Utility of Stable Isotope and Cytochrome Oxidase I Gene Sequencing

Article pubs.acs.org/JAFC

Utility of Stable Isotope and Cytochrome Oxidase I Gene Sequencing Analyses in Inferring Origin and Authentication of Hairtail Fish and Shrimp Heejoong Kim,†,⊥ K. Suresh Kumar,†,⊥ Seung Yong Hwang,‡,§ Byeong-Chul Kang,∥ Hyo-Bang Moon,† and Kyung-Hoon Shin*,† †

Department of Marine Sciences and Convergent Technology and ‡Department of Molecular and Life Science/Bio-nanotechnology, Hanyang University, Ansan 426-791, Republic of Korea § Biocore Company Limited, Guro-gu, Seoul 152-796, Republic of Korea ∥ Insilicogen Incorporated, Gweonseon-gu, Suwon 440-825, Republic of Korea ABSTRACT: Mislabeling of fishery products continues to be a serious threat to the global market. Consequently, there is an urgent necessity to develop tools for authenticating and establishing their true origin. This investigation evaluates the suitability of stable isotopes and cytochrome oxidase I (COI) sequencing in identifying and tracing the origin of hairtail fish and shrimp. By use of COI sequencing, the hairtail fish samples were identified as Trichiurus japonicus and Trichiurus lepturus, while the shrimp samples were identified as Pandalus borealis, Marsupenaeus japonicus, Fenneropenaeus chinensis, Litopenaeus vannamei, Penaeus monodon, and Solenocera crassicornis. Linear discriminant analysis (LDA) of stable isotopes further categorized the individuals of the same species based on the country of origin. Natural and farmed shrimp (from the same country) were distinctly differentiated on the basis of stable isotope values. Therefore, these two methods could be cooperatively utilized to identify and authenticate fishery products, the utilization of which would enhance transparency and fair trade. KEYWORDS: fish, shrimp, δ13C, δ15N, COI sequencing, geographic origin, species identification

■

INTRODUCTION Fishery products are among the chief internationally traded food commodities.1 They improve nutrition, health, and wellbeing2 and, are a prime source of ω-3 fatty acids, vitamins, minerals, trace elements, high-quality protein, and essential amino acids. Acceleration and diversification of transport (especially maritime traffic), increased seafood trade and consumption, and, greater demand for certain types of fish or seafood have globalized the fisheries trade. However, concomitant fluctuations in supply and inability to meet the phenomenal demand have encouraged fraudulent practices of substitution. As a huge number of fishery species are either consumed or utilized as raw material for different marketed preparations, authentication (of species and its origin) becomes quintessential for confronting deceptive practices. Accurate labeling of fishery products would deter commercial fraud and prevent potential safety hazards caused by the introduction of food ingredients that might be harmful to human health. Fishery products represent a significant market niche: they include a wide variety of commercially valuable species such as hairtail fish (belonging to the family Trichiuridae) and shrimp (belonging to the superfamily Penaeoidae). The hairtail comprises the sixth most important captured fish species, with their present world catch exceeding 1.5 million tons annually.3 On the other hand, shrimp (either harvested by extractive fishing or farmed in aquaculture facilities) account for more than 30% of the worldwide demand of crustacean species.4 Traditional identification and authentication of fish and penaeid shrimps are carried out by examining morphological features (such as body shape, color, size, fins, and other © 2015 American Chemical Society

body parts). In the case of similar species, it is necessary to consider some internal organs such as gill rakers or otoliths. However, when the external anatomical parts are not present (e.g., in the case of fish sold in parts), this is a rather complex or even impossible task. Additionally, phenotypic similarities among fish complicate species identification and determination of their origin. Shrimps with phenotypical similarities are also difficult to identify, and processing or removal of the external carapace further obscures this situation. In this scenario, commercial fraud caused by the inadvertent substitution of species due to phenotypic similarities, or deliberate replacement of higher quality species by others of lower quality, could occur, thereby leading to marketing of mislabeled adulterated products.4−6 However, labeling regulations enforced by several countries, coupled with customer awareness, have made identification and authentication of fish and seafood a crucial prerequisite. Distinctive and systematic analytical methods outlined to evaluate the origin of fish products facilitate distinguishing products of various origins. The instrumental techniques proposed for food authentication include high-performance liquid chromatography (HPLC), nuclear magnetic resonance (NMR) spectroscopy, infrared (IR) spectroscopy, capillary electrophoresis, and trace element and stable isotope analyses, as well as DNA-based and proteomic methods. As organisms Received: Revised: Accepted: Published: 5548

March 23, 2015 May 12, 2015 May 18, 2015 May 18, 2015 DOI: 10.1021/acs.jafc.5b01469 J. Agric. Food Chem. 2015, 63, 5548−5556

Article

Journal of Agricultural and Food Chemistry Table 1. Primers and Specific Probes for Hairtail Fish

a

primera

sequence (5′ to 3′)

target groupb

reaction type

FP-1 RP-1 FP-2 RP-2 FP-3 RP-3 probe 1 probe 2 probe 3

AGAGCTAAGCCAACCAGGCT AATTATCACGAAGGCATGGG AGGCACAGCCTTAAGCCTTCT GCTGTAACGATAACATTGTAAATTTGG AACTGGCTTATCCCCCTAATGAT GCGGAGGAGGCTAGGAGAAG [FAM]- CCCTCCTGGGCGATGACCAA -[TAMRA] [HEX]- CCGCGCAGAGCTAAGCCAGCC-[TAMRA] [FAM]- CCGACATGGCCTTCCCCCG -[TAMRA]

G3 G3 G2 G2 G1 G1 G3 G2 G1

multiple multiple multiple multiple single single multiple multiple single

FP, forward primer; RP, reverse primer. bGroup 1 (G1): Korea, Japan, and China. Group 2 (G2): Senegal and Canada. Group 3 (G3): Thailand.

have unique isotopic fingerprints, stable isotope composition analysis could provide information about ecological and geographical origin of biological products, thereby helping discrimination of food. The utilization of isotope ratio mass spectrometry in distinguishing the geographical origin of food samples has been established. Although this technique is extensively discussed for authenticating food products such as meat, wine, fruit juice, honey, and dairy products,7 its utility in inferring the geographical origin and authentication of fish, shrimp, and seafood species is scarce.6 On the other hand, molecular tools, based on protein and DNA biomarkers, have been proposed as suitable strategies for identification of fish and crustacean species. In the case of processed products, due to the lack of stability of the polypeptide targets, electrophoretic and immunological methods are unreliable. However, due to its remarkable stability, DNA analysis circumvents these problems. Among the DNA targets considered for species identification, 12S rRNA, 16S rRNA, tRNAVal, and, to a lesser extent, cytochrome oxidase I (COI) and cytochrome b genes have been proposed as useful molecular markers for fish and crustacean species.4 Authentication, verification of the geographic origin of a product, and pertinent labeling provide consumers with correct, complete, and transparent information. This enables the consumer to make an informed choice on the type and origin of fish purchased. There has been growing consumer enthusiasm for high-quality food with a clear regional identity. There is also an increased public awareness regarding the means by which it has been produced. This study investigates the applicability of stable isotopic values (δ13C and δ15N) as well as cytochrome c oxidase gene I as convergent tools to identify hairtail fish and shrimp and to verify their geographic origin. This would abate counterfeit labeling and help traceability of marketed products.

■

Vector) combined with a stable isotope mass spectrometer (Isoprime 100, Isoprime Ltd). The δ13C and δ15N (‰ deviations from Vienna Pee Dee Belemnite, VPDB, and atmospheric N2, respectively) are expressed as follows:

δ13C (‰) = [(13C/12C)sample /(13C/12C)standard − 1] × 1000 δ15 N (‰) = [(15N/14 N)sample /(15 N/14 N)standard − 1] × 1000 Two international standards, CH-6 and N-1 of International Atomic Energy Agency (IAEA), were used for calculating the isotope ratios, and the δ13C and δ15N values were reported. In case of both carbon and nitrogen isotope ratios, the analytical precision (standard deviation) was 95% similarity). These authors explained the degree of interspecific differences was due to the age of phylogenetic origin, and thus, barcode differences were genetically comprehensive.39 In our study, a clear segregation of patterns of COI was also observed on the basis of geographic origin and species. This validates the effectiveness of the DNA barcoding technique in identifying shrimp as well as hairtail fish and also ascertains its reliability in determining geographic origin. Thus, this particular procedure could be put to use for conservative fisheries management as well as governmental scrutiny of fishery products. In order to improve the reliability of seafood authentication via statistical analysis, stable isotope ratios as well as the DNA barcoding were combined in this study. The stable isotope data were processed by use of the LDA model. On the basis of this LDA, the hairtail fish (Figure 2a) were segregated into groups. Group 1 consisted of two subgroups; the first clustered together the Korean (with 96% similarity within them) and the Chinese hairtail fish (which had 0% similarity within them), while the second subgroup comprised the Japanese hairtail fish (with 100% match within themselves). LDA of the stable isotope data categorized group 2 as the Senegal (with 60% similarity within them) and Canadian hairtail fish (with 0% similarity within themselves). The LDA of stable isotopes in shrimp helped subcategorize the Group 4 shrimp into two subgroups. The first subgroup comprised Korean aquacultured shrimp (100% similarity within themselves; 100% accuracy) and natural Ecuador shrimp (0% similarity within themselves), while the second subgroup comprised Malaysian shrimp (having 100% similar profiles). LDA of stable isotopes helped subcategorize group 5 into four subgroups based on the country of origin, wherein the

stable isotopic values also vary with the country of origin; for example, the shrimp P. borealis from Greenland has different δ13C and δ15N values (−18.1‰ and 10.3‰)34 compared to shrimp from the Mid-Atlantic Ridge (−10.9‰ and 7‰) and Japan (−14.7‰ and 15.8‰).29,35 Ortea and Gallardo6 reported unique δ13C and δ15N values of shrimp species from Argentina (16.12‰ and 16.86‰), North Atlantic (−18.07‰ and 10.78‰), Mozambique (−16.77‰ and 10.55‰), Nigeria (−17.87‰ and 10.34‰), and Senegal (−16.80‰ and 8.72‰). These reported δ13C and δ15N values of various shrimp species from different countries differed significantly from the values of shrimp obtained in our study. This reveals that stable isotopic values could positively indicate the origin of shrimp. In the present investigation, shrimp from the natural environment showed higher isotopic variability and their mean δ13C and δ15N values were statistically different than the farmed ones. The δ13C values of Korean aquacultured shrimp ranged from −20.23‰ to −21.72‰, whereas the δ13C values of Korean natural shrimp ranged from −14.02‰ to −18.69‰. In contrast, the δ15N values of aquacultured shrimp (5.60− 6.20‰) were lower than the δ15N values (11.53−12.28‰) of natural shrimp; this was probably because of differences in diet. Gamboa-Delgado et al.36 also reported distinct δ13C and δ15N values for the shrimp species L. vannamei from Ecuador (open sea −16.6‰ and 9.76‰, estuary −18.32‰ and 4.25‰, semiintensively farmed −19.86‰ and 6.02‰) and L. vannamei from the Gulf of Mexico (open sea −17.14‰ and 12.19‰, estuary −18.59‰ and 5.88‰, semi-intensively farmed −19.69‰ and 8.32‰, intensively farmed −21.56‰ and 8.69‰). Aquaculture feeds are frequently formulated with varying dietary levels of plant meals. These plant meals are mostly derived from terrestrial plants having C3 photosynthesis and are less enriched in 13C (mean δ13CVPDB = −29‰) as compared to C4 plants (mean δ13CVPDB = −13‰).36 Also, the C3 plants are less enriched as compared to several marinederived ingredients such as fish meal (δ13CVPDB = −17‰). For example, some shrimp feeds used in Mexico have δ13CVPDB values ranging from −23.6‰ to −22.3‰ and δ15N values ranging from 5.8‰ to 9.7‰; the δ13CVPDB values of feed are transferred to the farmed organisms, thereby causing contrasting δ13C values (more isotopically depleted) as compared to the wild type.36 Thus, stable isotopic values could help distinguish farmed and natural shrimp. The unique isotopic values obtained for hairtail fish and shrimp obtained from various regions, viewed through the present study, assert that δ13C and δ15N could be used as discriminatory variables to distinguish between various geographic origins. Although several schematic reports and strategies have been outlined to identify fishery products, determine their geographical origin, and preserve domestic fishery products without adulteration, most of the techniques involved discuss animal meat (beef and lamb). But this study brings forth the applicability of isotopic analysis in the traceability of marine fish products. The identified differences in isotopic patterns of samples from various origins obtained in this study elucidate the potential of stable isotope analysis for validation of geographic authenticity. However, the identified patterns will have to be confirmed in another detailed study comprising a larger number of samples from certified origins and over a time course. Nevertheless, it is a fact that isotopic ratios of fishes are bound to be more stable as compared to other smaller life 5554

DOI: 10.1021/acs.jafc.5b01469 J. Agric. Food Chem. 2015, 63, 5548−5556

Article

Journal of Agricultural and Food Chemistry

(Panaeus monodon), the white leg shrimp (Litopenaeus vannamei) and the Indian white shrimp (Fenneropenaeus indicus) by PCR targeted to the 16S rRNA mtDNA. Food Chem. 2011, 125, 1457−1561. (5) Lavilla, I.; Costas-Rodríguez, M.; Bendicho, C. Authentication of fishery products. Comp. Anal. Chem. 2013, 60, 657−717. (6) Ortea, I.; Gallardo, J. M. Investigation of production method, geographical origin and species authentication in commercially relevant shrimps using stable isotope ratio and/or multi-element analyses combined with chemometrics: An exploratory analysis. Food Chem. 2015, 170, 145−153. (7) Kim, H.; Suresh Kumar, K.; Shin, K. H. Applicability of stable C and N isotope analysis in inferring the geographical origin and authentication of commercial fishes (mackerel, yellow croaker and pollock). Food Chem. 2015, 172, 523−527. (8) Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 2007, 24, 1596−1599 DOI: 10.1093/molbev/msm092. (9) Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406− 425. (10) Takezaki, N.; Rzhetsky, A.; Nei, M. Phylogenetic test of the molecular clock and linearized trees. Mol. Biol. Evol. 2004, 12, 823− 833. (11) Tamura, K.; Nei, M.; Kumar, S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. U.S.A. 2004, 101, 11030−11035. (12) Chakraborty, A.; Aranishi, F.; Iwatsuki, Y. Polymerase chain reaction and restriction fragment length polymorphism analysis for species identification of hairtail fish fillets from supermarkets in Japan. Fish. Sci. (Tokyo, Jpn.) 2007, 73, 197−201. (13) Kurle, C. M.; Sinclair, E. H.; Edwards, A. E.; Gudmundson, C. J. Temporal and spatial variation in the δ15N and δ13C values of fish and squid from Alaskan waters. Mar Biol. 2011, 158, 2389−2404. (14) Arcagni, M.; Campbell, L. M.; Arribére, M. A.; Kyser, K.; Klassen, K.; Casaux, R.; Miserendino, M. L.; Guevara, S. R. Food web structure in a double-basin ultra-oligotrophic lake in Northwest Patagonia, Argentina, using carbon and nitrogen stable isotopes. Limnologica 2013, 43, 131−142. (15) DeNiro, M. J.; Epstein, S. Influence of diet on the distribution of carbon isotopes in animals. Geochim. Cosmochim. Acta 1978, 42, 495− 506. (16) Gómez-Requeni, P.; Mingarro, M.; Calduch-Giner, J. A.; Médale, F.; Martin, S. A. M.; Houlihan, D. F.; Kaushik, S.; PérezSánchez, J. Protein growth performance, amino acid utilisation and somatotropic axis responsiveness to fish meal replacement by plant protein sources in gilthead sea bream (Sparus aurata). Aquaculture 2004, 232, 493−510. (17) Tanaka, H.; Ohshimo, S.; Takagi, N.; Ichimaru, T. Investigation of the geographical origin and migration of anchovy Engraulis japonicus in Tachibana Bay, Japan: A stable isotope approach. Fish Res. 2010, 102, 217−220. (18) Suh, Y. J.; Shin, K. H. Size-related and seasonal diet of the Manila clam (Ruditapes philippinarum), as determined using dual stable isotopes. Estuarine, Coastal Shelf Sci. 2013, 135, 94−105. (19) Libes, S. M. An Introduction to Marine Biogeochemistry; John Wiley and Sons: New York, 1992. (20) Schell, D. M.; Saupe, S. M.; Haubenstock, N. Bowhead whale (Balaena mysticetus) growth and feeding as estimated by δ13C techniques. Mar. Biol. 1989, 103, 433−443. (21) France, R. L. Carbon-13 enrichment in benthic compared to planktonic algae: foodweb implications. Mar. Ecol.: Prog. Ser. 1995, 124, 307−312. (22) Peterson, B.; Howarth, R. W. Sulfur, carbon and nitrogen isotopes used to trace organic matter flow in the salt-marsh estuaries of Sapelo Island, Georgia. Limnol. Oceanogr. 1987, 32, 1195−1213. (23) Wu, Y.; Zhang, J.; Li, D. J.; Wei, H.; Lu, R. X. Isotope variability of particulate organic matter at the PN section in the East China Sea. Biogeochemistry 2003, 65, 31−49.

subgroups comprising Indonesian, Indian, Dutch, and Thai shrimp were identified accurately (as they had 80%, 100%, 100%, and 80% similarity, respectively). Group 6 comprised Argentinian shrimp; the members demonstrated 100% similarity between themselves. Nowadays, consumers are increasingly interested in validating the reliability of fish products and determining if it is of natural (wild) origin. Nevertheless, international fishery and seafood trade are bound by food safety regulations, which insist on traceability (through all stages of production, processing, and distribution). These regulations aim to promote resource sustainability, quality distinction, and product safety. In fact, the FAO have outlined several analytical approaches for species authentication (NMR analysis, isotope analysis, fingerprints, electrophoresis, peptide mapping, immunological techniques analyzing proteins, target recognition, and blot hybridization), verification of geographic origin (NMR analysis, stable isotope and trace element analysis), and determining if the product is wild or cultivated. This study evaluates two of these techniques: stable isotope analysis and COI sequencing. Both these analyses harmonized in authenticating and tracing the origin of hairtail fish and shrimp from various origins. Stable isotopes (δ13C and δ15N) and COI gene sequencing have been used to authenticate, discriminate, and trace various food products. But their use in determining the provenance of fish has not been prevalent. On the basis of the present study, we can summarize that COI sequencing helped identify the species of hairtail fish and shrimp. The LDA of stable isotopes helped in further categorizing each species into subgroups, based on the country of origin. Moreover, the stable isotope values distinctly differentiated natural and farmed shrimp from the same country. Thus, this study on hairtail fish and shrimp validates the utility of these tools in identifying these species and establishing their geographical origin.

■

AUTHOR INFORMATION

Corresponding Author

*Phone +82 31 400 5536; fax +82 31 416 6173; e-mail [email protected]. Author Contributions ⊥

H.K. and K.S.K. contributed equally.

Funding

This research was a part of the project “Development of integrated techniques for the identification of seafood origin using chemical index and genetic information”, funded by the Ministry of Oceans and Fisheries, Korea. It was also supported by a grant from the National Research Foundation (No. 2012012617). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Ortea, I.; Pascoal, A.; Cañas, B.; Gallardo, J. M.; BarrosVelázquez, J.; Calo-Mata, P. Food authentication of commercially relevant shrimp species: From classical methods to foodomics. Electrophoresis 2012, 33, 2201−2211. (2) Tacon, A. G. J.; Metian, M. Fish matters: Importance of aquatic foods in human nutrition and global food supply. Rev. Fish Sci. 2013, 21, 22−38. (3) http://www.dpi.nsw.gov.au/__data/assets/pdf_file/0008/ 375902/Hairtail-and-Frostfish.pdf (accessed on July 27, 2014). (4) Pascoal, A.; Barros-Velásquez, J.; Ortea, I.; Cepeda, A.; Gallardo, J. M.; Calo-Mata, P. Molecular identification of the black tiger shrimp 5555

DOI: 10.1021/acs.jafc.5b01469 J. Agric. Food Chem. 2015, 63, 5548−5556

Article

Journal of Agricultural and Food Chemistry (24) MacKenzie, K. M.; Palmer, M. R.; Moore, A.; Ibbotson, A. T.; Beaumont, W. R. C.; Poulter, D. J. S.; Trueman, C. L. Locations of marine animals revealed by carbon isotopes. Sci. Rep. 2011, 1, 1−6. (25) Hobson, K. A. Applying isotopic methods to tracking animal movements. In Tracking Animal Migration Using Stable Isotopes; Hobson, K. A., Wassenaar, L. I., Eds.; Academic Press: London, 2008; pp 45−78. (26) Riera, P.; Stal, L. J.; Nieuwenhuize, J. Heavy δ15N in intertidal benthic algae and invertebrates in the Scheldt Estuary (The Netherlands): Effect of river nitrogen inputs. Estuarine, Coastal Shelf Sci. 2000, 51, 365−372. (27) Wan, R.; Wu, Y.; Huang, L.; Zhang, J.; Gao, L.; Wang, N. Fatty acids and stable isotopes of a marine ecosystem: study on the Japanese anchovy (Engraulis japonicus) food web in the Yellow Sea. Deep Sea Res. Part II 2010, 57, 1047−1057. (28) Shibata, J. Y.; Matsumoto, K.; Hamaoka, H.; Sogabe, A.; Nanko, T.; Kunihiro, T.; Onishi, H.; Omori, K. Contribution of pelagic and benthic grazing and detritus food chains to the coastal ecosystem of the Western Seto Inland Sea: A stable isotope and Bayesian mixing model analysis approach. In Interdisciplinary Studies on Environmental ChemistryEnvironmental Pollution and Ecotoxicology; Kawaguchi, M., Misaki, K., Sato, H., Yokokawa, T., Itai, T., Nguyen, T. M., Ono, J., Tanabe, S., Eds.; Terrapub: Tokyo, 2012; pp 427−435. (29) Takai, N.; Mishima, Y. Carbon sources for demersal fish in the western Seto Inland Sea, Japan, examined by δ13C and δ15N analyses. Limnol. Oceanogr. 2002, 47, 730−741. (30) Di Beneditto, A. P. M.; Bittar, V. T.; de Rezende, C. E.; Camargo, P. B.; Kehrig, H. A. Mercury and stable isotopes (δ15N and δ13C) as tracers during the ontogeny of Trichiurus lepturus. Neotrop. Ichthyol. 2013, 11, 211−216. (31) Lee, Y.; Hur, J.; Shin, K. H. Characterization and source identification of organic matter in view of land uses and heavy rainfall in Lake Shihwa, Korea. Mar. Pollut. Bull. 2014, 84, 322−329. (32) Yokoyama, H.; Tamaki, A.; Harada, K.; Shimoda, K.; Koyama, K.; Ishihi, Y. Variability of diet-tissue isotopic fractionation in estuarine macrobenthos. Mar. Ecol.: Prog. Ser. 2005, 296, 115−128. (33) Kuramoto, T.; Minagawa, M. Stable carbon and nitrogen isotopic characterization of organic matter in a mangrove ecosystem on the south-western coast of Thailand. J. Oceanogr. 2001, 57, 421− 431. (34) Rigét, F.; Møller, P.; Dietz, R.; Nielsen, T. G.; Asmund, G.; Strand, J.; Larsen, M. M.; Hobson, K. A. Transfer of mercury in the marine food web of West Greenland. J. Environ. Monit. 2007, 9, 877− 783. (35) Vereshchaka, A. L.; Vinogradov, G. M.; Dalton, A. Y. L. S.; Dehairs, F. Carbon and nitrogen isotopic composition of the fauna from the Broken Spur hydrothermal vent field. Mar. Biol. 2000, 136, 11−17. (36) Gamboa-Delgado, J.; Molina-Poveda, C.; Godínez-Siordia, D. E.; Villarreal-Cavazos, D.; Ricque-Marie, D.; Cruz-Suárez, L. E. Application of stable isotope analysis to differentiate shrimp extracted by industrial fishing or produced through aquaculture practices. Can. J. Fish Aquat. Sci. 2014, 71, 1520−1528. (37) Griffiths, A. M.; Sotelo, C. G.; Mendes, R.; Pérez-Martín, R. I.; Schröder, U.; Shorten, M.; Silva, H. A.; Verrez-Bagnis, V.; Mariani, S. Current methods for seafood authenticity testing in Europe: Is there a need for harmonisation? Food Control 2014, 45, 95−100. (38) Ward, R. D.; Hanner, R.; Hebert, P. D. N. The campaign to DNA barcode all fishes, FISH-BOL. J. Fish Biol. 2009, 74, 329−356. (39) Spies, I. B.; Gaichas, S.; Stevenson, D. E.; Orr, J. W.; Canino, M. F. DNA based identification of Alaska skates (Amblyraja, Bathyraja and Raja: Rajidae) using cytochrome c oxidase submit (COI) variation. J. Fish Biol. 2006, 69(B), 283−292. (40) Tzeng, C. H.; Chiu, T. S. DNA barcode-based identification of commercially caught cutlassfishes (Family: Trichiuridae) with a phylogenetic assessment. Fish Res. 2012, 127−128, 176−181.

5556

DOI: 10.1021/acs.jafc.5b01469 J. Agric. Food Chem. 2015, 63, 5548−5556