Unveiling the Pathogenic Molecular Mechanisms of the Most Common

Subscriber access provided by Fudan University

Article

Unveiling the pathogenic molecular mechanisms of the most common variant (p.K329E) in Medium-chain acyl-CoA dehydrogenase deficiency by in vitro and in silico approaches. Cátia A. Bonito, Joana Nunes, João Leandro, Filipa Louro, Paula Leandro, Fatima Vieira Ventura, and Rita C. Guedes Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.6b00759 • Publication Date (Web): 30 Nov 2016 Downloaded from http://pubs.acs.org on December 14, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Unveiling the pathogenic molecular mechanisms of the most common variant (p.K329E) in Mediumchain acyl-CoA dehydrogenase deficiency by in vitro and in silico approaches. Cátia A. Bonito1,2, Joana Nunes1, João Leandro1, Filipa Louro1, Paula Leandro1, Fátima V. Ventura1*, Rita C. Guedes2* 1

Department of Biochemistry and Human Biology, 2Metabolism and Genetics Group, Research Institute

for Medicines, iMed.ULisboa, 3Medicinal Chemistry, Research Institute for Medicines, iMed.ULisboa, 4

Department of Pharmaceutical Chemistry and Therapeutics, Faculty of Pharmacy, University of Lisbon, Av. Prof. Gama Pinto, 1649-003 Lisboa, Portugal

KEYWORDS: Mitochondrial fatty-acid β-oxidation, Medium-chain acyl-CoA dehydrogenase (MCAD); MCAD deficiency; p.K329E variant.

ABSTRACT

Medium-chain acyl-CoA dehydrogenase deficiency (MCADD) is the commonest genetic disorder affecting the mitochondrial fatty acid β-oxidation pathway. The mature and functional form of human MCAD (hMCAD) is a homotetramer assembled as a dimer of dimers (monomers

ACS Paragon Plus Environment

1

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 54

A/B and C/D). Each monomer binds a FAD cofactor, necessary for enzyme’s activity. The most frequent mutation in MCADD results from the substitution of a lysine by a glutamate in residue 304 of the mature hMCAD (p.K329E in the precursor protein). Here, we combined in vitro and in silico approaches to assess the impact of the p.K329E mutation on the protein’s structure and function. Our in silico results demonstrated for the first time, that the p.K329E mutation despite lying at dimer-dimer interface and deeply buried inside the tetrameric core, seems to affect the tetramer surface, especially the β-domain which forms part of the catalytic pockets wall. Additionally, the molecular dynamics data indicates a stronger impact of the mutation on the protein’s motions in dimer A/B, while dimer C/D remains similar to the wild-type. For dimer A/B a severe disruption in the pockets’ architecture and in the FAD and octanoyl-CoA binding affinities were also observed. The presence of unaffected pockets (C/D) in the in silico studies may explain the decreased enzymatic activity determined for the variant protein (46% residual activity). Moreover, the in silico structural changes observed for the p.K329E variant protein provide explanation for the structural instability observed experimentally, namely disturbed oligomeric profile, thermal stability and conformational flexibility, in respect to the wild-type.

1. INTRODUCTION The medium-chain acyl-CoA dehydrogenase deficiency (MCADD; OMIM #201450, ORPHA42) is the most common genetic disorder affecting the mitochondrial fatty acid βoxidation (mFAO) pathway.1 It is caused by a deficiency in the medium-chain acyl-CoA dehydrogenase (MCAD; EC 1.3.8.7) protein that catalyzes the first step of mFAO, a dehydrogenation reaction of C4 to C14 acyl-CoAs (Supporting Information, Scheme S1) with a maximal catalytic efficiency for octanoyl-CoA (C8-CoA).1 The human MCAD (hMCAD) is a


2

Page 3 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

mitochondrial matrix protein encoded by the ACADM nuclear gene. Upon import into the mitochondria the N-terminal signal peptide of 25 amino acid residues is cleaved off producing the mature and functional form of hMCAD. This protein is a homotetramer, with 396 amino acids (≈ 44 kDa) per monomer and comprising four catalytic pockets (Figure 1). Each hMCAD monomer presents three structural domains: the N- and C-terminal α-helical domains (helix A to F and G to L, respectively) which flank an intermediate β-sheet domain. The tetramer is considered a dimer of dimers (formed by monomers A/B and C/D; Figure 1 – lower panel) and the interface between them, the protein core, involves groups of four α-helices, similar to a fourhelix bundle structure (helix G, H, I and K).2–4 The flavin adenine dinucleotide (FAD) is the MCAD natural cofactor, which binds non-covalently in the active site being essential for the enzyme’s function and structure.1,2


3

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 54

Figure 1: Structural representation of hMCAD wild-type monomer (upper panel) and tetramer (lower panel) with location of FAD cofactor (gray) and octanoyl-CoA (C8-CoA) substrate (green); the tetramer is considered a dimer of dimers (formed by monomers A/B and C/D). Figures were created with MOE v2014.09 from PDB ID: 1EGC.

The MCADD is an autosomal recessive metabolic disorder presenting clinical, biochemical and mutational heterogeneous profiles that often impair the diagnosis, establishment of genotype/phenotype correlations and treatment.5 Patients with MCADD are mostly asymptomatic until the occurrence of metabolic crises, commonly triggered by catabolic stress such as prolonged fasting, intense exercise or illness with


4

Page 5 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

fever episodes. The symptoms include hypoketotic hypoglycemia and lethargy which may lead to coma and sudden death.1 MCADD presents high rate of morbidity and mortality, especially in childhood, with a 4% risk of mortality within the first 3 days of life, rising up to 5-7% until 6 years of age.6 Currently, MCADD is included in newborn screening (NBS) programs in many countries.9 This metabolic disorder is characterized by high levels of circulating C6 to C10 acylcarnitines, in particular octanoylcarnitine (C8 acylcarnitine) a metabolite present in symptomatic and asymptomatic patients and the main biomarker in NBS.7,8 Although being estimated to be present in a lower frequency in some populations (e.g. Asian and African), the prevalence of MCADD has been calculated to be around 1: 15,000 in Caucasians. Epidemiological data also revealed that MCADD is the most frequent inborn metabolic disorder in many countries such as Portugal (1: 8,385), Denmark (1: 8,954) and southern Germany (1: 8,500).7,10,11 To date, ≈ 100 different mutations have been reported (Public Human Gene Mutation Database®, Cardiff, UK), the majority being missense mutations resulting in single amino acid changes in the hMCAD sequence. These substitutions have been reported to impair or fully abolish enzyme’s activity and/or alter protein structure (misfolding) targeting the protein for degradation (conformational disorder with loss-of-function).12–14 The most common mutation identified in MCAD deficient patients is the transition of an adenine to a guanine in nucleotide 985 (c.985A>G) of exon 11 of the ACADM gene, and has been found in homozygous states in the majority of the North-Western European MCADD population. This mutation is also the most frequently found in compound heterozygous patients.15 Presently, it is recognized that the c.985A>G ACADM gene mutation is linked to higher risk of adverse clinical episodes.5


5

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 54

At the protein level the c.985A>G mutation results in the substitution of a lysine (Lys; K) by a glutamate (Glu; E) at residue 329 (p.K329E) of the precursor hMCAD. The Lys329 residue is located in the middle of α-helix H, which may affect the tetramer folding and/or assembly and lead to the loss-of-function phenotype.2,13,16 It has been suggested that in the p.K329E variant the change of the positively charged Lys residue by the negatively charged Glu residue, in the vicinity of two other negatively charged residues (Glu325 and Asp371 of the precursor protein), increases the local negative charge at the dimer-dimer interface. The increased charge-repulsion between such residues may contribute for an impaired assembly and/or compromised stability of the tetramers.

2,12,13,17

However, the molecular mechanism by which this occurs is not fully

characterized. At the functional level, the recombinant p.K329E variant presents a decreased activity (40% of residual enzyme activity), a broader change in substrate specificity with a maximal catalytic efficiency for the dodecanoyl-CoA (C12-CoA) and a marked change in the thermal inactivation profile (with a 4 ºC lower temperature at 50% of inactivation when compared to the wildtype).14,18 Currently, there is no approved pharmacological therapy for MCADD. The long-term treatment consists mainly in the dietary control and avoidance of fasting through frequent feeding, although in many countries a high-carbohydrate and a reduced-fat diet, supplemented with oral L-carnitine, is also recommended.19 Additionally, and despite under dietary control, many patients still present acute life-threatening decompensation episodes. These facts highlight the need for novel therapeutic approaches for MCADD treatment19 and the identification of the mechanisms underlying the decompensation episodes. This will allow to hold a more robust


6

Page 7 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

therapeutic approach to minimize the potential well-known long term morbidity associated with MCAD deficiency. To investigate the structural and functional impact of the substitution of a Lys by a Glu on MCAD residue 329, found in the majority of homozygous and compound heterozygous MCAD deficient patients, a combination of in vitro and in silico studies of the p.K329E variant and hMCADwt was undertaken. Purified recombinant proteins were characterized at the biochemical and biophysical level. To complement the experimental data, molecular dynamics (MD) simulations were also carried out. Since the crystallographic structure of the hMCADwt in the presence of the FAD cofactor and the fatty-acyl substrate is yet to be resolved, the structure of the hMCADwt was obtained according to a previously validated model.20 Then, the p.K329E mutation was inserted into the hMCADwt structure and all changes in the protein dynamics were thoroughly characterized by comparison with the ones registered for the wild-type protein. Overall, the data obtained from the experimental studies, together with the new insights gathered by the computational methodology, allowed a novel approach on MCADD by providing a thorough characterization and validation of in vitro and in silico models for the study of the p.K329E variant. These combined approaches open new perspectives for the better understanding of p.K329E pathogenesis and ultimately for the design and development of compounds that may constitute potential pharmacological strategies, so far inexistent, for the treatment of MCADD.

2. METHODS 2.1 Experimental methodology 2.1.1 Materials


7

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 54

The Escherichia coli BL21 (DE3) strain, the prokaryotic expression vector pET28a(+) and the fluorescent dye SYPRO® orange (5000x stock concentration) were purchased from Invitrogen (Carlsbad, CA, USA). The FAD cofactor, C8-CoA substrate, phenazine methosulphate (PMS), 2,6-dichlorophenolindophenol (DCPIP), trypsin, soybean trypsin inhibitor, DNase, imidazole, and bovine serum albumin (BSA) were acquired from Sigma-Aldrich (St. Louis, MO, USA). The primers for site-directed mutagenesis were obtained from Metabion (Martinsried, Germany). The QuikChange® II site-directed mutagenesis kit was obtained from Stratagene (La Jolla, CA, USA). The Ni-chelating resin for protein purification was purchased from Qiagen (Valencia, CA, USA). All other chemicals were of analytical grade.

2.1.2 Construction of expression vectors The cDNA of the mature hMCAD protein (gentle offer of Prof. Niels Gregersen, Aarhus University Hospital, Denmark) was cloned between NdeI and HindIII sites of the multiple cloning site (MCS) of the expression vector pET28a(+). This vector carries at 5’ and 3´of the MCS

a

nucleotide

sequence

codifying

for

a

hexahistidyl

peptide

(6xHis

tag).

The obtained construct was further modified by site-directed mutagenesis using the primers MCAD_Del_pET_N-6xHis_S

(5’-CCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGG

AGATATCATATGAAAGCCAATCGACAACGTGAACCAGG-3’) and MCAD_ Del_pET_N6xHis_A(5’-CCTGGTTCACGTTGTCGATTGGCTTTCATATGATATCTCCTTCTTAAAGT TAAACAAAATTATTTCTAGAGGGG-3’) to delete the sequence codifying for the N-terminal 6xHis-tag. This allowed us to obtain the pETMCADwt construct expressing the hMCADwt protein

presenting

a

C-terminal

6×His

tag.

The

primers

MCAD_G985_AS

(5’-

CAGGAAACAGCTATGACCATGGATCTGCACAGCATCAGTAGC-3’) and MCAD_G985


8

Page 9 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

_S (5’-TTTATGCTGGCTGAAATGGCCATG-3’) were used to further introduce the c.985A>C mutation generating the pETMCADK329E construct used in this study for the heterologous expression of the p.K329E variant protein. The obtained constructs were sequenced in both directions to verify the introduction of the desired mutations and exclude additional mutational events.

2.1.3 Protein expression and purification Competent E. coli BL21 (DE3) cells were transformed with either the pETMCADwt or pETMCADK329E constructs and grown in solid Luria Bertani (LB) medium supplemented with kanamycin (Kan; 50 µg/mL final concentration), at 37°C and 140 rpm, until an optical density at 600 nm of 0.6. At this point Isopropyl β-D-1-thiogalactopyranoside (IPTG; 0.5 mM final concentration) was used to induce protein expression. After 21 hours incubation, at 27°C and 140 rpm, cells were harvested (3,500g/10 min/4°C) and the resulting pellet used immediately or alternatively stored at -20°C up to a month. For protein purification the bacterial cells were disrupted by sonication at 4°C in 20 mM phosphate buffer (KPi) pH 7.4, 500 mM NaCl (buffer A) containing 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mg/mL of lysozyme and Dnase. The soluble and insoluble cellular fractions were isolated from the supernatant and pellet respectively, obtained by centrifugation (13,000g/40 min/4°C). The recombinant hMCAD proteins were further purified from the soluble cellular fraction by Immobilized Metal Affinity Chromatography (IMAC) using a Ni2+-chelating resin as described by Zeng and Li.21 The IMAC purification protocol comprised an imidazole gradient of 20 mM to 500 mM imidazole in buffer A. The IMAC eluted fractions were further analyzed by 12% denaturing polyacrylamide gel


9

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

electrophoresis (SDS-PAGE) after Coomassie brilliant blue R-250 staining.

Page 10 of 54

The fractions

containing the recombinant protein were pooled and dialysed overnight (ON) at 4°C with stirring, against the dialysis buffer (20 mM KPi, pH 7.4; 5 mM β-mercaptoethanol; 5% glycerol). Alternatively, the IMAC fractions containing the purified enzyme were pooled and loaded into a desalting gravity-feed PD-10 column (Sephadex™ G-25 Medium; MWCO 5 kDa; GE Healthcare Life Sciences, Uppsala, Sweden) and eluted with 20 mM KPi, pH 7.4, 200 mM NaCl (SEC buffer). The recombinant hMCAD proteins concentration was determined by the Bradford22 assay using the Bio-Rad Protein assay (Bio-Rad® Laboratories, Inc., EUA) and bovine serum albumin as the standard.

2.1.4 Size Exclusion Chromatography (SEC). SEC was performed on a AKTA® primeplus system (GE Healthcare, EUA) equipped with a UV detector (280 nm).23 After centrifugation at 13,000g/10 min/4°C to eliminate potential insoluble aggregates, the recombinant protein solution was loaded on a HiLoad™ 16/60, Superdex™ 200 prep grade column (GE Healthcare). Samples were run at 4°C in SEC buffer and a flow rate of 0.7 mL/min. The relative molecular mass (MR) of the different oligomeric forms was estimated from a calibration curve obtained by running a mix of standard proteins (cytochrome c, 12.4 kDa; ribonuclease, 13.7 kDa; myoglobin, 17.6 kDa; ovalbumin, 43 kDa; BSA, 66 kDa; alcohol dehydrogenase, 150 kDa; β-amylase, 200 kDa; and apoferritin, 440 kDa). Blue Dextran 2000 and L-tyrosine were used to determine the void volume (V0 = 46.6 mL) and the total exclusion volume (VT = 119.4 mL) of the column, respectively. The elution volume and relative amount of


10

Page 11 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

the oligomeric forms were determined by deconvolution analysis of the obtained chromatograms with PeakFit v4.12 (Systat Software Inc, San Jose, CA, USA). For each recombinant protein, the oligomeric profile was represented by the content (as percentage) of aggregates, high molecular mass species, tetramers, dimers and monomers relative to the total protein forms. The fractions corresponding to the tetrameric forms (MR ≈ 176.8 kDa) were collected and concentrated by ultrafiltration using a ViVaSpin 15R concentrator (MWCO 30 kDa; Sartorius Stedim Biotech, GmbH, Goettingen, Germany) for immediate use or to be stored in liquid N2.

2.1.5 Limited Proteolysis by trypsin. A reaction mixture with a total volume of 150 µL containing 0.3 mg/mL of purified hMCAD tetramers and 0.012 mg/mL trypsin [1:25 trypsin: protein ratio (by mass)] was incubated at 37°C in SEC buffer. At timed intervals (0-60 min), aliquots of the reaction were collected and mixed with soybean trypsin inhibitor at 1:1.5 protease to inhibitor ratio (by mass) and denatured at 95°C in the presence of SDS-PAGE loading buffer. The degradation profile was evaluated by 12% SDS-PAGE after gel staining. Bands were quantified by densitometry using the Image J® 1.43U NIH program (Image Processing and Analysis in Java). Using Graphpad Prism 6 v6.01 (GraphPad Software Inc. La Jolla, CA, USA) the obtained data were fitted to a single exponential decay equation allowing to obtain the decay constant of proteolysis (kP) and the percentage of full-length protein after 30 min proteolysis (FL30min).

2.1.6 Differential Scanning Fluorimetry (DSF).


11

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 54

In Real-Time PCR (RT-PCR) 96 wells plates, 5 µg of isolated tetramers of each recombinant protein were mixed with SYPRO® Orange (5x final concentration), as the hydrophobic probe, and SEC buffer in a final volume of 50 µL. The RT-PCR plates were sealed with Optical-Quality Sealing Tape (BioRad® Laboratories, Inc., EUA), centrifuged (500g/3 min/4ºC) and run in a RT-PCR system (C1000 Touch thermal cycler; BioRad) from 20 to 90 ºC (0.2ºC/12s), after an initial incubation of 10 min at 20°C. Fluorescence data were acquired using the FRET channel. The fluorescence intensity was plotted as a function of the temperature allowing determination of the protein melting temperature (Tm), i.e. the temperature at which the free energy of the native and the unfolded forms of the protein are equivalent.24,25 Data were processed using CFX Manager software V3.0 (Bio-Rad) and the GraphPad Prism 6 v6.01. The temperature scan curves were fitted to a biphasic dose-response function and the Tm values were obtained from the midpoint of the first (Tm1) and second (Tm2) transitions. The Tm values obtained for the wild-type and p.K329E variant were further compared and conclusions on the stability of the variant protein were inferred when |∆Tm|>2ºC.

2.17 Dynamic Light Scattering (DLS). Dynamic light scattering analysis was performed on a ZetaSizer Nano-S particle size analyzer (Malvern Instrument, UK) equipped with a precision Peltier temperature control unit (accuracy of 0.1ºC). A He-Ne laser was used as the light source and a λ of 633 nm. The intensity of light scattered at an angle of 173º was measured by an avalanche photodiode. The tetrameric fraction of each recombinant hMCAD protein was centrifuged (13,000g/15 min/4°C), diluted to 0.15 mg/mL with SEC buffer and filtered through a 0.2 µm membrane to remove larger soluble aggregates. Two different assays were performed in order to determine: (i) the temperature of


12

Page 13 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

aggregation (Tagg), by ramping the temperature from 20 to 70°C at 0.5°C/step and collection of the data on particle size distribution and total scattering intensity at 0.5 min intervals; and (ii) the aggregation kinetics at 37°C and 42°C. Data were processed using Zetasizer Nano DTS software v7.01 and analyzed with GraphPad Prism 6 v6.01. The Tagg (temperature at which a significant increase in size and intensity of scattered light occurs) was calculated by fitting the obtained data to a plateau followed by one phase association equation. The aggregation kinetics were analyzed using the exponential growth curve described by Golub et al..26 = − 1 − where I is the limiting value of I (Intensity) at t → ∞, k is a first order rate constant and t is the lag time (tlag; time at which the protein starts to aggregate). By comparing the Tagg and tlag of the hMCADwt and p.K329E variant it was possible to infer on the structure and stability of the latter. For the Tagg parameter a result was considered significantly different when |∆Tagg| > 2°C.

2.1.8 Enzymatic activity and kinetic parameters. The

enzymatic

activity

of

the

recombinant

hMCAD

tetramers

was

measured

spectrophotometrically by following the absorbance decrease at 600 nm in the presence of the C8-CoA substrate and the artificial redox pair PMS/DCPIP, according to the method described by Zeng and Li.21 The kinetic parameters Vmax, Km, Kcat, and catalytic efficiency (Kcat/Km) were also determined. The Kcat was determined based upon the molecular mass of the recombinant hMCAD subunit (44.2 kDa). The standard reaction mixture (20 mM KPi, pH 7.4; 1.5 mM PMS; 48 µM DCPIP; 33 µM C8CoA) was prepared in a final volume of 1 mL. The enzymatic assay was started by the addition


13

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 54

of 8 µg of the purified tetramers and was followed for at least 1 min at 25°C. A control assay was performed for each protein using the same conditions but in the absence of fatty-acyl substrate to account for any potential spontaneous reduction of the DCPIP component. The specific enzyme activity was expressed as µmol of DCPIP reduced per mg of protein per min (µmol.min-1.mg-1). The kinetic parameters were determined by assessing the enzymatic activity of hMCAD at increasing fatty-acyl substrate concentrations (1 - 100 µM). The obtained data were analyzed by nonlinear regression analysis using the GraphPad Prism 6 v6.01 and the Michaelis-Menten equation.

2.2 Computational methodology 2.2.1 Systems Preparation. The hMCADwt protein was obtained by reverting the Glu376Gly/Thr255Glu double mutation in the only available crystallographic structure of the hMCAD protein (residues numbering correspond to the mature protein) (PDB ID: 1EGC),27 in complex with FAD cofactor and C8CoA substrate.20 Following, the p.K329E mutation was obtained by mutating the wild-type structure into the p.K329E variant through the substitution of Lys329 by a glutamic acid residue (Glu), using the MOE 2014.0928 software. To assess the influence of the FAD cofactor and the fatty-acyl substrate in the dynamic behavior of both hMCADwt and p.K329E variant proteins, three systems were built for each protein: APO (no fatty-acyl substrate, nor FAD), FAD (no fatty-acyl substrate, with FAD), and LIPID (with both fatty-acyl substrate and FAD). All water molecules from the original crystallographic structures were removed (no crystallographic waters were found to be structurally important, as observed in a previous


14

Page 15 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

work)20 and the protonation state of titratable residues was assessed at 310 K (37°C) and pH 7.4 (physiological conditions) using the Protonate3D module available in the MOE 2014.09.28 Those residues as well as the C-terminal carboxyl and N-terminal amine groups were kept in their typical ionization states at neutral pH, except the His65 residue (charge +1). In order to use these structures with the GROMOS 53a629–31 force field, all the non-polar hydrogens were removed with the MOE 2014.09 software and the structures were further exported to GROMACS as PDB files. Then, protein topologies were generated according with the GROMOS 53a6 force field through the pdb2gmx module available in the GROMACS 4.6.332–35 package. As the topologies of the FAD cofactor and the C8-CoA substrate are not included in the typical residue library of GROMOS 53a6 force field, their topologies were obtained from the Automated Topology Builder (ATB) and Repository36,37 web server (for the FAD cofactor, freely available at http://atb.uq.edu.au/molecule.py? molid=7837) and PRODRG38 server (for the C8-CoA substrate) (manually curated). Each protein was kept centered in a cubic simulation box with dimensions xyz of 12.9 × 12.9 × 12.9 nm, with a distance of 1.0 nm from the box edge to allow periodic boundary conditions (PBC) in all dimensions. The systems for hMCADwt were solvated with 64.182 (APO), 64.079 (FAD) and 63.941 (LIPID) water molecules. As both the FAD cofactor and the C8-CoA substrate are negatively charged (charge of -2 and -4, respectively), the system’s total charge was neutralized by replacing an adequate number of water molecules with 4 (APO), 12 (FAD) or 28 (LIPID) sodium ions. Overall, the number of atoms in each system for hMCADwt was 207.910 (APO), 207.869 (FAD) and 207.731 (LIPID) respectively.


15

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 54

The systems for the p.K329E variant were solvated with 64.179 (APO system), 64.076 (FAD system) and 63.938 (LIPID system) water molecules (as above) and the system’s total charge was neutralized with 12 (APO system), 20 (FAD system) and 36 (LIPID system) sodium ions by replacing the same amount of water molecules. Overall, the number of atoms in each system for p.K329E variant was 207.897 (APO system), 207.856 (FAD system) and 207.718 (LIPID system) respectively.

2.2.2 Molecular Dynamics Simulations. The MD simulations for both hMCADwt and p.K329E variant protein systems were performed using the GROMOS 53a6 force field and the water molecules were parameterized according to the Simple Point Charge (SPC)39 model, both available in GROMACS 4.6.3 package. Previous to any MD simulation, and to remove any clashes between the atoms, energy minimization runs were performed using the steepest descent algorithm. The minimization stopped when the maximum force acting on an atom was < 1000 kJ mol-1 nm-1. All the systems were further equilibrated under NVT ensemble (100 ps) and an NPT (2 ns) simulations. The V-rescale weak coupling method40 was used to heat the systems to 310 K in the NVT equilibration run while in the NPT ensemble the Nosé-Hoover thermostat41,42 (two coupling groups, reference temperature of 310 K with a coupling time of 0.2 ps) together with the Parrinello-Rahman barostat43 (isotropic pressure coupling to a reference pressure of 1 bar, with a coupling time of 2 ps) were used to achieve a more rigorous control. Isothermal compressibility of water was set as default (4.5e-5 bar-1). Positional restraints on all heavy atoms (xyz, 1000 kJ mol-1 nm-2) were applied in both NVT and NPT (1 ns) runs, followed by an unrestrained NPT (1 ns) on heavy atoms of the FAD


16

Page 17 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

cofactor and C8-CoA substrate. The LINCS44,45 and SETTLE46 (for water molecules) algorithms were applied to constrain all bond lengths. A cut-off of 1.0 nm was used to compute the shortrange electrostatic and van der Waals interactions. Long-range electrostatic interactions employed the Particle Mesh Ewald (PME) method.47,48 Fully unrestrained production runs were performed over 100 ns under identical conditions previously described for the NPT ensembles.

2.2.3 Analysis of the MD trajectories. Several modules available in GROMACS package were used to thoroughly analyze the structural stability and the dynamic behavior of the hMCADwt and the p.K329E variant proteins in order to provide insights that might explain and/or complement the obtained experimental data. To assess the protein’s stability throughout the MD simulations, the root mean square deviation (RMSD) and radius of gyration (Rg) of the Cα atoms were calculated for each protein’s systems. The evolution of the secondary structure in function of time was calculated by the DSSP software.49,50 In order to analyze the impact of the p.K329E mutation in the protein’s motions, principal component analysis (PCA) was performed using the ProDy51,52 software. To assess the protein flexibility, the root mean square fluctuation (RMSF) of the protein’s residues was also calculated. To evaluate the effect of the p.K329E mutation in the structure and dynamics of the catalytic pockets, the volumes of the four catalytic pockets of hMCADwt and the p.K329E variant proteins were estimated during the simulation using the VOIDOO53 package, disregarding the cofactor and fatty-acyl substrate.


17

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 54

The FAD cofactor and C8-CoA substrate interactions with their respective protein’s binding sites were assessed by the g_contacts54 module added to the GROMACS program package. The relative free energies of binding (∆Gbind) for both the FAD cofactor and C8-CoA substrate were estimated using the g_mmpbsa55 program that links the GROMACS with the APBS56 software. The hydrogen bonds (HBs) properties [lifetime (τ), free energy of HB hydrogen bonding (∆GHB) and average number of HBs per timeframe (NHB)] were compute using the g_hbond57 available in the GROMACS package. The distances between the FAD cofactor, the C8-CoA substrate and any relevant protein residues within the catalytic pockets were calculated using the g_dist and g_mindist modules respectively. Visual inspections were performed with the VMD58 1.9.1 and MOE 2014.09 software.

3. RESULTS AND DISCUSSION 3.1 Experimental results 3.1.1 Impact of p.K329E mutation on the oligomeric profile. To assess the effect of the p.K329E mutation at the protein’s quaternary structural level, the oligomeric profile of hMCADwt and its p.K329E variant was determined by SEC. The results obtained are summarized in Table 1.

Table 1: Distribution of the oligomeric forms (%) obtained by SEC of recombinant hMCADwt and p.K329E variant proteins Aggregates

HMW

Tetramers

Dimers

Monomers

hMCADwt

1.57 ± 1.63

0.85±1.25

84.2±5.53

13.5±4.97

0.37±0.89

p.K329E

7.81 ± 3.50a

6.26±5.09

61.4±28.8

20.9±24.2

5.23±1.46b


18

Page 19 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Statistical significance determined using the Student unpaired t-test and comparing the variant and the wild-type forms of hMCAD, (a) p < 0.05 and (b) p < 0.005. The data represents the mean ± SD of 11 and four independent determinations performed in duplicate for hMCADwt and p.K329E proteins, respectively. Aggregates (Mr > 1000 kDa); High Molecular Weight Forms (HMW - Mr > 400 kDa); Tetramers (Mr ≈ 170 kDa); Dimers (Mr ≈ 90 kDa); Monomers (Mr > 40 kDa).

The data revealed a reduction of the tetrameric fraction for the p.K329E variant when compared with the hMCADwt followed by a substantial increase in the content of the monomeric forms. In addition, the content in aggregates and high molecular weight (HMW) forms was also higher in p.K329E than in hMCADwt while the dimeric fraction was only slightly elevated. These findings suggest that the p.K329E mutation affects the acquisition of the correct quaternary structure, possibly during the initial steps, compromising the assembly of the monomeric species as occurs in the homo-dimeric Spermine synthase, wherein the mutations affect dimer formation rather than monomer stability.59,60

3.1.2 Proteolytic stability of the recombinant proteins. Limited proteolysis by trypsin was used to evaluate the effect of the p.K329E mutation on the global conformation of the hMCAD (Figure 2). The data obtained showed that both proteins did not reach 50% of degradation during the maximum reaction time (60 min). However, the decay constant of proteolysis (kP) of the p.K329E (0.215 min-1) was higher than the one obtained for the wild-type protein (0.066 min-1) and the percentage of full-length protein after 30 min proteolysis (FL30min) of the hMCADwt (74.8%) was higher than the value obtained for the variant (56.1%) as already described in the literature.14


19

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 54

Figure 2: Representation of the degradation rate of the recombinant hMCADwt and p.K329E variant proteins after trypsin proteolysis. Data were fitted to a single exponential decay curve for determination of the decay constant of proteolysis (kP).

These results suggest that the p.K329E variant is less resistance to proteases than the hMCADwt, thus indicating a change in the overall conformation of the variant protein leading to a higher conformational flexibility and/or a more open structure.

3.1.3 Thermal stability of recombinant proteins. To study the possible effects of the p.K329E mutation in the thermal stability of hMCAD protein, the thermal denaturation profiles of both hMCADwt and p.K329E variant were assessed by DSF (Table 2). The denaturation profiles of both enzymes showed two transitions, allowing to calculate two Tms (Tm1 and Tm2; Table 2). These results suggest the existence of two structural domains within both proteins presenting different stabilities. Interestingly, the Tm1 of the p.K329E variant (43.4 ± 0.6 °C) was 2.4 °C lower than the Tm1 of the wild-type protein (45.8 ± 0.6 °C; p < 0.005). For Tm2 no changes were observed (50.3 ±0.3 and 50.8 ± 1.2°C for the hMCADwt and p.K329E, respectively).


20

Page 21 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Table 2: Melting temperature (Tm) (by DSF), temperature of aggregation (Tagg) and aggregation kinetics at 37°C and 42°C (by DLS) of recombinant hMCADwt and p.K329E variant proteins. DSF

DLS

Tm1 (°C)

Tm2(°C)

Tagg (°C)

tlag (37°C)

tlag (42°C)

hMCADwt

45.8 ± 0.6

50.3 ±0.3

39.6

9.0 min

4.1 min

p.K329E

43.4 ± 0.6

50.8 ± 1.2

36.3

4.0 min

1.9 min

The data from DSF represents the mean ± SD of four and three independent determinations for hMCADwt and p.K329E proteins, respectively; Tm1 – Tm value determined from the midpoint of the first temperature transition; Tm2 – Tm value determined from the midpoint of the second temperature transition. Tagg – temperature at which the proteins start to aggregate (obtained by ramping the temperature from 20-70°C); tlag – time at which the protein starts to aggregate. Tagg and tlag values represent the mean of two independent experiments performed in duplicate.

These data suggest that the change of a Lys by a Glu in residue 329 of MCAD confers a lower stability to a particular structural domain of the protein while the other remains relatively unaffected being less susceptible to thermal changes and maintaining a similar behavior to the one registered for the hMCADwt. In order to complement the structural studies and to assess the impact of the mutation in the temperature-dependent hMCAD stability, thermal aggregation profiles and aggregation kinetics for both hMCADwt and p.K329E variant proteins were determined by DLS (Table 2). The thermal aggregation profile showed that the p.K329E variant protein begins to aggregate at a lower temperature (Tagg ≈ 36°C) when compared with the wild-type form (Tagg ≈ 40°C). The data obtained from the aggregation kinetic assays additionally revealed that, at both physiological temperature (37°C) and at a temperature mimicking fever episodes (42°C), the p.K329E variant protein starts to aggregate earlier than the wild-type protein namely 5 min (37°C) and 2.2 min (42°C) .


21

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 54

3.1.4 Functional characterization of recombinant proteins. The effect of the structural changes induced by p.K329E mutation upon the hMCAD biological function was also evaluated. As shown in Table 3, when compared to the wild-type protein, the variant hMCAD showed a decrease in the specific enzyme activity (46% of residual activity), as previously reported.14,18 In addition, a lower Vmax (38% decrease) and a higher Km (lower affinity for the fatty-acyl substrate), resulting in a decrease in the catalytic efficiency of the p.K329E variant (34%) was also observed.

Table 3: Catalytic activity and kinetic parameters of recombinant hMCADwt and p.K329E variant proteins using C8-CoA as substrate. Enzymatic activity Specific enzymatic activity -1

-1

Kinetic parameters Residual activity

Vmax

Km

Kcat/Km

(µmol.min .mg )

(µM)

(µM-1.min-1)

1

-1

(µmol.min .mg )

(% )

hMCADwt

1.19 ± 0.47

100

1.86±0.16

2.8±1.2

29.1

p.K329E

0.53 ± 0.33

45.6± 27.8

0.70±0.02

3.1±0.5

9.92

Specific enzymatic activity was determined as a function of the variation of DCPIP concentration (µmol DCPIP.min-1.mg-1) using the hMCADwt and p.K329E variant tetrameric fractions; Residual activity of the p.K329E variant was calculated considering the activity of the hMCADwt protein as 100%; Data represent the mean ± SD of 11 and five independent determinations for hMCADwt and p.K329E proteins, respectively. The kinetic parameters were determined by assessing the enzymatic activity of hMCAD at increasing C8-CoA substrate concentration (0 100 µM). The data represent the mean ± SD of duplicates of two independent reactions. The kinetic parameters were obtained using a non-linear regression of the Michaelis-Menten equation. Kcat/Km represents the catalytic efficiency. Kcat was determined based upon the molecular mass of the recombinant hMCAD subunit (44.2 kDa).

3.2 Computational results 3.2.1 Analysis of protein stability Root mean square deviation (RMSD) and radius of gyration (Rg). Despite the increased tetramer instability of the p.K329E variant observed in the above experimental data, the precise


22

Page 23 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

mechanism on how the p.K329E mutation induces such behavior was still unclear. In order to gain further insights on the pathogenesis of MCADD caused by the p.K329E mutation, we applied a MD simulation protocol to both p.K329E and hMCADwt proteins and compared the evolution of both structures over the simulation time (100 ns). To that matter, the RMSD and the Rg of the tetrameric forms were monitored and plotted for both proteins in three different systems (Figure 3). Regarding the RMSD, and unlike the MD simulations of the hMCADwt, the introduction of the p.K329E mutation in the hMCAD structure induced larger deviations from the initial MD structure. Nonetheless, and despite the unstable behavior observed in the p.K329E variant during the simulations, both wild-type and p.K329E forms of hMCAD were considered to be stable after 60 ns of simulation time. On the other hand, the slight increase of the RMSD and Rg values observed in the variant protein (between 60 and 90 ns of simulation time; LIPID system), suggest a distinct event that partially affected the structure of the tetramer in a more localized manner. We anticipate that this event may be due to changes in the catalytic pocket architecture in the presence of the C8-CoA substrate (for additional details, please see section 3.2.2- Characterization of the catalytic pockets).


23

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 54

Figure 3: Root mean square deviation (RMSD) and radius of gyration (Rg) of hMCADwt20 and p.K329 variant MD simulations against the initial MD coordinates (PDB ID: 1EGC reverted): APO system (black), FAD system (red), and LIPID system (green).

Protein secondary structure assessment. In order to assess if the changes in the RMSD and Rg arised from structural alterations on the secondary structure of the p.K329E variant of hMCAD protein, its evolution in function of time was calculated applying the DSSP software and compared with the native hMCADwt. The data obtained revealed that the secondary structure of the variant protein remained stable in all simulations, with a mean of 50% of αhelices and 14% of β-sheets (against 53% (α-helices) and 14% (β-sheets) in the crystallographic


24

Page 25 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(PDB ID: 1EGC) and wild-type structures of hMCAD). Thus, the introduction of the p.K329E mutation in the hMCAD structure did not seem to affect significantly the secondary structure of the hMCAD protein as already observed by the circular dichroism spectra analysis.19

Principal Component Analysis. As no significant changes were found in the p.K329E secondary structure, and in order to infer about the stability of the tertiary (folding) and quaternary (assembly) structures of the variant hMCAD protein, the effect of the p.K329E mutation in the protein’s motions was assessed by a principal component analysis (PCA) using the ProDy software and compared with those observed in the wild-type form of hMCAD. As shown in Figure 4 [which represents the first principal component (PC1)] and in the mobility plots associated with the first four PCs (Figures S1A to S1D), different motion patterns in both wild-type and p.K329E forms of hMCAD protein were observed during the MD simulation in the presence of the FAD cofactor and the C8-CoA substrate (i.e. LIPID system). From the analysis of the first four principal components (PC) of the hMCADwt LIPID system it was possible to verify that all monomers showed smaller movements, which did not seem to affect the stability of the whole tetramer. While the protein core (at the dimer-dimer interface of the tetramer) was the most stable domain, some fluctuations could still be observed in domains located close to the protein surface, particularly in the β-domain (the more solvent-exposed motif in the tetramer). However, the observation of the same four PCs obtained from the LIPID system of the p.K329E variant showed a strikingly distinct behavior. While in PC1 distinct fluctuations between dimers were observed (dimers A/B vs. C/D, Figures 4 and S1A) that may explain the increased structural instability of the tetramer, the following PCs (PC2, PC3 and PC4, Figures


25

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 54

S1B to S1D), although much less intense than PC1, clearly displayed increased fluctuations within each monomer when compared with the corresponding ones for hMCADwt.

Figure 4: Representation of the protein ‘motions’ (PC1) observed in the hMCADwt and p.K329E variant proteins for the LIPID system. The green arrows represent the intensity and the


26

Page 27 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

dark arrows represent the rotational and translational protein’s motions. More flexible regions are represented in red. Figures were created with ProDy in VMD v1.9.1 from MD simulations.

Thus, and despite the deeply buried location of the mutation at the tetrameric core, the obtained data indicates that a single Lys→Glu substitution in this particular region does not have a direct impact in the nearby Glu304 residue (Glu329 of the precursor protein) but will induce a strong effect on the protein’s motion patterns of monomers A/B, mostly in the β-domain (the most solvent exposed motifs), that forms part of the catalytic pockets wall. These results also suggest that the p.K329E mutation affects the stability of the tetramer, probably due to charge-repulsion forces between the negatively charged residues located at the dimer-dimer interface2,12,13,17 (for additional details, please see section 1-Introduction). In addition, the p.K329E mutation also disturbs the structural organization of the binding pockets (monomers A/B), without a significant loss of the secondary structure in respect to the wild-type protein. Altogether these data are corroborated by the structural instability of the p.K329E variant observed experimentally, namely through an altered oligomeric profile with higher content of monomers, aggregates, HMW forms and dimers, when compared with the hMCADwt enzyme (Table 1). Nevertheless, it is noteworthy that a considerable percentage of tetramers were still observed, suggesting that despite structurally unstable, the tetramer was formed. Likewise, a lower resistance to trypsin proteolysis of the p.K329E variant, in respect to the hMCADwt, may indicate a higher conformational flexibility and/or a more open structure of the variant protein that may also contribute to tetramer’s instability.


27

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 54

Interestingly, these results were also corroborated by the data obtained from the root mean square fluctuation (RMSF) (Figures S2A and S2B) which showed that in the p.K329E variant the largest fluctuations were located in the β-domain (residues 180-200), the most solvent exposed motif in the tetramer. These data may explain the significant reduction in the p.K329E variant Tm1 observed in vitro with no changes in Tm2 (when comparing with hMCADwt). We hypothesize that the denaturation of the more unstable β-domain (monomers A/B) motifs may correspond to the existence of the first thermal transition state, while the denaturation of the most stable α-domains, may correspond to Tm2 value, which is not significantly destabilized by the mutation. It must be emphasized that our results corroborate previous data obtained by Jank et al.,19 who hypothesized that the unfolding of the β-domain would correlate with a lowtemperature transition.

3.2.2 Characterization of the catalytic pockets. Structural changes in monomer´s folding and dimerization, as well as tetramer misassembling, may also impair a correct binding of the cofactor and/or the C8-CoA substrate to the binding cavities or even disrupt the formation of the catalytic pockets, ultimately affecting MCAD function. Thus, it was imperative to also assess the structural and dynamic functions of the catalytic pockets of the p.K329E variant versus the hMCADwt in order to better understand if the p.K329E mutation may indirectly affect the hMCAD enzymatic function in a more specific manner. Catalytic pockets volume. One of the properties of the catalytic pockets that can be directly changed by mutations or by impairment of the tetramer assembly is their internal volume. An estimation of the changes of these volumes along the MD simulations was performed with the


28

Page 29 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

VOIDOO package. The probability distribution P(V) of the mean volumes of the four catalytic pockets in both proteins was plotted for all systems tested (APO, FAD and LIPID) (Figure S3). A comparison between all MD simulated systems of hMCADwt protein showed that the presence of the FAD cofactor alone (FAD system) or the presence of both FAD and C8-CoA substrate (LIPID system) induced the formation of cavities with larger volumes (80% of the volumes within 235-740 Å3 and 290-650 Å3, respectively), while a collapse of the catalytic pockets was observed in the absence of any ligands (APO system (80% of the volumes within 90-290 Å3)). However, when comparing each MD system of p.K329E variant, and unlike it was observed for the hMCADwt protein, the results pointed out that in the case of the variant protein, no significant difference existed between the volumes registered in the absence (80% of volumes within 110-310 Å3) or in the presence of the FAD cofactor (80% of volumes within 195-530 Å3). Thus, the presence of the FAD cofactor, previously reported as crucial for the enzyme´s structure,1,2 did not seem to reverse any pocket structural modifications induced by the p.K329E mutation. Nonetheless, in the presence of the C8-CoA substrate, the volumes of the catalytic pockets of the p.K329E variant were shifted to higher values (80% of volumes within 390-830 Å3) than those observed in the hMCADwt, suggesting that the substrate binding may induce deep changes in the pocket architecture. FAD cofactor and C8-CoA substrate binding regions. According to the crystallographic data, the hMCAD catalytic pockets are mainly formed by residues from both monomers of the same dimer.2,4,27 The FAD cofactor has an extended conformation that enables the formation of hydrogen bonds (HBs) with residues from the neighboring monomer of the dimer, namely with Arg281, Ile350, Gly353 and Asn354.2 In order to assess the effect of the p.K329E mutation in the HB network, the HBs properties (see section 2.2.3 Analysis of the MD trajectories) were


29

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 54

calculated for both FAD and LIPID systems and further compared with the respective MD systems of the hMCADwt protein (Table S1 and Table S2). The g_bond program calculates HB lifetimes by using a binary function h(t) that is 1 when any HB is present or 0 when absent. Accordingly, the Gibbs free energy of hydrogen bonding (∆GHB) can be obtained from the HB lifetime, calculated as the inverse of an HB breakage constant (described as an Eyring process), obtained from an autocorrelation function that takes into account the probability for a HB to break. A more detailed description of the method is available in the literature.57,61,62 Overall, in the hMCADwt an increase in the average number of HBs per timeframe (NHB) was observed, along with more favorable energies of hydrogen bonding (∆GHB), between the FAD and the protein’s residues in the presence of the C8-CoA substrate (LIPID system). These findings suggest that the presence of the acyl-CoA substrate reinforces the HB network between the FAD of one monomer and the residues from the neighboring monomer, ultimately contributing to increase the dimer cohesion as already observed in the orthologue SCAD protein (wherein substrates play an important role in the stabilization of the mitochondrial acyl-CoA dehydrogenases including the hMCAD protein).63 In the case of the p.K329E variant, the dramatic reduction of the HB interactions between the FAD and the adjacent monomer of the dimer, observed in both FAD and LIPID systems, may compromise the cohesion between the two monomers of the dimer. Moreover, lower contact frequencies (calculated by g_contacts) and a reduction in the number of residues that interact with FAD within the catalytic pockets were observed in the variant protein for both FAD and LIPID systems, when compared with the wild-type form of hMCAD (Tables S3 to S6). These results are supported by a decrease of the FAD binding affinity (> ∆Gbind) observed in the p.K329E variant for both FAD and LIPID systems (Table 4).


30

Page 31 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Table 4: Mean values of relative free energy of binding (∆Gbind) in kJ mol-1 (calculated by g_mmpbsa) for the FAD cofactor in the FAD and LIPID systems of hMCADwt and p.K329E variant proteins. ∆Gbind (kJ mol-1) FAD system

LIPID system

hMCADwt

-844 ± 89

-1016 ± 73

p.K329E

-663± 87

-852 ± 80

The data represents the mean ± SD values of the four monomers of both hMCADwt and p.K329E variant proteins.

Interestingly, when the ∆Gbind for the cofactor and the acyl-CoA substrate were calculated for each monomer (Figure 5 and Table S7) of the p.K329E variant in the LIPID system, the loss of binding affinity of FAD and C8-CoA was more evident in monomers A and B (not observed for the FAD in the FAD system).


31

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 54

Figure 5: Relative free energy of binding (∆Gbind) in kJ.mol-1 for the FAD cofactor and C8-CoA substrate in each monomer (A, B, C, D) of hMCADwt and p.K329E variant proteins, in the LIPID system. The mean ∆Gbind values of the four monomers are represent by the dotted lines.

A visual inspection of the positions of both FAD and C8-CoA within the catalytic pockets of the hMCADwt and the p.K329E variant proteins showed that, in the FAD system, the FAD molecule was still able to maintain the HB network with the protein‘s residues in p.K329E variant as observed in the hMCADwt protein. However, in the presence of the C8-CoA substrate (LIPID system) and unlike the wild-type form of hMCAD, in the p.K329E variant the FAD cofactor mainly establishes HBs with the protein through its phosphate moiety (Figure S4). As the cofactor was never found to leave the binding pocket in all systems, we propose that the HB interactions involving the phosphate moiety are the most important for anchoring FAD into the catalytic pocket. Surprisingly, a direct observation of the four catalytic pockets of the p.K329E revealed that three distinct events occurred within the 100 ns of simulation time in the LIPID system (but not in the FAD system) (Figure 6 and Table S8).


32

Page 33 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 6: Catalytic pockets architecture in the p.K329E variant for the LIPID system (left panel) and the respectively schematic representation of the C8-CoA substrate non-bonded interactions with the protein’s residues lining each catalytic pocket (see also Table S9). The arrows represent HBs between the C8-CoA substrate and protein’s residues: HBs with the backbone’s residues (blue) and HBs with side-chain’s residues (green). Salt bridges are represented as purple lines. The residues numbering correspond to the mature form of hMCAD protein. Figures were created with MOE v2014.09 from MD simulation of the LIPID system.


33

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 54

Our results suggest that the binding pocket remained structurally unaffected in monomers C and D. However, while for monomer D the relative positions of both FAD cofactor and C8-CoA substrate were maintained as observed in hMCADwt (Figure S5A), in monomer C the acyl-CoA substrate was found outside the pocket, bound to protein surface and occupying an upper location, forcing the cofactor to acquire a deeper position and a more packed conformation (Figure S5B). The acyl-CoA substrate displacement turned the main interactions of the protein residues lining the catalytic pocket towards the 3’-phosphadenosine group of the C8-CoA substrate instead of its phosphate moiety (Figure 6). This was not observed in the wild-type form of the hMCAD where the interactions involving its phosphate moiety were the ones that major contributed to anchor the acyl-CoA substrate to the protein (Figure S6 and Table S9). Moreover, the displacement of the C8-CoA substrate in the p.K329E variant induced misalignments between the carboxylate group of the catalytic residue Glu376 (of the mature protein), the flavin ring of FAD cofactor and the terminal acyl group of the fatty-acyl substrate, essential to the enzymatic reaction (Figures S5B and S5C).2,64 Finally, in the case of monomers A and B, a severe structural disruption of the pocket was observed due to a disruption of its wall, exposing the flavin ring of the cofactor and the terminal acyl-chain of the fatty-acyl substrate to a more polar environment (Figure S5C). In the monomers where the catalytic pockets maintained their structure (monomers C and D), it should still be possible for the C8-CoA substrate to acquire a favorable position inside the pocket, thus facilitating the catalysis of the α,β-dehydrogenation reaction. However, the structural disruption of the catalytic pockets observed for the monomers A and B will be enough to affect the enzymatic reaction due to: i) the exposure of a large portion of the cofactor and/or the acyl-CoA substrate to the polar water environment, which may reduce the catalytic residue


34

Page 35 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Glu376 (mature protein) desolvation, thus decreasing its pKa to a value that precludes proton removal from the acyl-CoA substrate30; ii) the impairment of the correct binding of the C8-CoA substrate and to the increment to non-optimal values of the distances between the flavin ring, the Cα-Cβ bond of the substrate and the catalytic residue (Figure S5C); iii) the incorrect coupling of the FAD cofactor, which may impair the electron transfer to the ETF protein. Overall, the reduction of the specific enzymatic activity and catalytic efficiency observed for the variant protein could be explained by alterations on the protein’s motions patterns, that ultimately affect the catalytic pockets. However, the p.K329E mutation seems to only affect one of the dimers (monomers A/B) of the tetramer having a stronger impact in the respective catalytic pockets architecture and in the FAD and C8-CoA binding affinities. This data may explain why the p.K329E variant still retained about 46% of its residual activity. We propose that the unaffected catalytic pockets of the neighboring dimer (monomers C/D) were still able to accommodate and dehydrogenate the substrate (although with a lower Vmax than the hMCADwt).

4. CONCLUSIONS The studies herein presented allowed the establishment of a direct relation between the obtained experimental and computational data. The abnormal oligomeric profile found in vitro for the p.K329E variant, as well as its lower resistance to limited proteolysis and earlier denaturation and aggregation, when compared with the wild-type form of hMCAD, were corroborated by the structural instability of the variant protein observed in the in silico studies. From the analysis of the APO, FAD and LIPID systems it was also possible inferring that the acyl-CoA substrate induced tetramer instability and structural changes in the catalytic pockets of the p.K329E variant protein affecting its enzymatic activity (46% residual activity).


35

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 54

Altogether, the data obtained allowed the characterization and validation of in vitro and in silico models of the p.K329E variant. With these models now characterized we are in position to go forward to drug design studies which will contribute to the discovery and development of compounds that may constitute potential pharmacological strategies for the treatment of MCAD deficiency.

ASSOCIATED CONTENT Supporting Information. “Schematic representation of the α,β-dehydrogenation hMCAD reaction mechanism; mobility plots for each active mode (PC1, PC2, PC3, PC4) in both hMCADwt and p.K329E variant proteins (LIPID system); chart representing the root mean square fluctuation (RMSF) values obtained for the wild-type and p.K329E variant proteins (APO, FAD;, LIPID); chart representing the Probability distribution function P(V) of the average volumes of the catalytic pockets in both wild-type and p.K329E variant proteins; schematic representation of the FAD HBs interactions with the protein’s residues lining the catalytic pockets of hMCADwt and p.K329E variant proteins (LIPID system); schematic representation of the C8-CoA substrate HBs interactions with the protein’s residues lining the catalytic pockets of hMCADwt.; tables listing the HBs between the FAD of one monomer and the neighboring monomer of the dimer unit in the hMCADwt protein (FAD and LIPID systems); tables listing the contacts between the FAD and the protein’s residues of the catalytic pockets in both hMCADwt and its p.K329E variant proteins; tables containing the contacts between the C8-CoA substrate and the protein’s residues of the binding cavities of both proteins. Tables containing the free energy of binding (∆Gbind) values for the FAD cofactor and C8-CoA substrate in each monomer of the p.K329E variant, in the LIPID system. Representation of the relative positions


36

Page 37 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

of the FAD cofactor, the C8-CoA substrate and the catalytic residue Glu376 found in each monomer of p.K329E variant. This material is available free of charge via the Internet at http://pubs.acs.org.” AUTHOR INFORMATION

Corresponding Authors * Rita C. Guedes ([email protected]) * Fátima V. Ventura ([email protected]) Present Addresses Faculty of Pharmacy, Universidade de Lisboa, Av. Prof. Gama Pinto, 1649-003 Lisboa, Portugal Cátia A. Bonito - REQUIMTE, Department of Chemistry & Biochemistry, Faculty of Sciences, University of Porto, Porto, Portugal Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Funding Sources Part of this work was financially supported by iMed.ULisboa (UID/DTP/04138/2013) from Fundação para a Ciência e Tecnologia (FCT), Lisboa, Portugal. Notes: The authors have no conflict of interests to declare.


37

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 54

ACKNOWLEDGMENTS The authors would like to thank Andreia Luz, Francisca Lopes, Margarida Pissarra, Nĕza Palir, and Paulo Roque Lino, from the Department of Biochemistry and Human Biology, Metabolism and Genetics Group, iMed.ULisboa, Faculty of Pharmacy, Universidade de Lisboa, for all the contributions to the gathering of the experimental data herein reported. The authors also gratefully acknowledge Ricardo J. Ferreira, M.Sc of the Natural Products Chemistry group, Department of Pharmaceutical Chemistry and Therapeutics, iMed.ULisboa, Faculty of Pharmacy, Universidade de Lisboa, for his valuable suggestions throughout the development of the computational studies herein presented. REFERENCES (1) Gregersen, N., Andresen, B. S., Pedersen, C. B., Olsen, R. K. J., Corydon, T. J., and Bross, P. (2008) Mitochondrial fatty acid oxidation defects—remaining challenges. J. Inherit. Metab. Dis. 31, 643–657. (2) Kim, J. J., Wang, M., and Paschke, R. (1993) Crystal structures of medium-chain acyl-CoA dehydrogenase from pig liver mitochondria with and without substrate. Proc. Natl. Acad. Sci. U. S. A. 90, 7523–7527. (3) Kim, J.-J. P., and Miura, R. (2004) Acyl-CoA dehydrogenases and acyl-CoA oxidases. Structural basis for mechanistic similarities and differences. Eur. J. Biochem. 271, 483–493. (4) Satoh, A., Nakajima, Y., Miyahara, I., Hirotsu, K., Tanaka, T., Nishina, Y., Shiga, K., Tamaoki, H., Setoyama, C., and Miura, R. (2003) Structure of the transition state analog of


38

Page 39 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

medium-chain acyl-CoA dehydrogenase. Crystallographic and molecular orbital studies on the charge-transfer complex of medium-chain acyl-CoA dehydrogenase with 3-thiaoctanoyl-CoA. J. Biochem. 134, 297–304. (5) Waddell, L., Wiley, V., Carpenter, K., Bennetts, B., Angel, L., Andresen, B. S., and Wilcken, B. (2006) Medium-chain acyl-CoA dehydrogenase deficiency: Genotype–biochemical phenotype correlations. Mol. Genet. Metab. 87, 32–39. (6) Schatz, U. A., and Ensenauer, R. (2010) The clinical manifestation of MCAD deficiency: challenges towards adulthood in the screened population. J. Inherit. Metab. Dis. 33, 513–520. (7) Ventura, F. V., Leandro, P., Luz, A., Rivera, I. A., Silva, M. F. B., Ramos, R., Rocha, H., Lopes, A., Fonseca, H., Gaspar, A., Diogo, L., Martins, E., Leão-Teles, E., Vilarinho, L., and Tavares de Almeida, I. (2014) Retrospective study of the medium-chain acyl-CoA dehydrogenase deficiency in Portugal. Clin. Genet. 85, 555–561. (8) Houten, S. M., Violante, S., Ventura, F. V., and Wanders, R. J. A. (2016) The Biochemistry and Physiology of Mitochondrial Fatty Acid β-Oxidation and Its Genetic Disorders. Annu. Rev. Physiol. 78, 23–44. (9) Rhead, W. J. (2006) Newborn screening for medium-chain acyl-CoA dehydrogenase deficiency: A global perspective. J. Inherit. Metab. Dis. 29, 370–377. (10) Andresen, B. S., Lund, A. M., Hougaard, D. M., Christensen, E., Gahrn, B., Christensen, M., Bross, P., Vested, A., Simonsen, H., Skogstrand, K., Olpin, S., Brandt, N. J., Skovby, F., Nørgaard-Pedersen, B., and Gregersen, N. (2012) MCAD deficiency in Denmark. Mol. Genet. Metab. 106, 175–188.


39

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 54

(11) Matern, D., and Rinaldo, P. (2015) Medium-Chain Acyl-Coenzyme A Dehydrogenase Deficiency, in Gene Reviews (Pagon, R., Bird, T., and Dolan, C., Eds.). University of Washington, Seattle. (12) Bross, P., Jespersen, C., Jensen, T. G., Andresen, B. S., Kristensen, M. J., Winter, V., Nandy, A., Kräutle, F., Ghisla, S., and Bolundi, L. (1995) Effects of two mutations detected in medium chain acyl-CoA dehydrogenase (MCAD)-deficient patients on folding, oligomer assembly, and stability of MCAD enzyme. J. Biol. Chem. 270, 10284–10290. (13) Bross, P., Andersen, B. A., Winter, V., Kräutle, F., Jensen, T. G., Nandy, A., Kølvraa, S., Ghisla, S., Bolund, L., and Gregersen, N. (1993) Co-overexpression of bacterial GroESL chaperonins partly overcomes non-productive folding and tetramer assembly of E. coli-expressed human medium-chain acyl-CoA dehydrogenase (MCAD) carrying the prevalent disease-causing K304E mutation. Biochim. Biophys. Acta - Mol. Basis Dis. 1182, 264–274. (14) Maier, E. M., Gersting, S. W., Kemter, K. F., Jank, J. M., Reindl, M., Messing, D. D., Truger, M. S., Sommerhoff, C. P., and Muntau, A. C. (2009) Protein misfolding is the molecular mechanism underlying MCADD identified in newborn screening. Hum. Mol. Genet. 18, 1612– 1623. (15) Grosse, S. D., Khoury, M. J., Greene, C. L., Crider, K. S., and Pollitt, R. J. (2006) The epidemiology of medium chain acyl-CoA dehydrogenase deficiency: an update. Genet. Med. 8, 205–212. (16) Bross, P., Jensen, T. G., Andresen, B. S., Kjeldsen, M., Nandy, A., Kolvraa, S., Ghisla, S., Rasched, I., Bolund, L., and Gregersen, N. (1994) Characterization of Wild-Type Human Medium-Chain Acyl-CoA Dehydrogenase (MCAD) and Mutant Enzymes Present in MCAD-


40

Page 41 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Deficient Patients by Two-Dimensional Gel Electrophoresis: Evidence for Posttranslational Modification of the Enzyme. Biochem. Med. Metab. Biol. 52, 36–44. (17) Koster, K.-L., Sturm, M., Herebian, D., Smits, S. H. J., and Spiekerkoetter, U. (2014) Functional studies of 18 heterologously expressed medium-chain acyl-CoA dehydrogenase (MCAD) variants. J. Inherit. Metab. Dis. 37, 917–928. (18) Kieweg, V., Krautle, F.-G., Nandy, A., Engst, S., Vock, P., Abdel-Ghany, A.-G., Bross, P., Gregersen, N., Rasched, I., Strauss, A., and Ghisla, S. (1997) Biochemical Characterization of Purified, Human Recombinant Lys304Glu Medium-Chain Acyl-Coa Dehydrogenase Containing the Common Disease-Causing Mutation and Comparison with the Normal Enzyme. Eur. J. Biochem. 246, 548–556. (19) Jank, J. M., Maier, E. M., Reiß, D. D., Haslbeck, M., Kemter, K. F., Truger, M. S., Sommerhoff, C. P., Ferdinandusse, S., Wanders, R. J., Gersting, S. W., and Muntau, A. C. (2014) The Domain-Specific and Temperature-Dependent Protein Misfolding Phenotype of Variant

Medium-Chain

acyl-CoA

Dehydrogenase.

PLoS

One

9,

e93852;

doi:

10.1371/journal.pone.0093852. (20) Bonito, C. A., Leandro, P., Ventura, F. V., and Guedes, R. C. (2016) Insights into Mediumchain acyl-CoA dehydrogenase structure by Molecular Dynamics simulations. Chem. Biol. Drug Des. 88, 281-292. (21) Zeng, J., and Li, D. (2004) Expression and purification of His-tagged rat mitochondrial medium-chain acyl-CoA dehydrogenase wild-type and Arg256 mutant proteins. Protein Expr. Purif. 37, 472–478.


41

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 42 of 54

(22) Bradford, M. (1976) A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 72, 248– 254. (23) Tayyab, S., Qamar, S., and Islam, M. (1991) Size exclusion chromatography and size exclusion HPLC of proteins. Biochem. Educ. 19, 149–152. (24) Matulis, D., Kranz, J. K., Salemme, F. R., and Todd, M. J. (2005) Thermodynamic Stability of Carbonic Anhydrase: Measurements of Binding Affinity and Stoichiometry Using ThermoFluor. Biochemistry 44, 5258–5266. (25) Niesen, F. H., Berglund, H., and Vedadi, M. (2007) The use of differential scanning fluorimetry to detect ligand interactions that promote protein stability. Nat. Protoc. 2, 2212– 2221. (26) Golub, N. V, Markossian, K. a, Sholukh, M. V, Muranov, K. O., and Kurganov, B. I. (2009) Study of kinetics of thermal aggregation of mitochondrial aspartate aminotransferase by dynamic light scattering: protective effect of α-crystallin. Eur. Biophys. J. 38, 547–556. (27) Lee, H.-J. K., Wang, M., Paschke, R., Nandy, A., Ghisla, S., and Kim, J.-J. P. (1996) Crystal Structures of the Wild Type and the Glu376Gly/Thr255Glu Mutant of Human MediumChain Acyl-CoA Dehydrogenase: Influence of the Location of the Catalytic Base on Substrate Specificity. Biochemistry 35, 12412–12420. (28) Molecular Operating Environment (MOE), 2014.09; Chemical Computing Group Inc., 1010 Sherbooke St. West, Suite #910, Montreal, QC, Canada, H3A 2R7, 2016. (29) Bonvin, A. M., Mark, A. E., and van Gunsteren, W. F. (2000) The GROMOS96


42

Page 43 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

benchmarks for molecular simulation. Comput. Phys. Commun. 128, 550–557. (30) Scott, W. R., Hünenberger, P. H., Tironi, I. G., Mark, A. E., Billeter, S. R., Fennen, J., Torda, A. E., Huber, T., Krüger, P., and van Gunsteren, W. F. (1999) The GROMOS Biomolecular Simulation Program Package. J. Phys. Chem. A. 103, 3596–3607. (31) Oostenbrink, C., Villa, A., Mark, A. E., and van Gunsteren, W. F. (2004) A biomolecular force field based on the free enthalpy of hydration and solvation: the GROMOS force-field parameter sets 53A5 and 53A6. J. Comput. Chem. 25, 1656–1676. (32) Berendsen, H. J., van der Spoel, D., and van Drunen, R. (1995) GROMACS: A messagepassing parallel molecular dynamics implementation. Comput. Phys. Commun. 91, 43–56. (33) Lindahl, E., Hess, B., and van der Spoel, D. (2001) GROMACS 3.0: a package for molecular simulation and trajectory analysis. J. Mol. Model. 7, 306–317. (34) Hess, B., Kutzner, C., van der Spoel, D., and Lindahl, E. (2008) GROMACS 4: Algorithms for Highly Efficient, Load-Balanced, and Scalable Molecular Simulation. J. Chem. Theory Comput. 4, 435–447. (35) Van Der Spoel, D., Lindahl, E., Hess, B., Groenhof, G., Mark, A. E., and Berendsen, H. J. (2005) GROMACS: fast, flexible, and free. J. Comput. Chem. 26, 1701–1718. (36) Malde, A. K., Zuo, L., Breeze, M., Stroet, M., Poger, D., Nair, P. C., Oostenbrink, C., and Mark, A. E. (2011) An Automated Force Field Topology Builder (ATB) and Repository: Version 1.0. J. Chem. Theory Comput. 7, 4026–4037. (37) Koziara, K. B., Stroet, M., Malde, A. K., and Mark, A. E. (2014) Testing and validation of the Automated Topology Builder (ATB) version 2.0: prediction of hydration free enthalpies. J.


43

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 44 of 54

Comput. Aided Mol. Des. 28, 221–233. (38) Schüttelkopf, A. W.; van Aalten, D. M. (2004) PRODRG: a tool for high-throughput crystallography of protein-ligand complexes. Acta Cryst. 60, 1355–1363. (39) Berendsen, H. J. C., Postma, J. P. M., van Gunsteren, W. F., and Hermans, J. (1981) Interaction Models for Water in Relation to Protein Hydration, in Intermolecular Forces (Pullman, B., Ed.), pp 331–342. Springer Netherlands, Dordrecht. (40) Bussi, G., Donadio, D., and Parrinello, M. (2007) Canonical sampling through velocity rescaling. J. Chem. Phys. 126, 14101–14107. (41) Hoover, W. (1985) Canonical dynamics: Equilibrium phase-space distributions. Phys. Rev. A. 31, 1695–1697. (42) Nosé, S., and Klein, M. L. (1983) Constant pressure molecular dynamics for molecular systems. Mol. Phys. 50, 1055–1076. (43) Parrinello, M.; Rahman, A. (1981) Polymorphic transitions in single crystals: A new molecular dynamics method. J. Appl. Phys. 52, 7182–7190. (44) Hess, B., Bekker, H., Berendsen, H. J., and Fraaije, J. G. E. M. (1997) LINCS: A linear constraint solver for molecular simulations. J. Comput. Chem. 18, 1463–1472. (45) Hess, B. (2008) P-LINCS: A Parallel Linear Constraint Solver for Molecular Simulation. J. Chem. Theory Comput. 4, 116–122. (46) Miyamoto, S., and Kollman, P. A. (1992) Settle: An analytical version of the SHAKE and RATTLE algorithm for rigid water models. J. Comput. Chem. 13, 952–962.


44

Page 45 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(47) Darden, T., York, D., and Pedersen, L. (1993) Particle mesh Ewald: An N⋅log(N) method for Ewald sums in large systems. J. Chem. Phys. 98, 10089–10092. (48) Essmann, U., Perera, L., Berkowitz, M. L., Darden, T., Lee, H., and Pedersen, L. G. (1995) A smooth particle mesh Ewald method. J. Chem. Phys. 103, 8577–8593. (49) Touw, W. G., Baakman, C., Black, J., Te Beek, T. A. H., Krieger, E., Joosten, R. P., and Vriend, G. (2015) A series of PDB-related databanks for everyday needs. Nucleic Acids Res. 43, D364–D368. (50) Kabsch, W., and Sander, C. (1983) Dictionary of protein secondary structure: Pattern recognition of hydrogen-bonded and geometrical features. Biopolymers 22, 2577–2637. (51) Bakan, A., Meireles, L. M., and Bahar, I. (2011) ProDy: protein dynamics inferred from theory and experiments. Bioinformatics 27, 1575–1577. (52) Bahar, I., Lezon, T. R., Bakan, A., and Shrivastava, I. H. (2010) Normal mode analysis of biomolecular structures: functional mechanisms of membrane proteins. Chem. Rev. 110, 1463– 1497. (53) Kleywegt, G. J., and Jones, T. a. (1994) Detection, delineation, measurement and display of cavities in macromolecular structures. Acta Crystallogr. Sect. D Biol. Crystallogr. 50, 178–185. (54) Blau, C., and Grubmuller, H. (2013) g_contacts: Fast contact search in bio-molecular ensemble data. Comput. Phys. Commun. 184, 2856–2859. (55) Kumari, R., Kumar, R., and Lynn, A. (2014) g_mmpbsa —A GROMACS Tool for HighThroughput MM-PBSA Calculations. J. Chem. Inf. Model. 54, 1951–1962.


45

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 46 of 54

(56) Baker, N. A., Sept, D., Joseph, S., Holst, M. J., and McCammon, J. A. (2001) Electrostatics of nanosystems: application to microtubules and the ribosome. Proc. Natl. Acad. Sci. U. S. A. 98, 10037–10041. (57) van der Spoel, D., van Maaren, P. J., Larsson, P., and Tîmneanu, N. N. (2006) Thermodynamics of Hydrogen Bonding in Hydrophilic and Hydrophobic Media. J. Phys. Chem. B. 110, 4393–4398. (58) Humphrey, W., Dalke, A., and Schulten, K. (1996) VMD: visual molecular dynamics. J. Mol. Graph. 14, 33–38. (59) Peng, Y., Norris, J., Schwartz, C., and Alexov, E. (2016) Revealing the Effects of Missense Mutations Causing Snyder-Robinson Syndrome on the Stability and Dimerization of Spermine Synthase. Int. J. Mol. Sci. 17, 77; doi:10.3390/ijms17010077. (60) Zhang, Z., Teng, S., Wang, L., Schwartz, C. E., and Alexov, E. (2010) Computational analysis of missense mutations causing Snyder-Robinson syndrome. Hum. Mutat. 31, 1043– 1049. (61) Luzar, A. (2000) Resolving the hydrogen bond dynamics conundrum. J. Chem. Phys. 113, 10663–10675. (62) Luzar, A., and Chandler, D. (1996) Hydrogen-bond kinetics in liquid water. Nature 379, 55–57. (63) Lucas, T. G., Henriques, B. J., Rodrigues, J. V, Bross, P., Gregersen, N., and Gomes, C. M. (2011) Cofactors and metabolites as potential stabilizers of mitochondrial acyl-CoA dehydrogenases. Biochim. Biophys. Acta 1812, 1658–1663.


46

Page 47 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(64) Garcia-Viloca, M., Poulsen, T. D., Truhlar, D. G., and Gao, J. (2004) Sensitivity of molecular dynamics simulations to the choice of the X-ray structure used to model an enzymatic reaction. Protein Sci. 13, 2341–2354.


47

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1: Structural representation of hMCAD wild-type monomer (upper panel) and tetramer (lower panel) with location of FAD cofactor (gray) and octanoyl-CoA (C8-CoA) substrate (green); the tetramer is considered a dimer of dimers (formed by monomers A/B and C/D). Figures were created with MOE v2014.09 from PDB ID: 1EGC. 113x169mm (300 x 300 DPI)


Page 48 of 54

Page 49 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Representation of the degradation rate of the recombinant hMCADwt and p.K329E variant proteins after trypsin proteolysis. Data were fitted to a single exponential decay curve for determination of the decay constant of proteolysis (kP). 73x51mm (300 x 300 DPI)


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Root mean square deviation (RMSD) and radius of gyration (Rg) of hMCADwt20 and p.K329 variant MD simulations against the initial MD coordinates (PDB ID: 1EGC reverted): APO system (black), FAD system (red), and LIPID system (green). 211x157mm (300 x 300 DPI)


Page 50 of 54

Page 51 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Representation of the protein ‘motions’ (PC1) observed in the hMCADwt and p.K329E variant proteins for the LIPID system. The green arrows represent the intensity and the dark arrows represent the rotational and translational protein’s motions. More flexible regions are represented in red. Figures were created with ProDy in VMD v1.9.1 from MD simulations. 158x296mm (300 x 300 DPI)


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Relative free energy of binding (∆Gbind) in kJ.mol-1 for the FAD cofactor and C8-CoA substrate in each monomer (A, B, C, D) of hMCADwt and p.K329E variant proteins, in the LIPID system. The mean ∆Gbind values of the four monomers are represent by the dotted lines. 159x169mm (300 x 300 DPI)


Page 52 of 54

Page 53 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Catalytic pockets architecture in the p.K329E variant for the LIPID system (left panel) and the respectively schematic representation of the C8-CoA substrate non-bonded interactions with the protein’s residues lining each catalytic pocket (see also Table S9). The arrows represent HBs between the C8-CoA substrate and protein’s residues: HBs with the backbone’s residues (blue) and HBs with side-chain’s residues (green). Salt bridges are represented as purple lines. The residues numbering correspond to the mature form of hMCAD protein. Figures were created with MOE v2014.09 from MD simulation of the LIPID system. 141x177mm (300 x 300 DPI)


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

For Table of Contents use only. Our results showed that p.K329E variant is structurally unstable in respect to the wild-type form of hMCAD protein. Moreover, p.K329E variant holds structural modifications in the catalytic pockets that ultimately affect its enzymatic activity. 88x42mm (300 x 300 DPI)


Page 54 of 54

Unveiling the Pathogenic Molecular Mechanisms of the Most Common

Recommend Documents