBS, pH 7.4) at 37 °C. Following centrifugation at 13,000 rpm for 30 min, the supernatant was collected and the released DNA was quantified using PicoGreen fluorescence reagent with a Bio-Tek Synergy HT (Winooski, VT) microplate reader. The stability of encapsulated plasmid DNA due to processing conditions was assessed using agarose gel electrophoresis. Following extraction of the DNA from the freeze-dried sample of nanoparticles using alginate lyase and precipitation with ethanol, a sample was run on 1.2% precasted ethidium bromide-stained agarose gels (Invitrogen). Control lanes had 2−16 kb DNA ladder and the naked plasmid DNA sample. Additionally, the nanoparticles were also exposed to DNase I prior to treatment with alginate lyase to show that the DNA was physically encapsulated and protected in the nanoparticles and not adsorbed onto the surface. Following the agarose gel electrophoresis, the ethidium bromide labeled DNA bands were visualized with a Kodak FX imager (Carestream, Rochester, NY). Macrophage-Specific Uptake and Cytotoxicity Analyses. Cell Culture Conditions. The J774A.1 adherent murine macrophage cell line was obtained from the American Type Culture Collection (ATCC; Manassas, VA) and grown in a T75 culture flask at 37 °C and 5% CO2 using Dulbecco’s modified Eagle medium (DMEM; Cellgro, Mediatech Inc., Manassas, VA) modified with 10% fetal bovine serum (FBS; Gemini BioProducts, West Sacramento, CA) and combination penicillin/ streptomycin antibiotics. Cells were allowed to divide until they a reached desired density. The cell count was measured by placing 20 μL of the cell suspension mixture on a heamocytometer slide, and the cell viability studies were performed using a Trypan blue dye exclusion assay. Macrophage-Specific Particle Uptake and Cellular Internalization. To evaluate the uptake and cellular internalization of the scrambled peptide-modified (as control) and tuftsin-modified alginate nanoparticles, rhodamine-B dextran was encapsulated at 0.1% (w/w) concentration using a similar procedure as described above for plasmid DNA. Unmodified, scrambled peptide-modified, and tuftsin-modified alginate nanoparticles were incubated with 200,000 J774A.1 macrophages in a 6-well microplate in the presence of DMEM supplemented with 10% FBS. Quantitative analysis of the nanoparticle uptake was also carried out with the unmodified and surface-modified samples by flow cytometry using a BD Biosciences FACS caliber (San Jose, CA) after 1 h of incubation. The FL-2 channel (585/42 emission) was used to detect the cells containing rhodamine-dextran dye containing particles. A total of 10,000 events were counted within a gated region. The results obtained were analyzed using Cell-Quest Pro software. The data was presented as mean fluorescence (FL) intensity. Additionally, at various time intervals ranging from 15 min to 6 h 1076


Biomacromolecules

■

for 1 h in a 6-well microplate, in the presence of DMEM supplemented with 10% FBS, having glass coverslips in each well, the cells were incubated at 37 °C. Before the imaging session, the untreated cells were observed under the microscope and the exposure time was set to eliminate the effect of autofluorescence. At this exposure time, the field of view of untreated cells appeared dark/black as the autofluorescence was completely negated. The GFP fluorescence images were then recorded at this exposure time in both control and macrophage targeted nanoparticle treatment groups. At predetermined time intervals from 12 to 96 h post-treatment, the coverslips were removed, rinsed with sterile PBS, and placed on a glass slide. GFP expression in the cells was visualized by fluorescence microscopy using an inverted Olympus microscope. mIL-10 Plasmid DNA Transfection Studies. mIL-10 expressing plasmid DNA (i.e., pORF-mIL-10) cloned in transformed E. coli was harvested and purified using a Qiagen HiSpeed plasmid purification maxi kit. The plasmid was further precipitated and extracted in the presence of isopropanol and 70% ethanol (v/v) to get rid of the contaminants. Following confirmation of the plasmid purity by measuring the absorbance ratio at 260/280 nm and agarose gel electrophoresis, it was encapsulated in control and tuftsin-modified alginate nanoparticles. In 6-well microplates, 200,000 J774A.1 macrophage cells were treated with 20 μg of an equivalent DNA dose in different formulations in the presence of DMEM supplemented with 10% FBS. Naked plasmid and Lipofectincomplexed DNA were used as controls. For evaluation of the mIL-10 mRNA levels following transfection with the plasmid DNA, RT-PCR studies were performed. Total RNA was isolated from the cell lysates with a High Pure RNA Isolation Kit from Roche Applied Sc. (Indianapolis, IN). The reagents for the first cDNA strand synthesis and DNA amplification were all purchased from Invitrogen. β-Actin was used as the internal control in the PCR experiments. The primer sequences for mIL-10 and β-actin were as follows: Murine IL-10 Forward: CCAAGCCTTATCGGAAATGA Murine IL-10 Reverse: TCTCACCCAGGGAATTCAAA Murine β −Actin Forward: GTTACCAACTGGGACGACA Murine β −Actin Reverse: TGGCCATCTCCTGCTCGAA The PCR was performed with the cDNA and primers. The samples were heated at 94 °C for 5 min and 35 cycles of 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 30 s. The gels were visualized using a Kodak FX imager. Additionally, mIL-10 transgene expression was also evaluated at the protein level using an ELISA. Since transfected mIL-10 is a secreted protein, at predetermined time points from 12 to 96 h postadministration, the cell suspensions were collected and centrifuged at 2000 rpm for 5 min. For quantitative evaluation of mIL-10 expression, the supernatant was used for an ELISA. The IL-10 specific Quantikine ELISA kit was purchased from R&D Systems (Minneapolis, MN). The results are expressed as picograms of mIL-10 per milliliter of cell culture supernatant. In Vitro Anti-Inflammatory Effects of Transfected mIL-10. To assess that the expressed mIL-10 has a potential anti-inflammatory therapeutic effect, the levels of pro-inflammatory cytokines tumor necrosis factor alpha (TNF-α) was measured at the mRNA and protein levels in lipopolysaccharide- (LPS; Sigma Aldrich) stimulated J774A.1 macrophages. In a 6-well microplate, 200,000 cells were treated with 100 ng/mL LPS for 6, 12, and 24 h to determine the effect of time on baseline expression of TNF-α. The cells were transfected with mIL-10 expressing plasmid DNA as described above. Lastly, the transfected cells were then treated with 100 ng/mL LPS and the level of TNF-α was measured periodically at the mRNA level by RT-PCR and at the protein level with a cytokine-specific Quantikine ELISA kit (R&D Systems). For PCR analysis, the primer sequences for TNF-α were as follows: Murine TNF-α Forward: CATGAGCACAGAAAGCATGATC Murine TNF-α Reverse: CCTTCTCCAGCTGGAAGACT Statistical Analysis. The statistical significance of the results was determined using one-way ANOVA and Tukey’s Multiple Comparison Test with a 95% confidence interval (p < 0.05).

Article

RESULTS Preparation and Characterization of DNA-Encapsulated Control and Peptide-Modified Alginate Nanoparticles. Figure 1b shows the graph of the surface charge (ζ potential) values of optimized tuftsin peptide-modified alginate nanoparticles as a function of increasing nanoparticle concentrations when modified with 1 mg/mL of the peptide in aqueous solution. When the concentration of nanoparticles increased, the ζ potential values became increasingly negative as the peptide surface coverage decreased. Additionally, at higher nanoparticle concentrations, there was significant aggregation and precipitation, probably due to particle bridging effects of the peptide. On the basis of these results, the nanoparticles were modified with 1 mg/mL of peptide for 1 mg/mL of the nanoparticles, which corresponded with positive ζ potential values, using both tuftsin as well as the scrambled peptide construct. Lastly, TEM analysis was carried out to evaluate the morphology of control and peptide-modified alginate nanoparticles. Figure 1c shows the TEM image of the tuftsinmodified alginate nanoparticles, which shows smooth and spherical nanoparticles of approximately 200 nm in diameter. Following surface modification of EGFP-N1 plasmid DNAencapsulated alginate nanoparticles with the scrambled peptide and the tuftsin constructs, the hydrodynamic diameter and the surface charge values were measured. Table 1 shows that Table 1. Particle Characterization of the Blank and EGFPN1 Plasmid DNA-Encapsulated Peptide-Modified Alginate Nanoparticles nanoparticle formulation

hydrodynamic diameter (nm)

polydispersity index (PDI)

ζ potential (mV)

blank nanoparticles DNA encapsulated unmodified nanoparticles DNA encapsulated nanoparticles modified with scrambled peptide DNA encapsulated nanoparticles modified with tuftsin

427.2 ± 27.7a 422.1 ± 28.9

0.66 ± 0.08 0.67 ± 0.04

−47.0 ± 1.01 −45.8 ± 3.26

293.3 ± 2.07

0.31 ± 0.03

23.6 ± 0.95

286.6 ± 1.36

0.26 ± 0.01

19.7 ± 0.40

a

Mean ± SD (n = 3).

unmodified nanoparticles had an average diameter of approximately 427 nm, while surface modification with either scrambled peptide or tuftsin decreased the diameter to around 280−290 nm. The relatively higher polydispersity index observed in the case of the blank (0.66 ± 0.08) and unmodified nanoparticles (0.67 ± 0.01) may have been due to more aggregated nanoparticles relative to more uniformly dispersed peptide-modified alginate nanoparticles (0.26 ± 0.01). The average ζ potential of DNA-encapsulated unmodified alginate nanoparticles was −45.8 mV, similar to the values observed for blank unmodified nanoparticles. These results confirm that the plasmid DNA was physically encapsulated in the alginate matrix and not adsorbed to the surface. When the alginate nanoparticle surface was modified with either scrambled peptide or tuftsin constructs, the average ζ potential values changed to 23.6 and 19.7 mV, respectively, due to the neutralization of the surface negative charge with excess of the positively charged Larginine residues that anchored the peptides on the alginate surface. In addition, the peptide density on the surface of 1 mg of nanoparticles was calculated to be 116.7 ± 1.01 μmol/cm2 or 1077


Biomacromolecules

Article

Figure 2. Stability of the encapsulated plasmid DNA in the nanoparticles upon modification with the tuftsin and scrambled peptides (1 mg/mL). Lane 1 is a 2−16 kb supercoiled double stranded DNA ladder. Lanes 2 and 3 show a single band at 4.7 kb corresponding to supercoiled plasmid DNA extracted from tuftsin- and scrambled peptide-modified alginate nanoparticles, respectively. Lanes 4 and 5 represent the intact tuftsin- and scrambled peptide-modified alginate nanoparticles, respectively, were first treated with DNase-I, followed by extraction of the plasmid DNA using alginate lyase.

Figure 3. Cellular uptake of the rhodamine-B dextran containing calcium alginate nanoparticle in J774A.1 macrophages. Shows the flow cytometry results of nanoparticle uptake in cells after 1 h of incubation. The FL-2 channel (585/42 emission) was used to detect the cells containing rhodamine-dextran dye containing particles (A). Flow cytometry data for the 1-h time point is presented as mean fluorescence intensity (B). Fluorescence microscopy images showing the time dependent uptake of the rhodamine-B dextran dye containing different versions of nanoparticles (C). The microscopy studies were conducted at 15 min, 30 min, 1 h, 2 h, 3 h, and 6 h post particle administration. The images were taken at 40× original magnification.

702.6 ± 6.08 molecules of peptide/cm2. The optimized plasmid DNA loading efficiency in cross-linked alginate nanoparticles before and after surface modification with scrambled peptide and tuftsin was found to be around 60% at 0.78% (w/w) DNA loading with both EGFP-N1 and pORF-mIL-10 plasmids. Figure 2 shows the stability of encapsulated plasmid DNA due to processing conditions as well as upon exposure to DNase-I using agarose gel electrophoresis. Lane 1 is a 2−16 kb

supercoiled double stranded DNA ladder, while lanes 3−5 have EGFP-N1 plasmid DNA extracted from the scrambled peptideor tuftsin-modified alginate nanoparticles following treatment with alginate lyase. Lanes 2 and 3 show a single band at 4.7 kb corresponding to supercoiled plasmid DNA extracted from tuftsin- and scrambled peptide-modified alginate nanoparticles, respectively. For lanes 4 and 5, the intact tuftsin- and scrambled peptide-modified alginate nanoparticles, respectively, were first 1078


Biomacromolecules

Article

treated with DNase-I, followed by extraction of the plasmid DNA using alginate lyase. The result in lanes 4 and 5 also show that the alginate nanoparticle encapsulated DNA is protected from enzymatic degradation by DNase-I. Evaluations of Nanoparticle Uptake and Cytotoxicity in Macrophages. The quantitative and qualitative analyses of rhodamine dextran-encapsulated unmodified, scrambled peptide-modified, and tuftsin-modified alginate nanoparticles were evaluated using flow cytometry and fluorescence microscopy, respectively. Figure 3a shows the flow cytometry results of nanoparticle uptake in J774A.1 murine macrophages after a 1-h incubation. The unmodified and scrambled peptide-modified nanoparticles did not show a significant difference in nanoparticle uptake. However, the tuftsin-modified nanoparticle treatment group was fluorescing with a significantly higher intensity. The results shown in Figure 3b represent a mean fluorescence (FL) intensity that was recorded in the cell population treated with tuftsin-modified nanoparticles (255.73 FL units), whereas the unmodified (34.7 FL units) and scrambled peptide-modified (22.67 FL units) nanoparticle treated cells showed significantly less fluorescence signal after 1 h of incubation. The fluorescence microscopy images in Figure 3c further confirmed the nanoparticle internalization results of flow cytometry. Even after 15 and 30 min of incubation, there was a significant intracellular accumulation of the rhodamine dextran-encapsulated alginate nanoparticles that were modified with tuftsin as compared to unmodified and scrambled peptidemodified nanoparticles. Specific interactions of tuftsin construct with the cell surface receptors and subsequent receptormediated phagocytosis were probably responsible for the rapid intracellular uptake. After 1 to 3 h of incubation, even the scrambled peptide-modified nanoparticles showed significant accumulation in macrophages probably to the cationic surface charge that is known to facilitate nonspecific endocytosis. Lastly, at 6 h after nanoparticle incubation, the intracellular uptake was almost the same for the three different formulations tested. This is due to the fact that, at longer time points, the endocytosis process saturated and reaches a maximum regardless of the presence of ligands that specifically interact with cell surface receptors. However, these results clearly show that tuftsin-modified alginate nanoparticles were more efficiently internalized in macrophages at earlier time points, which would be essential when administering the formulation in vivo in the future. To assess potential cytotoxicity, if any, with the control and surface-modified EGFP-N1 plasmid DNA-encapsulated alginate nanoparticles, the formulations were incubated at different amounts with J774A.1 macrophages. In viable cells, the enzymes convert the yellow MTS reagent, in the presence of phenazine methosulfate, to a purple-colored formazan product that has an absorbance maximum at 490 nm. The cell viability results, as shown in Figure 4, confirm that neither the blank, unmodified, and scrambled peptide-modified nor the tuftsinmodified alginate nanoparticle formulations induced any significant cytotoxicity when added to cells at 0.2 and 0.5 mg amounts per 200,000 cells. There was a significant decrease in cell viability to 60% with scrambled peptide-modified nanoparticles at 1 mg amount, indicating that higher concentration of the positive charge, imparted due to the scrambled peptide, is causing rupture of the cell membrane and, hence, the decrease in percent cell viability. However, this effect was not observed with tuftsin-modified nanoparticles even at 1 mg levels, where the cell viability was around 90%. The difference

Figure 4. Cytotoxicity of the different versions of the calcium alginate nanoparticles in J774A.1 macrophages evaluated with the MTS (formazan) assay. The toxicity of the plasmid DNA loaded formulation in macrophages was compared to that of untreated cells, poly(ethyleneimine) (PEI, used as a positive control), and blank NP (0.5 and 1 mg), Unmodified NP (0.2, 0.5, and 1 mg), Scrambled peptide NP (0.2, 0.5, and 1 mg), and tuftsin-modified NP (0.2, 0.5, and 1 mg). The cell viability of the control/untreated cells was considered to be 100%, and the values obtained in the rest of the treatment groups were normalized to control values and presented in percentage form. The values reported are mean ± SD (n = 8).

in the cytotoxicity profile of the tuftsin and scrambled peptidemodified nanoparticles can be attributed to the uptake kinetics and mechanism of internalization of the two different versions of the nanoparticles. The tuftsin-modified nanoparticles are phagocytosed via receptor-mediated endocytosis, whereas scrambled peptide nanoparticles may solely interact with negative charged cell membrane by electrostatic interactions and, hence, may cause some additional cytotoxicity. Quantitative and Qualitative Transfection Analyses with EGFP-N1 Plasmid DNA. A GFP-specific ELISA was used for quantitative determination of the transgene expression in J774A.1 macrophages upon treatment with control and surface-modified nanoparticles. The results in Figure 5a show the intracellular GFP per total protein concentrations as a function of time, with the various formulations tested starting from 12 to 96 h postadministration. Although DNA encapsulated in unmodified nanoparticles and scrambled peptide-modified nanoparticles did show a transient expression for up to 72 h, the levels were significantly lower than those shown with tuftsin-modified nanoparticles. The maximum GFP concentration of 0.54 ng/mg of intracellular protein was observed after 48 h of transfection with tuftsin-modified nanoparticles. Naked plasmid and Lipofectin-complexed DNA did show initial transgene expression for up to 24 h; however, the levels were significantly lower than those observed with any of the alginate formulations tested. Figure 5b shows the qualitative GFP expression analysis using fluorescence microscopy images of J774A.1 macrophages transfected with EGFP-N1 plasmid DNA in the control and surface-modified alginate nanoparticle formulations. Starting from 12 h postadministration, there was a significant GFP expression observed with tuftsin-modified alginate nanoparticles that increased in intensity at 48 h and then decreased after 96 h. The qualitative results observed with tuftsinmodified nanoparticles corroborated with the quantitative data determined using ELISA in Figure 5a. 1079


Biomacromolecules

Article

Figure 5. Quantitative and qualitative evaluation of GFP expression evaluated by GFP-ELISA and fluorescence microscopy in the J774A.1 macrophage cell line, respectively. Time-dependent (12, 24, 48, 72, and 96 h) ELISA results showing GFP expression upon administration of EGFPN1 plasmid DNA in control and tuftsin-modified alginate nanoparticles. The amount of GFP is expressed in nanograms per mg of total cell protein. The amount of total protein was calculated using the BCA assay. The values reported are mean ± SD (n = 3) (A). The statistical significance of the results was determined using one-way ANOVA and Tukey’s Multiple Comparison test with a 95% confidence interval (p < 0.05). Panel B shows the fluorescence microscopy images representing the GFP-expression in macrophage cells at the 12, 48, and 96 h time points. The cells were treated with blank nanoparticles (A), with naked EGFP-N1 plasmid DNA (B), with EGFP-NI plasmid DNA encapsulated in the unmodified nanoparticle (C), with EGFP-N1 plasmid DNA complexed with Lipofectin (D), with scrambled sequence modified alginate nanoparticles (E), or with tuftsin peptide modified nanoparticles (F). All of the images were acquired at the 40× original magnification.

mIL-10 Transfection Analyses by PCR and ELISA. Following confirmation of GFP transfection with control and tuftsin-modified alginate nanoparticles, mIL-10 expressing plasmid DNA (i.e., pORF-mIL-10) was encapsulated in the same formulations and the transgene expression was evaluated at the transcriptional and translational levels. Figure 6a shows the results of the PCR, which confirmed the presence of mIL10 transcript from cells transfected with Lipofectin-complexed DNA and DNA-encapsulated in both scrambled peptide- and tuftsin-modified nanoparticles. The samples were tested for the presence of mIL-10 transcript at 12, 24, and 72 h postadministration, and β-actin was used an internal control in these experiments. The PCR products for the mIL-10 and βactin were reported to be 100 bp and 459 bp, respectively. In the case of tuftsin-modified nanoparticles, the presence of mIL10 transcript was observed for up to 72 h. However, in the case

of Lipofectin and scrambled peptide-modified nanoparticle formulations, the transcript was only detected at the 12 and 24 h time points. IL-10 specific ELISA was used to determined the quantitative mIL-10 transfection at the protein level, and the results are shown in Figure 6b. Since mIL-10 is a secreted protein, the levels were measured in the cell culture supernatant and reported as pg/mL. The levels of mIL-10 protein observed with tuftsin-modified alginate nanoparticles were significantly higher than those of the other controls across all the time points (p < 0.0001). For example, after 12 h of transfection, the highest mIL-10 level of 404.7 pg/mL was measured with tuftsinmodified nanoparticles. In contrast, all of the other formulations resulted in levels of less than 240 pg/mL at 12 h. Additionally, at 72 and 96 h post administration, the mIL-10 levels were 350 pg/mL and 270 pg/mL, respectively, when 1080


Biomacromolecules

Article

Figure 6. Evaluation of murine IL-10 (mIL-10) cytokine expression by RT-PCR (qualitative) and IL-10 specific ELISA (quantitative) in J774A.1 macrophages. The presence of the mIL-10 mRNA transcript upon transfection with Lipofectin, scrambled-peptide modified NP, and tuftsin-peptide modified NP was determined at various time points (12, 24, and 72 h), post particle administration. β-Actin was used as an internal control for these experiments. The PCR products of mIL-10 and β-actin are 100bp and 459 bp, respectively (A). Time-dependent (12, 24, 48, 72, and 96 h) ELISA analysis of mIL-10 expression in macrophages upon administration of murine IL-10 plasmid in control and tuftsin-modified alginate nanoparticles (B). The values reported are mean ± SD (n = 4). The statistical significance of the results was determined using one-way ANOVA and Tukey’s Multiple Comparison Test with a 95% confidence interval (p < 0.05).

transfected with tuftsin-modified alginate nanoparticles, while the other formulations resulted in levels of less than 50 pg/mL at both of these time points. In Vitro Anti-inflammatory Effects of mIL-10 Transfection. The potential anti-inflammatory effect of transfected mIL-10 in J774A.1 macrophages was evaluated by measuring the levels of TNF-α, a pro-inflammatory cytokine, expressed in macrophages following stimulation with LPS. First, in order to determine the optimum time for mIL-10 induced TNF-α signal down-regulation, the level of TNF-α, mRNA was measured at 6, 12, and 24 h post-LPS stimulation. The PCR results in Figure 7a show the maximum TNF-α mRNA signal at 6 h (i.e., 95% TNF-α to β-actin relative band intensities ratio) post stimulation. The levels decreased significantly to 30% and 10% TNF-α to β-actin relative band intensities ratio at 12 and 24 h post-LPS stimulation, respectively. On the basis of these results, the 6-h time point was used for evaluation of TNF-α down-regulation in mIL-10 expressing cells. Figure 7b shows the PCR results of TNF-α transcript levels in macrophages after transfection with mIL-10 expressing plasmid DNA after 12, 24, and 72 h postadministration of the control and surface-modified alginate nanoparticle formula-

tions. In these studies, 6 h prior to the time for evaluation of mIL-10 transgene expression, the J774A.1 macrophage cells were stimulated with LPS. The mTNF-α product was run on agarose gel electrophoresis, and β-actin was used as the internal control. The PCR results showed that there was significantly lower TNF-α transcript in LPS stimulated cells that were transfected with mIL-10 expressing plasmid DNA in tuftsinmodified alginate nanoparticles at 12, 24, and 72 h time points. A slight decrease in TNF-α transcript was also detected in the cells treated with DNA-encapsulated unmodified and scrambled peptide-modified alginate nanoparticles at 12 and 24 h relative to LPS stimulated cells that were not transfected with mIL-10 plasmid DNA. The PCR results obtained in Figure 7b were further corroborated with TNF-α specific ELISA to show the decrease in the expression of the pro-inflammatory cytokine upon mIL10 transgene expression in LPS-stimulated J774A.1 macrophages. The same experimental conditions were used for the ELISA analysis as before. The ELISA results, as shown in Figure 8, express the percent of TNF-α expression relative to baseline in LPS-stimulated, but untreated cells. Similar to the PCR results shown in Figure 7b, the ELISA results also showed 1081


Biomacromolecules

Article

Figure 7. Time-dependent assessment of TNF-α cytokine expression upon LPS stimulation in nontransfected and IL-10 transfected J774A.1 macrophages. The left top panel shows the profile of the TNF-α expression in macrophages at 6, 12, and 24 h post stimulation with 100 ng/mL of LPS. The results were evaluated via RT-PCR. β-Actin served as an internal control. The PCR products of mTNF-α and β-actin are 620 bp and 459 bp, respectively. The left bottom panel shows the ratio of TNF-α to β-actin band intensity at the corresponding time points (A). The right top panel shows the RT-PCR results of TNF-α mRNA transcript obtained upon treatment with IL-10 plasmid DNA-encapsulated nanoparticle at different transfection time points (12, 24, and 72 h). mTNF-α and β-actin bands are represented in a sequential manner (top to bottom). Lanes 1 and 9 represent the 100 bp DNA ladder, lane 2 represents the untreated cells stimulated with LPS, lane 3 represents the LPS stimulated cells treated with blank NP, lane 4 represents LPS stimulated cells treated with naked plasmid, lane 5 represents the LPS stimulated cells treated with unmodified NP, lane 6 represents LPS stimulated cells treated with Lipofectin, lane 7 represents LPS stimulated cells treated tuftsin peptide-modified NP, and lane 8 represents LPS stimulated cells treated with scrambled peptide-modified NP. The bottom panel represents a plot of the ratio of the TNF-α to β-actin band intensity at the corresponding time points (B).

the formulations, the average TNF-α expression was only 4.7% in LPS-stimulated cells transfected with tuftsin-modified nanoparticles. In contrast, the TNF-α expression was 67.5% and 74.8% in cells transfected with DNA administered as Lipofectin complexes or when encapsulated in scrambled peptide-modified alginate nanoparticles. Similarly, for the 24 h time point, the average TNF-α levels with tuftsin-modified nanoparticles were significantly lower (i.e., 40.9%) than with Lipofectin (i.e., 109.5%; p < 0.0001) and scrambled peptidemodified nanoparticles (i.e., 87.4%; p < 0.001). Lastly, at the 72 h time point, the same trend was seen with the average TNF-α level of 31.6% when mIL-10 expressing plasmid DNA was transfected with tuftsin-modified nanoparticles, 94.7% with Lipofectin, and 96.7% with scrambled peptide-modified nanoparticles. Overall, the PCR and ELISA results clearly show the significant potential of mIL-10 transfection with tuftsinmodified alginate nanoparticles in down-regulation of proinflammatory cytokine TNF-α expression upon LPS-stimulation of macrophages.

Figure 8. TNF-α specific ELISA showing time-dependent mTNF-α cytokine expression in the J774A.1 macrophage cell line upon administration of murine IL-10 plasmid in control and tuftsinmodified alginate nanoparticles. Data was plotted by considering the TNF- α expression as 100% in untreated cells that were not given any treatment but were stimulated with LPS (100 ng/mL) for 6 h. The values reported are mean ± SD (n = 3). The statistical significance of the results was determined using one-way ANOVA and Tukey’s Multiple Comparison Test with a 95% confidence interval (p < 0.05).

■

DISCUSSION Macrophages are important cells in the regulation of immune responses associated with inflammation, infections, cancer, and many other acute and chronic diseases.17,18 With regard to targeting these cells, numerous strategies have focused on either active or passive modes of nanoparticle based targeting agents. To target these cells, researchers have looked into exploiting various receptors on the surface of macrophages, such as

that there was significant decrease in TNF-α protein expression in LPS-stimulated macrophages upon transfection with mIL-10 expressing plasmid DNA using tuftsin-modified alginate nanoparticles. For example, after 12 h postadministration of 1082


Biomacromolecules

Article

mannose, scavenger, dectin-1, Fc, CD44, and tuftsin.19,20 This approach can be considered as one of the ways to overcome the existing problem of poor or low transfection efficiency associated with nonviral vectors. A literature review also suggests that macrophage targeted systems have a lot of potential from the perspective of gene therapy, which encompasses novel therapeutic areas of research such as DNA vaccination, siRNA, and therapeutic plasmid DNA delivery. For example, Fernandes et al. studied the boneprotective effects of nonviral gene therapy using macrophage targeted nanoparticle containing the interleukin-1 receptor antagonist (IL-1Ra) gene encoding plasmid DNA in rats with adjuvant-induced arthritis.21 The group took advantage of highly expressed folate receptors (FR- β) on the surface of synovial macrophages to design a chitosan based macrophage targeted system for the delivery of IL-1Ra. The nanoparticles were reported to be ∼200 nm in size. The in vitro and in vivo studies clearly showed that the levels of IL-1Ra transgene expression recorded in the case of the folate-targeted chitosan particles were sufficient enough to down-regulate the expression of pro-inflammatory cytokines such as TNF-α and IL-1β. Also, serum levels of biomarkers for bone metabolism (Alkaline phosphatase (ALP), Osteocalcin (OC)) and bone resorption (Tartrate-resistant acid phosphatase (TRAP)) were also significantly lower as compared to those of other controls. In summary, the authors indicated that nonviral gene therapy with folate-chitosan-DNA nanoparticles containing the IL-1Ra gene seemed to protect against the bone damage and inflammation in the rat adjuvant-arthritis model. Similarly, Wijagkanalan et al. investigated the effect of the alveolar macrophage-targeted NF-kB decoy by mannosylated (Man) cationic liposomes in a LPS-induced lung inflammation model, upon intratracheal administration.22 In vitro cell uptake studies conducted in alveolar macrophages showed that Man-liposomes (uptake ratio 4.0) were highly selective toward these cells as compared to the naked NF-kB decoy (uptake ratio 3.0) (p < 0.01) and its complex with cationic liposome (uptake ratio 2.3) (p < 0.01). The results of the in vivo studies also confirmed that Man-cationic liposomes were superior in their ability to inhibit TNF-α, IL-1β, and CINC-1 in BAL fluid as well as in the lung tissue (p < 0.05) as compared to that of LPS, naked NF-kB decoy, unmodified cationic liposome/NF-kB decoy complex, and mannosylated cationic liposomes containing the scrambled decoy complex. A similar trend was reported for the neutrophilic MPO enzyme activity levels. Lastly, the EMSA analysis revealed stronger inhibition of the activated NFkB in lung tissue after treatment with mannosylated liposomes/ NF-kB decoy complex as opposed to other controls. No inhibitory effects were reported with mannosylated cationic liposomes containing the scrambled decoy complex. Overall, this study indicated that active targeting to the macrophage population can be achieved by incorporating mannose sugar residues into the formulation. Other studies have also exploited nanoparticle delivery platforms to target macrophages from the perspective of DNA vaccination. Overall, these studies have shown that nonviral gene delivery platforms can be successfully targeted toward macrophages and have shown a lot of promise from the perspective of gene therapy. In this study, we have examined the role of macrophagespecific gene delivery and transfection with reporter (GFP expressing) and therapeutically relevant (mIL-10 expressing) plasmid DNA using tuftsin-modified alginate nanoparticles. The motivation behind using this system for systemic gene

therapy stems from the safety profile and the noncondensing nature of the anionic alginate matrix. Furthermore, the ability of the nanoparticle system to effectively encapsulate and protect the plasmid DNA makes it very attractive in comparison to some other systems that form either poly- or lipo-plexes with the plasmid DNA system. Therefore, problems of overt toxicity and release of the DNA from such vectors are a limiting factor. Surface modification with tuftsin was investigated on the basis of the fact that this tetrapeptide has been used for macrophagespecific targeted delivery.23,24 For example, a recent study published by Dutta et al.25 has shown the efficacy of tuftsinconjugated efavirenz encapsulated poly(propyleneimine) (PPI) dendrimer in targeting HIV-infected macrophages in an in vitro setting. The group mentioned that cellular uptake of the peptide-modified PPI dendrimers was 34.5 times higher than that of the free drug in the first 1 h of incubation with the cells. Subsequently, the viral load was reported to decrease by 99% at a concentration of 0.625 ng/mL. The authors attributed these results to the enhanced cell uptake, reduced toxicity, and inherent anti-HIV activity of the macrophage targeted efavirenz dendrimer construct. In the future, we are furthering these studies with in vivo evaluation of macrophage-specific delivery of plasmid DNA expressing anti-inflammatory proteins such as mIL-10. These studies will be carried out with both nontargeted and tuftsintargeted alginate nanoparticles following intravenous and intraperitoneal administration in rodent disease models. We anticipate that the nontargeted nanoparticles will be rapidly cleared from the systemic circulation by the reticulo-endothelial system (RES) and lead to predominant liver and spleen uptake. The macrophage-targeted nanoparticles are expected to accumulate at the inflamed sites in the body due to inherent tropism of macrophages. Using medium viscosity grade sodium alginate, we were able to optimize formulation and surface modification of DNAencapsulated nanoparticles to reproducibly obtain particles of around 280−300 nm in diameter. Using a peptide construct that had 6 R residues for anchoring to the negatively charged alginate surface, 4 G residues as spacer, and either tuftsin or scrambled peptide motifs, the nanoparticle surfaces were modified for active targeted delivery to macrophages. Surface modification with the peptide sequences was confirmed when the surface charge on the nanoparticles changed from a net negative value to a positive value of around 20 mV with peptide modification (Figure 1b). In addition, a relatively low polydispersity index, as compared to that for unmodified nanoparticles, was achieved upon tuftsin or scrambled peptide modification, suggesting that peptide binding to the particle surface also tends to reduce the particle−particle aggregation. The high plasmid DNA encapsulation efficiency was optimized to around 60% for the unmodified and peptide-modified formulations, and the stability of supercoiled plasmid was confirmed due to processing conditions and upon exposure to DNase-1 (Figure 2). Macrophage-specific uptake of unmodified, scrambled peptide-modified, and tuftsin-modified alginate nanoparticles with encapsulated rhodamine dextran was evaluated as a function of time by flow cytometry and fluorescence microscopy in J774A.1 adherent cells. Tuftsin-modified alginate nanoparticles were rapidly internalized within the first 15 min of exposure. In contrast, unmodified and scrambled peptide modified nanoparticles were internalized over a longer time frame of about 1 h and beyond (Figure 3). On the basis of the 1083


Biomacromolecules

Article

staining images, as the effect of GFP expression was curtailed due to the nuclear stain and that is why it was decided to present GFP fluorescence images only, without the counter stain. Lastly, as part of our experimental plan for GFP studies, we also contemplated the prospect of using FACS analysis to calculate % GFP transfected cells; however, the issue of autofluorescence in FACS was our major concern. Therefore, it was decided to perform GFP-ELISA (specific anti-GFP antibody based test) instead and ultimately demonstrate the anti-inflammatory effect of the IL-10 transgene expression in the macrophage cell line. Once the GFP transfection was confirmed, we evaluated the delivery and transfection of a therapeutically relevant mIL-10 expressing plasmid DNA with the control and peptide-modified alginate nanoparticles in J774A.1 macrophages. PCR analysis at 12, 24, and 72 h postadministration showed an increase in mIL10 transcript with the tuftsin-modified nanoparticles relative to Lipofectin or scrambled peptide-modified nanoparticles. Furthermore, the mIL-10 expression was also quantified at the protein level using an ELISA. The results showed the highest protein expression with tuftsin-modified alginate nanoparticles from 12 to 96 h postadministration of the formulations. In comparison, the levels detected upon treatment with Lipofectin and scrambled modified nanoparticles were significantly lower (p < 0.0001) at all the time points. However, compared to the 12-h time point, a significant decrease in the IL-10 cytokine expression was observed in the cells treated with tuftsin-modified nanoparticles at 24 and 48 h, post particle administration. The decrease in the protein expression could be attributed to the release of the plasmid DNA from the nanoparticles. To validate this hypothesis and understand the kinetics of the plasmid DNA release from the particles upon phagocytosis, we will be conducting further in vitro particle-trafficking studies with confocal microscopy. Lastly, to show that the expressed mIL-10 in J774A.1 macrophages had the functional anti-inflammatory effect, we have examined down-regulation of pro-inflammatory cytokine TNF-α upon stimulation of the cells with 100 ng/mL LPS per 200,000 cells. LPS is a component of the gram-negative bacteria cell-wall and is known to bind to the toll-like receptors (TLR4) on the surface of macrophages, leading to production of proinflammatory cytokine response, including TNF-α.31 First, the expression of TNF-α transcript was examined after LPS stimulation of cells at 6, 12, and 24 h. The maximum TNF-α mRNA levels were observed after 6 h following LPS stimulation. Subsequently, the cells were first transfected with mIL-10 expressing plasmid DNA using the control and tuftsinmodified alginate nanoparticles and the levels of TNF-α signal were measured at different time points ranging from 12 to 72 h postadministration. The TNF-α protein expression profile also showed a significant decrease in the levels of this proinflammatory cytokine at all the time points following transfection of the cells with mIL-10 expressing plasmid using tuftsin-modified alginate nanoparticles (Figure 8). Additionally, for future in vivo studies, we will also include blank Ca2+ ion cross-linked alginate nanoparticles modified with tuftsin peptide as a control group to evaluate any anti-inflammatory response of macrophages upon delivering tuftsin alone. Literature review suggests that CpG motifs of the plasmid DNA sequence can also cause immunostimulation and can potentially lead to macrophage apoptosis.32 However, as evident from Figure 7b, the β-actin band intensity in control groups such as naked plasmid DNA alone was similar to that of

rapid cellular internalization, we believe that tuftsin-modified alginate nanoparticles were internalized by receptor-mediated phagocytosis and the peptide was indeed attached to the particles at the time of the particle uptake. At longer time points, however, the unmodified and scrambled peptidemodified nanoparticles were also internalized to the same extent by nonspecific uptake. Cytotoxicity analysis showed that the control and peptide-modified nanoparticles did not induce overt toxicity to the cells at doses that were subsequently used for DNA delivery and transfection (Figure 4). Also, particle uptake studies in the cells pretreated with tuftsin peptide alone were not conducted, as the amount of peptide on the nanoparticle surface cannot be accurately determined and will not be the same as the amount required to block the tuftsin receptors. Therefore, to circumvent this issue, scrambled peptide was used as a control to demonstrate the targeting effect of the tuftsin modified nanoparticles toward macrophages. Initial evaluations of DNA delivery and transfection with control and surface-modified alginate nanoparticles were performed with EGFP-N1 plasmid. The quantitative GFP expression by ELISA and qualitative analysis by fluorescence microscopy showed that the tuftsin-modified alginate nanoparticles were most effective as gene delivery vectors in J774A.1 macrophages (Figure 5). Although nonviral vectors have a relatively high margin of safety, the transfection efficiency is severely compromised due to extracellular and intracellular barriers. For cell-based transfection studies, the nucleic acid construct could remain trapped in the phagosomal compartment and/or either fuse with the lysosome for degradation of the content or be excreted from the cell by exocytosis. When trapped in the phago/lysosomal compartment, the encapsulated DNA would be highly susceptible to premature degradation. Additionally, for cationic nonviral gene delivery vectors, such as Lipofectin and PEI, that form electrostatic complexes with the negatively charged DNA, the construct can be highly cytotoxic to the cells or prevent release of the DNA for nuclear entry.26,27 In the case of tuftsin-modified alginate nanoparticles, the combination of active targeted delivery and a noncondensing calcium alginate matrix that maintains the stability of the payload in the phago/lysosomal compartments and the supercoiled structure of the released plasmid in the cell allows for efficient nuclear uptake and transfection. Although the exact mechanism of calcium alginate matrices in promoting phago/lysosomal escape has not been well examined, the report from You et al.28 suggests that the Ca2+ ions used for crosslinking alginate may be sequestered by intracellular phosphate and citrate ions, leading to an increase in the osmotic pressure, which will facilitate swelling and rupture of the phago/ lysosomes. To further investigate this phenomenon, we are in the process of conducting particle trafficking studies where we will be labeling the polymer, plasmid DNA, and cell nucleus to study how particles escape endosomes and DNA is released from the nanoparticles and makes its way into the nucleus of the cell for effective transfection. Previous studies from our lab have shown that noncondensing type B gelatin-based nanoparticulate delivery systems provided sustained levels of reporter and therapeutically relevant transgene expression for both systemic and oral gene therapy.29,30 Trafficking studies with gelatin nanoparticles showed that they could efficiently deliver supercoiled plasmid DNA through the nuclear membrane, leading to efficient transfection. Also, for the GFP fluorescence microscopy studies, we did not include the DAPI 1084


Biomacromolecules

Article

Electron Microscopy Center of Northeastern University (Boston, MA).

untreated cells stimulated with LPS alone, which indicates that there were no signs of cell toxicity/apoptosis associated with naked plasmid DNA treatment. Also, the TNF-α levels of the naked plasmid DNA were comparable to those of untreated cells, further suggesting that plasmid DNA administration alone did not cause any inflammatory response. In addition, our group has also tested the efficacy of another formulation incorporating the same murine IL-10 plasmid DNA in an in vivo model of inflammatory bowel disease, and on the basis of those results, we do not anticipate any adverse effects from plasmid DNA administration.29 Overall, the results of these studies show that the calcium alginate nanoparticle matrix can be used for encapsulation of plasmid DNA. Albeit, the level of encapsulation was around 60% for the control and surface modified nanoparticles, the stability of encapsulated DNA and efficient intracellular availability led to high levels of transgene expression using both reporter GFP and therapeutically relevant mIL-10 expressing plasmids. Further evidence of mIL-10 transgene expression was demonstrated by down-regulation of the proinflammatory cytokine TNF-α at the transcription and translational levels. The sustained transgene expression with tuftsin-modified alginate nanoparticles suggests potential for this type of delivery system in targeting macrophages in vivo for anti-inflammatory therapy.

■

(1) Kawakami, S.; Higuchi, Y.; Hashida, M. J. Pharm. Sci. 2008, 97, 726−45. (2) Goverdhana, S.; Puntel, M.; Xiong, W.; Zirger, J. M.; Barcia, C.; Curtin, J. F.; Soffer, E. B.; Mondkar, S.; King, G. D.; Hu, J.; Sciascia, S. A.; Candolfi, M.; Greengold, D. S.; Lowenstein, P. R.; Castro, M. G. Mol. Ther. 2005, 12, 189−211. (3) Romano, G.; Pacilio, C.; Giordano, A. Stem cells (Dayton, Ohio) 1999, 17, 191−202. (4) Rothman, S.; Tseng, H.; Goldfine, I. Diabetes Technol Ther. 2005, 7, 549−57. (5) Bhavsar, M. D.; Amiji, M. M. Expert Opin. Drug Deliv. 2007, 4, 197−213. (6) Han, S.; Mahato, R. I.; Sung, Y. K.; Kim, S. W. Mol. Ther. 2000, 2, 302−17. (7) Kabanov, A.; Shriadibhatla, S.; Alakhov, V. In Polymeric Gene Delivery: Principles and Applications; Amiji, M., Ed.; CRC Press: Boca Raton, FL, 2005; pp 312−13. (8) Morille, M.; Passirani, C.; Vonarbourg, A.; Clavreul, A.; Benoit, J. P. Biomat. 2008, 29, 3477−96. (9) Draget, K.; Smidsrod, O.; Skjak-Braek, G. In Polysaccharides and Polyamides in Food Industry. Properties, Production and Patents; Steinbuchel, A.; Rhee, S., Eds.; Wiley-VCH Verlag GmbH & Co.KGaA: Weinheim, 2005; pp 1−30. (10) George, M.; Abraham, T. J. Controlled Release 2006, 114, 1−14. (11) Tonnesen, H.; Karlsen, J. Drug Dev. Ind. Pharm. 2002, 28, 621− 30. (12) Rajaonarivony, M.; Vauthier, C.; Couarraze, G.; Puisieux, F.; Couvreur, P. J. Pharm. Sci. 1993, 82, 912−7. (13) Phillips, J.; Babcock, G.; Nishioka, K. J. Immunol. 1981, 126, 915−21. (14) Amoscato, A.; Davies, P.; Babcock, G.; Nishioka, K. Ann. N.Y. Acad. Sci. 1983, 419, 114−34. (15) Najjar, V. Ann. N.Y. Acad. Sci. 1983, 419, 1−11. (16) Bar-Shavit, Z.; Stabinsky, Y.; Fridkin, M.; Goldman, R. J. Cell Physiol. 1979, 100, 55−62. (17) Ross, J.; Auger, M. In The Macrophage, 2nd ed.; Burke, B., Lewis, C., Eds.; Oxford University Press: New York, 2002; pp 49−55. (18) Lewis, C.; Pollard, J. Cancer Res. 2006, 66, 605−12. (19) Aouadi, M.; Tesz, G.; Nicoloro, S.; Wang, M.; Chouinard, M.; Soto, E.; Ostroff, G.; Czech, M. Nature 2009, 458, 1180−4. (20) Schmitt, F.; Lagopoulos, L.; Kauper, P.; Rossi, N.; Busso, N.; Barge, J.; Wagnieres, G.; Laue, C.; Wandrey, C.; Juillerat-Jeanneret, L. J. Controlled Release 2010, 144, 242−250. (21) Fernandes, J. C.; Wang, H.; Jreyssaty, C.; Benderdour, M.; Lavigne, P.; Qiu, X.; Winnik, F. M.; Zhang, X.; Dai, K.; Shi, Q. Mol. Ther. 2008, 16, 1243−51. (22) Wijagkanalan, W.; Kawakami, S.; Higuchi, Y.; Yamashita, F.; Hashida, M. J. Controlled Release 2011, 149, 42−50. (23) Gupta, C.; Haq, W. Methods Enzymol. 2005, 391, 291−304. (24) Khan, M.; Owais, M. J. Antimicrob. Chemother. 2006, 58, 125− 32. (25) Dutta, T.; Garg, M.; Jain, N. Eur. J. Pharm. Sci. 2008, 34, 181−9. (26) Farhood, H.; Serbina, N.; Huang, L. Biochim. Biophys. Acta 1995, 1235, 289−95. (27) Khalil, I.; Kogure, K.; Akita, H.; Harashima, H. Pharmacol. Rev. 2006, 58, 32−45. (28) Jin-Oh, Y.; Ching-An, P. J. Gene Med. 2005, 7, 398−406. (29) Bhavsar, M.; Amiji, M. Gene Ther. 2008, 15, 1200−9. (30) Kommareddy, S.; Amiji, M. Cancer Gene Ther. 2007, 14, 488− 98. (31) Lu, Y.; Yeh, W.; Ohashi, P. Cytokine 2008, 42, 145−51. (32) Scheule, R. K. Adv. Drug Delivery Rev. 2000, 44, 119−34.

■

CONCLUSIONS Macrophages play an important role in acute and chronic inflammatory reactions in the body. In this study, we have investigated macrophage-targeted alginate nanoparticles as a noncondensing delivery system for transfection of reporter (GFP expressing) and therapeutically relevant (mIL-10 expressing) plasmid DNA. Tuftsin-modified alginate nanoparticles were rapidly internalized in J774A.1 murine macrophages, leading to superior transfection potential without any toxicity. The quantitative and qualitative analysis of GFP and mIL-10 transgene expression confirmed efficient DNA delivery with tuftsin-modified alginate nanoparticles. Additionally, to establish the anti-inflammatory potential of mIL-10 transfection, the cells were stimulated with LPS for production of pro-inflammatory cytokine TNF-α. The expression levels of these pro-inflammatory cytokines were significantly decreased in macrophage previously transfected with mIL-10 expressing plasmid DNA. These results provide encouraging evidence for development of a systemic macrophage-targeted anti-inflammatory gene delivery system with potential to treat many debilitating diseases.

■

REFERENCES

AUTHOR INFORMATION

Corresponding Author

*Tel.: (617) 373-3137. Fax: (617) 373-8886. E-mail: m.amiji@ neu.edu. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This study was supported by a grant (R01-DK080477) from the National Institute of Diabetes, Digestive Diseases, and Kidney Diseases of the National Institutes of Health. We deeply appreciate the assistance of Ms. Jing Xu with the transmission electron microscopy analysis that was performed at the 1085


Tuftsin-Modified Alginate Nanoparticles as a Noncondensing

Recommend Documents