Two Splice Variants of Y Chromosome-Located Lysine-Specific

Page 1 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

Two splice variants of Y Chromosome-located Lysine-specific Demethylase 5D Have Distinct Function in Prostate Cancer Cell Line (DU-145) Zohreh Jangravi1,2, Mehdi Sharifi Tabar1, Mehdi Mirzaei3, Pouria Parsamatin1, Haghighat Vakilian1, Mehdi Alikhani1, Mohammad Shabani2, Paul A Haynes4, Ann K Goodchild3 , Hamid Gourabi5, Hossein Baharvand6,7, Ghasem Hosseini Salekdeh1,8* 1

Molecular Systems Biology Department at Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran 2 Biochemistry Department, Iran University of Medical Sciences, Tehran, Iran 3 The Australian School of Advanced Medicine, Faculty of Human Sciences, Macquarie University, Sydney, NSW, 2109, Australia 4 Department of Chemistry and Biomolecular Sciences, Macquarie University, Sydney, NSW, 2109, Australia 5 Department of Genetics at Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran 6 Department of Developmental Biology, University of Science and Culture, ACECR, Tehran, Iran 7 Department of Stem Cells and Developmental Biology at Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran 8 Department of Systems Biology, Agricultural Biotechnology Research Institute of Iran, Karaj, Iran

*Corresponding author: Ghasem Hosseini Salekdeh ([email protected]); Department of Molecular Systems Biology at Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran. Tel: +98 21 22306485; Fax: +98 21 23562507

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract One of the major objectives of the Human Y Chromosome Proteome Project is to characterize sets of proteins encoded from the human Y chromosome. Lysine (K)-specific demethylase 5D (KDM5D) is located on the AZFb region of the Y chromosome and encodes a JmjC-domaincontaining protein. KDM5D, the least well-documented member of the KDM5 family, is capable of demethylating di- and tri-methyl H3K4. In this study, we detected two novel splice variants of KDM5D with lengths of 2650bp and 2400bp that correspond to the 100 and 80 kDa proteins in the human prostate cancer cell line, DU-145. The knockdown of two variants using the short interfering RNA (siRNA) approach increased the growth rate of prostate cancer cells and reduced cell apoptosis. To explore the proteome pattern of the cells after KDM5D downregulation, we applied a shotgun label-free quantitative proteomics approach. Of 820 proteins present in all four replicates of two treatments, the abundance of 209 proteins changed significantly in response to KDM5D suppression. Of these, there were 102 proteins observed to be less abundant and 107 more abundant in KDM5D knockdown cells compared to control cells. The results revealed that KDM5D knockdown altered the abundance of proteins involved in RNA processing, protein synthesis, apoptosis, the cell cycle, and growth and proliferation. In conjunction, these results provided new insights into the function of KDM5D and its splice variants. The proteomics data are available at PRIDE with ProteomeXchange identifier PXD000416.

Keywords: Lysine (K)-specific demethylase 5D (KDM5D), Short interfering RNA (siRNA), Shotgun proteomics, Human Proteome Project


Page 2 of 36

Page 3 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction The Chromosome-Centric Human Proteome Project (C-HPP) has been launched to enhance our understanding of human biology by systematically mapping the entire human proteome in order to and lay a foundation for diagnostic, prognostic, therapeutic, and preventive applications1, 2. Therefore, a major objective of the Human Y Chromosome Proteome Project is to characterize the functional relevance human proteins in a biological and medical context. Lysine (K)-specific demethylase 5D (KDM5D) is located on the azoospermia factor b (AZFb) region of the Y chromosome. It is the least studied member of the JARID subfamily within the JmjC-domaincontaining proteins. These proteins comprise the largest class of demethylase enzymes that catalyze lysine demethylation of histones through an oxidative reaction 3. Covalent modifications of histones, particularly methylation/demethylation, play important roles in activation, gene silencing, normal development, and in different diseases such as cancer4. KDM5D speciﬁcally demethylates di- and trimethyl H3K4 5. Since trimethylated H3K4 are enriched specifically at the start site of transcriptionally active genes6, the trimethyl H3K4 demethylase activity of this protein may act as a transcriptional repressor. Demethylation of trimethyl H3K4 in close proximity to transcription start sites by KDM5D alters the basal transcription machinery and reduces occupancy of the chromatin remodeling complex, NURF, which results in repression of transcription7. Several recent studies have reported an association of KDM5 family members with cancer due to their capability of regulating an activation mark on H3K4. It has been suggested that these enzymes have oncogenic properties and tumor suppressor functions in various tissues 3. Although histone demethylase activity of KDM5D has been shown in different cell lines

7, 8

,

information related to the biological function of this protein and its association with various



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 36

diseases is limited 3. While no direct link has been established between KDM5D and cancer, deletion analysis of Y chromosome-specific genes in human prostate cancer reveals that 52% of cases show deletion of the KDM5D gene 9. In this study, we investigated the function of KDM5D in human prostate cancer cell line, DU145, by knocking down its expression utilising a short interfering RNA (siRNA) silencing approach. We subsequently analyzed the effect of this depletion on the morphology, physiology, and proteome profile of cells. Materials and Methods Cell culture and siRNA transfection Human prostate carcinoma cell line, DU-145, was obtained from the National Cell Bank of Iran and grown in RPMI 1640 medium (Gibco RL, Grand Island, NY) supplemented with 10% fetal bovine serum, penicillin (100 U/ml), 1% glutamine and 1% non-essential amino acids in a 5% humidified CO2 atmosphere. We used pool of siRNAs that targeted the KDM5D gene in different

exons.

The

siRNAs

nucleotide

sequences

were

as

below;

siRNA1:

GGCCCAAACUAGAGUGAAA (exon 4) siRNA2: GCACAUUCCUGGAGAGAGA (exon 5) siRNA3: GCUACGAUCACAUUA CGAA (exon 17) (Figure 1). The pool was synthesized by the Eurofins MWG operon (Ebersberg, Germany). We used BLOCK-iT(TM) Fluorescent Oligo (Invitrogen, Carlsbad, CA) to measure transfection efficiency. Silencer Select Predesigned siRNA (Negative control #1, Ambion) was used as the non-targeting control siRNA. siRNA transfection was performed using Lipofectamine® RNAiMAX (Invitrogen, Carlsbad, CA) in RPMI 1640 medium according to the manufacturer's protocol with a final siRNA concentration of 40 pmol. All experiments were performed using four biological replicates per treatment. At 48 h after transfection, we collected the cells for RNA and protein isolation.


Page 5 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Real-time PCR analysis Total RNA was extracted as described previously10 using Trizol reagent (Invitrogen, Carlsbad, CA). Quality and integrity of RNA samples were checked by a Nanodrop (ND-1000) spectrophotometer. M-MuLV reverse transcriptase (Fermentas Inc., MD) was used for reverse transcription according to the manufacturer’s protocol with 1 µg of total RNA. Quantitative realtime PCR (qRT-PCR) for KDM5D and KDM5C was performed in an Applied Biosystems 7900 instrument using the SYBR Green PCR master mix (Applied Biosystems, Foster City, CA). Relative mRNA levels were calculated, with beta-actin as an internal control for normalization, using the comparative CT method as described by the manufacturer (Applied Biosystems, Foster City, CA). Primers sequences used for qRT- PCR were as follows: P4 forward primer: 5'AGCAGAGCATTTGGAGGAGG -3', P5 reverse primer: 5'- TCCCCTGCACACTGGTTTGT 3', P6 forward primer: 5'- AACTATCTGCATTGGTTGTCCGC -3', P7 reverse primer: 5'CTCGTGGGAGAAGACACAATAG

-3';

Beta-actin

TCCCTGGAGAAGAGCTACG-3',

Beta-actin

forward reverse

primer: primer:

5'5'-

GTAGTTTCGTGGATGCCACA -3'. The P4 and P5 primers were designed from exons 14 and 15, respectively, amplifying both KDM5D-V1 and KDM5D-a transcripts. The primer P6 was designed in exon junction manner between exons 13 and 15 (KDM5D-b lacks exon 14) so that exclusively amplify the KDM5D-b transcript (Figure 1A,B). Western blot analysis Protein extractions were performed using a Qproteome Mammalian Protein Prep Kit (Qiagen, Hilden, Germany), and protein quantification was carried out by Bradford assay. Proteins (40 µg) were separated on an 8% SDS-polyacrylamide gel (SDS-PAGE) and then transferred to PVDF membranes (Bio-Rad, Hercules, CA). The blots were blocked with TBST (20 mM Tris-



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

HCl, pH 7.6, 150 mM NaCl, and 0.1% Tween-20) that contained 5% BSA, and then incubated overnight at 4°C with primary antibodies: rabbit anti-KDM5D (1:10000, Abcam, ab35492) and rabbit anti-GAPDH (1:5000, Sigma, G9545). After washing with TBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (1:100,000, Sigma, A2074), for 1 h at room temperature. Signals were detected with an ECL substrate (GE Healthcare, Piscataway, NJ) using Hyperfilm (GE).

Designing primers to detect KDM5D splice variants in the DU-145 cell line VectorNTI was used to design variant specific primers. Briefly, two forward primers, one from upstream (P1: 5’ GGTCCTTCCCTGCAATACGCA -3’) and another from downstream (P2: 5’GAAGGTCTCACAGGTTTGGA -3’) of the transcription start site (TSS) along with a reverse primer (P3: 5’- AGGCCAGGAGATAGTAGGATT -3’) that corresponded to the 3’ end of the KDM5D mRNA were designed to amplify all possible alternatively spliced variants. By designing the P1 forward primer we aimed to determine the presence of any possible additional TSS in the 5-UTR of the gene (Figure 1A, B). MTS assay DU-145 cells were plated onto 12-well plates at a density of 75 × 103 cells per well. After 24 h, cells were treated with control or KDM5D siRNA. 3-(4,5-dimethylthiazol-2-yl)-5-(3carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium inner salt (MTS) reagent (Promega, Madison, WI) was added directly to the wells 48 h after control and KDM5D siRNA. Cells were incubated for a minimum of 3 h at 37°C. Assessment of viability was recorded as relative colorimetric changes measured at 490 nm. Immunofluorescence staining


Page 6 of 36

Page 7 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For immunostaining experiments, cells were fixed with 4% paraformaldehyde (Sigma-Aldrich, P6148) for 15 min, after which their membranes were permeabilized by 0.2% Triton X-100 (Sigma-Aldrich, T8532) and blocked with 1% BSA and 10% host serum of the secondary antibody (Sigma-Aldrich, A3311). Cells were incubated overnight at 4°C with the primary antibody, rabbit anti-KDM5D (1:200, Abcam, ab35492), which was diluted in blocking solution for 1 h. After washing three times with 0.1% Tween 20 in PBS, cells were incubated at 37˚C with goat anti-rabbit DyLight conjugated secondary antibody (1:200, Santa Cruz Biotechnology, sc-2780) for 45 min. The nuclei were counterstained with DAPI (1:1000, Sigma-Aldrich, D8417), then analyzed using a fluorescence microscope (Olympus, Japan). Quantitation was performed using ImageJ software, after which the corrected total cell fluorescence was calculated. Detection of apoptosis Apoptosis was assayed using the Annexin V-FITC/Propidium Iodide (PI) Apoptosis Detection Kit (Miltenyi Biotec, Bergisch Gladbach, Germany). We calculated the percent of apoptotic cells with a BD FACSCalibur flow cytometer and the Cell Quest program (Beckton Dickinson, San Diego, CA). Cell cycle analysis DU-145 cells (75 × 103) were seeded into each well of a 12-well culture plate and incubated at 37°C overnight. Cells were transfected with control and KDM5D siRNA. After 48 h, treated cells were detached, and fixed with 500 µl of 70% ethanol for 2 h at -20°C. Cells were washed twice with PBS, and stained with PI (50 µg/ml PI and 100 µg/ml RNase A in PBS) for 30 min at 37°C. Cell cycle analysis was performed on a BD FACSCalibur flow cytometer and the Cell Quest program (Becton-Dickinson, San Jose, CA).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

BrdU cell cycle analysis Transfected cells were exposed to 10 mM BrdU for 30 min. Cells were harvested and washed with PBS and subjected to staining with FITC-conjugated BrdU antibody and PI according to the manufacturer's protocol (BD Biosciences) prior to analysis using a BD FACSCalibur flow cytometer and the Cell Quest program (Becton-Dickinson, San Jose, CA).

Protein separation by SDS-PAGE and trypsin in-gel digestion We loaded 150 µg of protein into each well of an 8% SDS-PAGE gel and separated them on 10% bis-tris polyacrylamide gels for 1 h at 150 V. Proteins were visualized by colloidal Coomassie Blue staining, and gels were then washed twice in water for 10 min. Lanes were excised and each lane was cut into 16 equal slices from top to bottom, then further chopped into smaller pieces and placed into the wells of a 96-well plate. Gel pieces were briefly washed with 100 mM NH4HCO3 and 200 µL of 50% ACN/100 mM of 50% NH4HCO3, twice eachfor 10 min, prior to dehydration in 100% ACN. Samples were air dried, reduced with 50 µL of 10 mM DTT/50 mM NH4HCO3 at 37˚C for 1 h and alkylated with 50 µL of 50 mM iodoacetamide/50 mM NH4HCO3 for 1 h in the dark at room temperature. Samples were washed briefly with 100 mM NH4HCO3, 200 µL of 50% ACN/100 mM of 50% NH4HCO3 for 10 min, dehydrated with 100% ACN and dried again. Samples were subsequently digested with 20 µL of trypsin (12.5 ng/mL of 50 mM NH4HCO3), first for 30 min on ice, then overnight at 37˚C. Resultant peptides were twice extracted with 30 µL of 50% ACN/2% formic acid, dried in a vacuum centrifuge and then reconstituted to with 2% formic acid to a final volume of 10 µL. Nanoflow high performance liquid chromatography - tandem mass spectrometry


Page 8 of 36

Page 9 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Peptides were analyzed by nanoLC-MS/MS system which included an LTQ-XL ion-trap MS (Thermo, San Jose, CA). Columns used for reversed-phase chromatography were made from 100 µm I.D. fused silica tubing, including an integrated electrospray tip, and were packed with 100 Å, 5 µM Zorbax C18 resin (Agilent Technologies, Santa Clara, CA) to a column length of 7.5 cm or greater. A gold electrode liquid junction was used to provide electrospray voltage of 1.8 kV. Samples were injected onto the C18 column using a Surveyor autosampler (Thermo, San Jose, CA). Following an initial wash with buffer A [5% (v/v) ACN, 0.1% (v/v) formic acid] for 10 min at 1 µL/min, peptides were subsequently eluted using a gradient from 0-50% buffer B [95% (v/v) ACN, 0.1% (v/v) formic acid] over 58 min at 500 nL/min followed by 50%-95% buffer B over 5 min at 500 nL/min. The eluate from the column was directed into the nanospray ionization source of the mass spectrometer and survey stands were performed over the range of 400 - 1500 amu. Dynamic exclusion was used with an exclusion window set to 90s, and the top six most intense precursor ions were selected for tandem MS of at 35% normalization collision energy, using Xcalibur software (version 2.06, Thermo, San Jose, CA.). Data processing and quality control Global Proteome Machine Organisation (GPM) open source software (www.thegpm.org) was used to search tandem mass spectra against a Homo sapiens protein database compiled from NCBI (RefSeq protein database containing 99,871 sequences as of Sept 2014). The database also contained a list of common human tryptic peptide contaminants. Search parameters included MS and MS/MS tolerances of ±2 Da or ±0.2 Da, K/R–P cleavages, and allowing for up to 2 missed tryptic cleavages. Carbamidomethylation of cysteine was considered as a static modification, and oxidation of methionine was considered as a dynamic modification. For each condition, we combined the GPM outputs from each of the four biological replicates to produce a single high



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 36

confidence shotgun proteomic analysis output. The final data set contained all proteins common to each of the four replicates that had a total spectral count of at least six for at least one condition. False Discovery Rates (FDR) of identification were calculated using a reversed sequence decoy database. Protein FDR = (#Reverse proteins identified)/(Total protein identifications) × 10011 ; Peptide FDR = 2 × (#Reverse peptide identifications)/(Total peptide identifications) × 10012. Statistical analysis Normalized Spectral Abundance Factor (NSAF) values were calculated as previously described for each identified protein13. A spectral fraction of 0.5 was added to all spectral counts, in order to compensate for null values and therefore allow log transformation of data necessary for subsequent statistical analyses. Student t-tests on log-transformed NSAF data were used to determine differentially accumulated proteins. Only proteins present in all four replicates for at least one condition were included in the data set. Proteins with t-test p-values

Two Splice Variants of Y Chromosome-Located Lysine-Specific

Recommend Documents