Water Stress Alters Lignin Content and Related Gene Expression in

Article pubs.acs.org/JAFC

Water Stress Alters Lignin Content and Related Gene Expression in Two Sugarcane Genotypes Adriana Brombini dos Santos,†,‡ Alexandra Bottcher,†,§ Eduardo Kiyota,† Juliana Lischka Sampaio Mayer,† Renato Vicentini,∥ Michael dos Santos Brito,†,⊥ Silvana Creste,⊥ Marcos G. A. Landell,⊥ and Paulo Mazzafera*,† †

Departamento de Biologia Vegetal, Instituto de Biologia, CP 6109, Universidade Estadual de Campinas, CEP 13083-970 Campinas, SP, Brazil ‡ Embrapa Soja, Rodovia Carlos João Strass, s/n°, Acesso Orlando Amaral, Distrito de Warta, CP 231, CEP 86001-970 Londrina, PR, Brazil § Centro de Tecnologia Canavieira (CTC), Rua Santo Antônio, Centro, CEP 13400-160 Piracicaba, SP, Brazil ∥ Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, CEP 13083-875 Campinas, SP, Brazil ⊥ Centro de Cana, Instituto Agronômico de Campinas, CEP 14001-970 Ribeirão Preto, SP, Brazil S Supporting Information *

ABSTRACT: The lignin deposition in the stem of two sugarcane genotypes was assessed on exposure to water stress. The lignin content and the morphoanatomical characterization of the stem indicated that IACSP94-2094 plants are more lignified than those of IACSP95-5000 genotype, under normal water supply conditions, which was especially associated with higher lignin contents in the rind of mature internodes. Water deficit had negative impact on the biomass production, mostly with IACSP942094 plants, possibly due to stress severity or higher susceptibility of that genotype during the stem-lengthening phase. Water deficit led to significant alterations in the expression levels of lignin biosynthesis genes and led to an approximate 60% increase of lignin content in the rind of young internodes in both genotypes. It is concluded that the young rind region was more directly affected by water stress and, depending on the genotype, a higher lignin accumulation may occur in the stem, thus implying lower quality biomass for bioethanol production. KEYWORDS: Saccharum, lignocellulosic biomass, gene expression, genetic variability, water stress

■

INTRODUCTION Sugarcane (Saccharum spp.) is a C4 grass accounting for an abundant and promising source of plant biomass for the production of biofuels. Residual sugarcane biomass (mainly bagasse and tops + young leaves) accounts for two-thirds of the total energy of the plant, the potential of which is partially used with the incineration of the bagasse, so as to generate electricity at alcohol and sugar mills.1 It is estimated that a mill currently and daily producing 1000000 L of ethanol from sugarcane juice, rich in sucrose, is potentially capable of initially generating an additional 150000 L of ethanol from the bagasse, provided that the cellulose there contained was available by means of acid hydrolysis, for fermentation with microorganisms.1 Ethanol derived from bagasse is called second-generation ethanol or cellulosic ethanol, the use of which is restricted by the recalcitrance of the cell wall. Sugarcane bagasse consists of approximately 50% cellulose, 25% hemicellulose, and 25% lignin.2 The recalcitrance of sugarcane bagasse and other biomasses is partially attributed to lignin, which serves as a natural mechanical barrier preventing the access of hydrolytic enzymes to cellulose fibrils. Additionally, lignin can absorb the enzymes used during hydrolysis of lignocellulosic material, thus impairing process efficiency. Furthermore, some polymer degradation products may inhibit subsequent fermentation phases.3 © 2015 American Chemical Society

Lignin is a phenolic polymer complex derived mainly from three hydroxycinnamoyl alcohols varying in methoxylation rate: monolignol p-coumaryl, coniferyl, and sinapyl. After incorporation in the lignin polymer, via combinatorial coupling reactions, monolignols originate the subunits p-hydroxyphenyl (H), guaiacyl (G), and syringyl (S), respectively.4,5 Polymerization takes place by means of addition of new monolignol radicals to the growing polymer, usually via a connection in position β, such as β-O-4, β-5, and β-β. The interunit linkage βO-4 (β-aryl ether) is the most frequent and also the most easily cleaved by chemical processes, whereas condensed linkages (β5, β-β, 5-5, 5-O-4, and β-1) are more resistant to chemical degradation.4,6 Lignin content and composition vary among different taxons, cellular types, and cellular wall layers and are modified by environmental factors throughout plant development.7 In gymnosperms (softwood), lignin is formed basically by G units and traces of H units, whereas in dicotyledonous angiosperms (hardwood) it consists mainly of G and S units, with few traces of H units. In grasses (monocotyledonous), G Received: Revised: Accepted: Published: 4708

December 24, 2014 May 1, 2015 May 3, 2015 May 4, 2015 DOI: 10.1021/jf5061858 J. Agric. Food Chem. 2015, 63, 4708−4720

Journal of Agricultural and Food Chemistry

■

and S units are incorporated at similar levels, while H units are relatively higher, in comparison to dicotyledonous species.4 Research into grasses has revealed that the incorporation of H, G, and S units in the lignin polymer is regulated spatiotemporally, varying in primary and secondary cellular walls and also in different tissues.8,9 Lignin topology and composition in different sugarcane internodes vary among the main cellular types present in the stem: fibers incorporate a significant amount of sinapyl alcohol, forming lignin at a S > G > H proportion; in xylem vessels, G and H units prevail in the protoxylem, whereas metaxylem features a fiberlike composition; parenchyma cells have a great deal of phenolic acids, thus preventing accurate determination of the proportion of each lignin unit.8 Similarly to other grasses, sugarcane features a significant amount of hydroxycinnamic acids associated with the cellular wall, at higher levels in the parenchyma tissue than in the vascular bundles. Sinapyl, ferulic, and p-coumaric acids are preferably deposited in the early stages of lignification, presenting different relative proportions as tissues mature.8 Sugarcane internode anatomy shows that it consists basically of parenchyma cells and vascular bundles, featuring two different morphological regions, the rind and the pith. The rind is the region containing mostly vascular bundles, in turn constituted by vessels surrounded by a great number of fibers. The pith is formed by parenchyma cells (which store sucrose), where the vascular bundles are distributed, at a lower number than in the rind.10 A recent systematic study reported on physiological, morphological, biochemical, and molecular data for the investigation of lignin deposition throughout sugarcane stem development.11 The outcome was a detailed profile of lignin and phenolic compounds related to the formation of the cellular wall in two contrasting genotypes for lignin content, highlighting differences regarding polymer content and composition, S/G ratio, and gene expression of lignin biosynthesis in the rind and in the pith of sugarcane internodes. Alteration in lignin biosynthesis is induced by a range of environmental stresses, such as drought, low temperature, UVB radiation, mineral deficiency, and pathogen infection.12 Several studies in corn reported an increased gene expression in lignin biosynthesis and varied content and composition in plants exposed to water deficit.13,14 Other studies have revealed that the gene expression and presence of enzymes related to lignin and its deposition on the cellular walls can be differentially regulated during water stress. cDNA-AFLP (amplified fragment length polymorphism) and Northern blot analyses have evidenced that the expression of the genes playing a role in cellular growth and extensibility of the cell wall in rice roots was potentiated in the early stages of water stress, whereas gene expression related to lignin biosynthesis was considerably higher during the intermediate and final stages of water deficit.15 A proteomic study of Citrullus lanatus roots submitted to water deficit has proven that proteins related to lignin synthesis, such as CCoAOMT and various class III peroxidases (involved in lignification), were induced mainly in the final stages of the stress.16 Supported by a previous systematic study of lignin deposition in sugarcane,11 the present work has looked into the effects of water deficit on lignin metabolism in the stem of two sugarcane genotypes.

Article

MATERIALS AND METHODS

Plant Material and Growth Conditions. The experiment was carried out at the experimental area of the Department of Plant Biology of the State University of Campinas, at Campinas, SP, Brazil (22°81′77′′ latitude S; 47°03′83′′ longitude W). Two commercial Saccharum spp. genotypes were used: IACSP94-2094, deemed drought-resistant,17,18 and IACSP95-5000, which has not been characterized for drought tolerance so far. Plants were obtained from single nodes of mature culms collected from plants in the field. These “one eye setts” were left to germinate (January 2011) on trays containing vermiculite, and after approximately 1 month 15 plants of each genotype were transferred to 25 L plastic (35 cm height × 25 cm top diameter × 28 cm bottom diameter) vases containing 20 L of commercial organic soil mixture and kept in a greenhouse under no temperature, light, or air humidity control. Secondary sprouts were removed, and only the main stem remained in each vase. The plants were irrigated on a daily basis until the beginning of the waterrestriction treatment, on May 2011. Water-Stress Treatment and Plant Collection. At the age of 5 months, the plants were submitted to three water regimes: namely, severe drought (SD), moderate drought (MD), and control (daily irrigation). SD and MD correspond to maintenance of the water content in the substratum at 40% and 80% of the total water storage capacity of the soil (Cw). Five plants of each genotype were used in each treatment. The Cw value was estimated using the fresh mass of the soil after water saturation (Cfm) and the dry mass (Cdm) after soil drying in a greenhouse for 24 h at 105 °C and applied in the equation Cw = (Cfm − Cdm)/Cfm × 100. At the beginning of the treatments, the vases were water-saturated, drained of water, and weighed. From that moment on, irrigation was suspended and the vases were weighed every second day, assuring maintenance of Cw at 40% or 80% by water addition, considering 1 mL = 1 g. The plants were kept under such conditions for 60 days. Figure S1 in the Supporting Information shows water replacement volumes throughout the stress period, as well as temperature and relative air humidity variation. The average maximum and minimum air temperatures in the greenhouse were 28.4 ± 3.8 and 11.8 ± 2.6 °C, respectively; the relative humidity was not controlled. By the end of a 60 day period (July 6th, 2011) the following parameters were obtained for each replicate in each treatment: number of green leaves (Nl), number of stem internodes (Ni), stem lengths (Ls), fresh stem mass (FMs), dry leaf mass (DMl), and dry root mass (DMr). For Nl determination only leaves featuring over 50% of leaf blade colored green were considered. Measurements of the leaves and root dry mass were determined after drying the material at 72 °C for 72 h. Stems were numbered from apex to base, so that internode 1 (I1) corresponded to the internode in which the leaf +1 was inserted. The internode stem diameter was measured by means of a digital caliper rule. Then two distinct internode maturation stages were selected for analysis: young or immature region, made of a pool of internodes I1−I3, and mature region, a pool of internodes I8 and I9. Each sample of these stages was separated in rind and pith, as previously identified.19 The stem material was frozen in liquid nitrogen and divided into two parts, one for biochemical analyses and the other for molecular analyses. The samples for biochemical analyses were lyophilized at −60 °C for 72 h and stored at −80 °C, whereas the samples for molecular analyses were kept at −80 °C. Biochemical Analyses. Approximately 50 mg of lyophilized (pith) and pulverized material was extracted twice with 1 mL of 80% ethanol in a water bath at 40 °C for 30 min with occasional vortexing. The supernatants were recovered by centrifugation at 8000g for 15 min, and the extracts were combined and dried in a SpeedVac (Savant, São Paulo, Brazil). The residue was solubilized in 1 mL of Milli-Q water. For soluble sugar determination 50 μL of each sample was homogenized in 950 μL of 80% acetonitrile in water and an aliquot of 4 μL was injected in an Acquity UPLC-MS (Micromass-Waters, Manchester, U.K.) mass spectrometer coupled to a TDQ triple quadrupole. The chromatographic separation was carried out in an Acquity UPLC C18-BEH column (2.1 mm × 50 mm, 1.7 μm) at a 0.2 mL min−1 flow rate. A gradient of 20−35% of 0.1% NH4OH solution 4709

DOI: 10.1021/jf5061858 J. Agric. Food Chem. 2015, 63, 4708−4720

Article


Table 1. Gene Identification, Sugarcane Assembled Sequences (SAS-SUCEST Database), Primer Sequences, and Amplicon Sizes

a

SASa

primer (5′→ 3′)

amplicon (bp)

ShPAL1

SCCCLR194D07.g

for: AGGAGGAGAAGAGGAGGAAAATAC rev: AGAAGAAAGAACAACGCCACA

150

ShC4H1

SCCCCL4009H01.g

for: CCGCAGATCCAGCACTATG rev: ATCCAACACCATTCCTCAGC

148

Sh4CL2

SCVPLB1015F12.g

for: CACACTGGGGACATTGGTT rev: CATTGAGACAACAGCAGCATC

162

ShHCT-like

SCVPRT2082B07.g

for: GCAGGTGGTAGAGTCGTCGT rev: ATGAGGTCCAGGGGAGAGAG

81

ShC3H1

SCVPCL6041E07.g

for: TCACTGCTGGAATGGACACA rev: TGTAGGTAGGGGAGGTTCTGG

163

ShCCoAOMT1

SCAGCL6012G12.g SCCCLR1069B09.g SCCCLR1079A02.g SCRUFL4024C06.b

for: GACGCCGACAAGGACAAC rev: CACGAAGTCGCGGTAGAAG

162

ShCCoAOMT3

SCJFRZ2010H06.g

for: CAGGACCAGTGCCAACATC rev: TTTCAGCGTCTCTTTCATTACTTG

157

ShCCR1

SCCCRZ2C01A04.g SCBFRT1064A01.g

for: GCTGGTCGGTCTCTTATCATC rev: CTGACGGTTCCCTTGACAG

214

ShF5H

SCJLRT1022E04.g

for: GCACTACGGTCCCTTCTGG rev: TCACGTTCTTGGTCAGGTTG

194

ShCOMT1

SCRFLR1012F12.g SCJLRT1023B09.g

for: GAGGACAAGGACGGCAAGT rev: AGTACCAGCTCTCCATGAGGAC

139

ShCAD2

SCBFAM2021E08.g SCEPRZ1011A02.g

for: CCCCTACACCTACACCCTCA rev: CACCTCACCGACCACCTC

157

ShCAD8

SCEQLR1029E05.g

for: ACGGCTGGAGAAGAACGAC rev: GCAAAGCACCAACTCATCAA

154

ShGAPDH

SCCCCL3001G02

for: TTGGTTTCCACTGACTTCGTT rev: CTGTAGCCCCACTCGTTGT

122

gene

Sugarcane assembled sequence. Gene Expression Analyses. Gene expression was assayed only in samples from severe drought (SD) treatment. Approximately 200−300 mg of tissue (pith and rind) pulverized in liquid nitrogen was used for the extraction of total RNA.24 After DNase treatment (Ambion), total RNA was quantified in a spectrophotometer at 260 nm and the quality checked in 1% agarose gel with ethidium bromide and UV visualization. The first cDNA strand was synthesized from 1 μg of total RNA using a Superscript III Reverse Transcriptase kit (Invitrogen, Carlsbad, CA, USA), in accordance with the manufacturer’s instructions. The relative number of transcripts was estimated for 12 genes related to lignin biosynthesis. The analyzed genes and their primers are given in Table 1.11 Quantitative RT-PCR (qPCR) analyses were carried out with a QuantiFast SYBR Green PCR kit (Qiagen, São Paulo, Brazil) on 96-well plates using 50×-diluted cDNA. The reactions were analyzed with an iCycler iQ5Multicolor Real-Time PCR Detection system (Bio-Rad USA) and the correction of the Ct (cycle threshold) values among the plates in the same assay (the same gene) was based on an intercalibrating sample and automatically performed by an iQ5 software tool. Calculation of the relative gene

in water (solvent B) and acetonitrile containing 0.1% NH4OH (solvent A) was used to elute the compounds from the column. The electrospray ionization in the mass spectrometer was set to the negative mode under the following conditions: capillary 3.0 kV and cone 30 V, temperature at ionization source 150 °C, and desolvation temperature 350 °C. The sugar content was estimated from calibration curves obtained with pure standards of glucose, fructose, and sucrose. Free proline content was determined spectrophotometrically.20 Morphoanatomical Analyses. Transversal sections of the middle of the third (I3) and ninth (I9) stem internodes in plants of both genotypes, not submitted to water stress, were obtained manually and treated with phloroglucinol21 for lignin analysis with an optical microscope (Olympus BX51). Lignin Analyses. The analyses of soluble lignin oligomers in the stem were carried out with 100 mg of lyophilized material according to ref 22. Lignin content was estimated by derivatization with thioglycolic acid from 15 mg of lyophilized material,23 using lignin alkali, 2hydroxypropyl ether (Sigma-Aldrich), to build a calibration curve. 4710


Article


Table 2. Number of Green Leaves (Nl), Number of Internodes (Ni), Stem Length (Ls), Fresh Stem Mass (FMs), Dry Leaf Mass (DMl), and Dry Root Mass (DMr) in Plants of Sugarcane Genotypes IACSP94-2094 and IACSP95-5000 Grown with Normal Water Supply (C) and Moderate (MD) and Severe (SD) Water Stress IACSP94-2094a

IACSP95-5000

param

C

MD

SD

C

MD

SD

Nl Ni Ls (m) FMs (g) DMl (g) DMr (g)

9.8 ± 0.4 Aa 15.8 ± 0.4 Aa 1.5 ± 0.10 Aa 491 ± 35 Aa 92.6 ± 4.3 Aa 56.5 ± 4.9 Aa

8.0 ± 0.5 Ba 15.2 ± 0.2 Aa 1.3 ± 0.1 Aa 411 ± 16 Aa 80.1 ± 3.1 Aa 49.3 ± 5.1 Aa

6.0 ± 0.3 Ca 14.2 ± 0.2 Ba 1.2 ± 0.1 Ba 369 ± 18 Ba 68.8 ± 4. Four Ba 38.9 ± 3.7 Ba

7.8 ± 0.4 Ab 12.4 ± 0.2 Ab 0.63 ± 0.03 Ab 241 ± 5 Ab 76.3 ± 3.3 Ab 66.9 ± 6.1 Aa

7.2 ± 0.6 Aa 12.8 ± 0.6 Ab 0.55 ± 0.04 Ab 188 ± 17 Bb 68.5 ± 3.1 Ab 65.8 ± 5.6 Aa

3.8 ± 0.3 Bb 12.5 ± 0.3 Ab 0.64 ± 0.02 Ab 210 ± 4 Ab 57.3 ± 1.4 Ba 43.5 ± 2.2 Ba

a Different uppercase letters indicate significant differences among water regimes within the same genotype; different lowercase letters indicate differences between the two genotypes under the same water regime. Means were compared by the Tukey test, P ≤ 0.05. Each value represents the mean ± standard error of five replications.

expression was based on the ΔΔCt method,25 and GAPDH (glyceraldehyde 3-phosphate dehydrogenase) was the reference gene to normalize expression values in the different samples.11,26 Statistics. The experiment was carried out in an entirely randomized design, in a 2 × 3 factorial (two genotypes and three water regimes), with five biological replications. For lignin quantification, data were analyzed as a 2 × 3 factorial (two internode maturation stages and three water regimes) for each sugarcane genotype. Each experimental unit consisted of one plant per vase. Data were submitted to variance analysis (Statistics software, version 10), and significant differences in treatment means were compared by means of the Tukey test and the F test (P ≤ 0.05). Results were presented as means + standard error. For the biochemical and molecular analyses, each replication represents the average of three technical determinations of each sample.

■

RESULTS Biometry. Except for dry root mass (DMr), we have observed that control IACSP94-2094 genotype plants featured better growth rates than those of the IACSP95-5000 genotype (Table 2). We have verified, for instance, that, regarding the number of internodes (Ni), stem length (Ls), and fresh stem mass (FMs), the performance of IACSP94-2094 plants was 22%, 58%, and 51% better than that of IACSP95-5000 plants, respectively. Water restriction negatively and progressively (regarding stress intensity) affected plant growth parameters in both sugarcane genotypes (Table 2). Moderate drought (MD) had few effects on plant growth, so that only Nl (in IACSP94-2094) and FMs parameters (in IACSP95-5000) were reduced. Under severe drought (SD) conditions, IACSP94-2094 plants had significant reduction of all analyzed parameters, in comparison with irrigated plants. Nl, DMl, and DMr also decreased in IACSP95-5000 plants under SD, nevertheless without significant alteration in stem-related parameters (Ni and Ls). The internode stem diameter of stressed plants had a growth profile resembling that of control plants (Figure 1), although the average stem diameter was greater in IACSP95-5000 genotype plants (21.25 mm) than in IACSP94-2094 (19.98 mm). In these plants, intermediate internodes (I4−I8) presented an average diameter above those of the other stem regions, in both sugarcane genotypes. Regardless of the water regime, the plants tended to present lower basal internode (mature) diameters, with values approaching those obtained for apical internode (immature) diameters (Figure 1). Water deficit caused a reducion of the internode diameter along the stem. IACSP94-2094 plants appear to have been more strongly affected, especially during severe drought. The

Figure 1. Diameters of stem internodes of plants of sugarcane genotypes IACSP94-2094 and IACSP95-5000 grown under different water regimes. Data are means ± standard error of five replicates.

intermediate internode region presented the most significant reductions: i.e. 14.3% in IACSP94-2094 and 9.3% in IACSP955000 (Figure 1). Morphological alterations, such as shortening and/or thinning of the internodes, were observed in both sugarcane genotypes, possibly as a result of cultivation conditions in the vegetation house. Soluble Sugars and Proline. Sucrose content in the wellwatered control plants was higher in immature internodes of IACSP94-2094 genotype, as opposed to IACSP95-5000 genotype, while in mature internodes similar values were observed in the two genotypes (Figure 2A). The amount of sucrose in control plants of both genotypes was approximately 5−6 times higher in mature internodes than in immature internodes. Plants under water restriction (MD and/or SD) posed significantly increased sucrose content in immature 4711


Article


Figure 2. Contents of sucrose (A), glucose (B), fructose (C), and proline (D) in immature internodes (Y) and in mature internodes (M) of plants of sugarcane genotypes IACSP94-2094 and IACSP95-5000 grown under different water regimes. Different uppercase letters indicate significant differences among water regimes within the same genotype, whereas different lowercase letters indicate differences between the genotypes under the same water regime. Data are means ± standard error of four replicates.

internodes. No significant difference was observed in mature internodes of the two sugarcane genotypes under the same water regime (Figure 2A). Control plants presented higher contents of reducing sugars in immature internodes, in relation to mature internodes (Figures 2B,C). In those plants, we observed that the relative amounts of glucose and fructose were higher in IACSP94-2094 than in IACSP95-5000 in immature and mature internodes. Under water deficit, glucose and fructose contents tended to be reduced in immature internodes, in comparison with that in control plants; however, this reduction was only significant for fructose, in both sugarcane genotypes (Figure 2C). In mature internodes, such sugars posed values similar to those observed in control plants in both genotypes (except for IACSP94-2094 plants under severe drought, which featured higher glucose content in relation to control plants). It was not possible to detect fructose contents in mature internodes of IACSP95-5000 plants (Figure 2C). Regardless of the water regime, IACSP95-5000 genotype plants always had higher proline content in immature internodes than IACSP94-2094 genotype plants. Free proline contents were higher in immature internodes in comparison with those of mature internodes in both genotypes. Proline content in the stem was not significantly affected by water deficit in either evaluated sugarcane genotype (Figure 2D). Morphoanatomical Analyses. The analyses of the internal morphology revealed that the sugarcane stem of both varieties studied here consists basically of parenchyma cells, concentrated on the pith region, and of vascular bundles, more

abundant in the rind region. Reaction with phloroglucinol evidenced a differentiated lignin deposition pattern in the sugarcane genotypes analyzed in this study. IACSP94-2094 genotype stems present a premature and more intense lignification process, in comparison to IACSP95-5000 genotype plants, as indicated by the thickening of cellular walls and the lignification level of the epidermis and of the vascular bundle elements of the xylem in immature internodes (Figures 3A,C,E,G and 4A,C,E,G). We have observed that, in immature internodes of IACSP942094 plants, the tracheal elements of protoxylem and metaxylem are already lignified (Figures 3E,G), while fibers and subepidermal layers happen to be in an early lignification phase (Figure 3A). In mature internodes, lignin is present in practically all tissues, except for chlorophyllin parenchyma cells (Figure 3B) and phloem cells in the vascular bundles (Figure 3F,H). Tissues tend to become too rigid, because parenchyma cells feature thicker and more lignified walls all over the organ; in addition, xylem fibers also present rather thick and lignified cellular walls (Figure 3F,H). Stems of IACSP95-5000 plants presented a discrete lignification degree in immature internodes, in which only protoxylem tracheal elements of the vascular bundles were lignified (Figure 4A,E,G). In mature internodes, parenchyma cells were lignified (Figure 4F,H); nevertheless, they posed a less intense reaction in the presence of phloroglucinol, in comparison to IACSP94-2094 plants. Similarly, fibers also became less stained in vascular bundles located both in the rind (Figure 4B,F) and in the pith (Figure 4H). 4712


Article


Figure 3. Transversal sections of different regions of sugarcane stems of genotype IACSP94-2094 submitted to acid phloroglucinol for lignin detection: (left column) immature internode; (right column) mature internode; (A, B) rind region; (C, D) detail of epidermis and adjacent cellular layers; (E, F) detail of rind vascular bundle; (G, H) detail of pith vascular bundle. Abbreviations: pc = parenchymal cell; ep = epidermis; f = fibers; mx = metaxylem; cp = chlorophyllin parenchyma; ph = phloem; vb = vascular bundle; px = protoxylem. Bars: (A, B and E, F) 50 μm; (C, D and G, H) 20 μm.

Soluble Lignin Oligomers. The analyses of soluble lignin enabled outlining the profiles of monomer and oligomer precursors of sugarcane polymer, on the basis of the frequency of such structures, as indicated in Table 3. We have identified G and S monolignols and their aldehydes (coniferyl and sinapyl aldehyde) and four dimers and four trimers of lignin. Type 8O-4 linkages (less recalcitrant) were relatively frequent among the identified structures; however, linkages 8-5 and 8-8 (more recalcitrant) were also found. G monomers (coniferyl alcohol, m/z 179) were found more frequently than S monomers (sinapyl alcohol, m/z 209), while H units (p-coumaryl alcohol, m/z 149) were not detected (Figure 5), thus confirming previous results.11 In both genotypes, lignin dimers tended to prevail in the rind and in the pith of immature internodes (YR and YP) in comparison to

their content in mature internodes; trimers, in turn, tended to prevail in mature internodes. In IACSP94-2094 plants, G monomers were more frequently detected in mature internodes than in immature internodes (Figure 5A). Under stressing conditions, G levels tended to decrease in mature internodes (rind). Dimers predominated in immature internodes (YR), and their frequency did not appear to be affected by water deficit. Among dimers, G(8-5)H (m/z 327) was the rarest, while S(8-O-4)G (m/z 435) was the most abundant. Among trimers, G(8-O-4)S(8-8)S (m/z 613) was the least frequent, detected only in mature internodes. In contrast, S(8-O-4)G(8-O-4)S (m/z 631) appeared to be the most frequent trimer, being absent only in the pith immature internodes. Structures G(8-O-4)G(8-5)G (m/z 553) and G(8O-4)S(8-5)G (m/z 583) were found in immature internodes only under water restriction (MD and SD). 4713


Article


Figure 4. Transversal sections of different regions of sugarcane stems of genotype IACSP95-5000 submitted to acid phloroglucinol for lignin detection; (left column) immature internode; (right column) mature internode; (A, B) rind region; (C, D) detail of epidermis and adjacent cellular layers; (E, F) detail of rind vascular bundle; (G, H) detail of pith vascular bundle. Abbreviations: pc = parenchymal cell; ep = epidermis; f = fibers; mx = metaxylem; cp = chlorophyllin parenchyma; ph = phloem; vb = vascular bundle; px = protoxylem. Bars: (A, B and E, F) 50 μm; (C, D and G, H) 20 μm.

control plants featured lignin content 4.6 times higher in mature internodes in comparison to that in immature internodes (rind region); on the other hand, IACSP95-5000 genotype control plants posed a 3.2× ratio. In mature internodes, the pith was also approximately 2.7× as lignified as in immature internodes, in both sugarcane genotypes (Figure 6). Lignin contents measured in the stems of irrigated plants were similar in the two sugarcane genotypes analyzed, except for MR, which proved to be more lignified in IACSP94-2094, in comparison to that in IACSP95-5000 plants. Water deficit has induced discrete lignin accumulation in immature internodes (YR and YP) in both sugarcane genotypes (Figure 6). In mature internodes, IACSP95-5000 plants featured significantly increased MR lignin content, on submission to severe water restriction (SD) (Figure 6B).

In the IACSP95-5000 genotype, G levels in immature and mature internodes appeared to be negatively affected by water deficit (Figure 5B). Dimers also tended to prevail in immature internodes; their abundance posed no apparent correlation with water stress. In mature internodes, G(8-O-4)S(8-5)G (m/z 583) and S(8-O-4)G(8-O-4)S (m/z 631) were the most abundant trimers. In this tissue region, the presence of G(8-O4)G(8-5)G (m/z 553) was apparently influenced by the water regime, tending to be more frequent in MR and MP, under drought conditions (MD and SD). On the other hand, S(8-O4)G(8-O-4)S (m/z 631) tended to be less frequent under water stress. Lignin Content. Lignin content was positively associated with the maturation status of stem internodes, so that the amount of lignin was higher in mature internodes than in immature internodes (Figure 6). IACSP94-2094 genotype 4714


Article


in the rind, independently of the maturation phase of stem internodes. Water deficit has induced alterations in the expression of various genes in lignin biosynthesis (Figure 7). The expression patterns of all analyzed genes were similar in IACSP94-2094 and IACSP95-5000 plants, although stress response intensities differed. In a general way, severe water restriction (SD) has led to increased transcripts of various genes in immature internodes, mainly in YR. Under water stress, except for ShCCoAOMT3 (Figure 7H) and ShCAD8 (Figure 7L), all other genes were significantly more expressed in immature internodes (YR), in comparison to the control conditions, in at least one of the analyzed genotypes. Similarly, genes ShPAL1, Sh4CL2, ShCOMT1, ShCCoAOMT3, and ShCCR1 also featured a higher number of transcripts, due to drought in YP (Figure 7A,C,F,H,J). In contrast, mature internodes presented an overall reduction in the expression of the analyzed genes, in comparison to watered control plants. Transcripts of ShPAL1, ShC4H1, ShC3H1, ShCOMT1, ShCCoAOMT1, ShCCoAOMT3, ShF5H, ShCCR1, and ShCAD2 genes were significantly decreased in MP under stress, in one or both sugarcane genotypes (Figure 7A,B,E−K). Such reduction in the expression levels was also observed for ShPAL1, ShC3H1, ShCOMT1, ShCCoAOMT1, ShCCoAOMT3, ShF5H, and ShCAD2 genes in MR, in comparison to irrigated control plants (Figures 7A,E−I,K). Apparently, ShHCT-like and ShCAD8 were slightly affected or not affected at all by the drought, maintaining practically unaltered expression levels (Figure 7D,L). Figure S1 in the Supporting Information shows the summarized main changes in gene expression levels in plants submitted to severe water deficit (SD) and their effects on lignin content in stem internodes.

Table 3. Lignin Precursor Monomers and Oligomers and Respective m/z Values Obtained by UPLC-MS/MS unit

structure

m/z

monomer

coniferyl aldehyde coniferyl alcohol (G) sinapyl aldehyde sinapyl alcohol (S) G(8-5)H G(8-5)G S(8-8)S S(8-O-4)G G(8-O-4)G(8-5)G G(8-O-4)S(8-5)G G(8-O-4)S(8-8)S S(8-O-4)G(8-O-4)S

177 179 207 209 327 357 417 435 553 583 613 631

dimer

trimer

Gene Expression. The analyses of the expression pattern of the genes coding for enzymes of the lignin biosynthesis pathway in sugarcane showed that the number of transcripts varied in accordance with the developmental phase of stem internodes, tissue type (rind or pith) and water regime (Figure 7). In the control plants, i.e. under irrigation, most analyzed genes were more strongly expressed in mature internodes (MR and/or MP), except for Sh4CL2 and ShCCoAOMT3 genes, which featured a higher number of transcripts in immature internodes for some tissues (Figure 7C,H). ShCAD8 had similar expression patterns in immature and mature internodes (YR, YP, MR, and MP) in control plants (Figure 7L). When comparing transcript levels in the rind and in the pith, we observed that the expression of the analyzed genes was higher

Figure 5. Soluble lignin detection pattern obtained by UPLC-MS analyses in plants of sugarcane genotypes IACSP94-2094 and IACSP95-5000 grown under different water regimes. The frequency of each structure is represented in the diagram by different hues, thus, 0× (white) indicates that the structure was not detected in any biological replicate, and 1×−3× indicate that the structure was detected in one, two, or three biological replicates. Abbreviations: YR = young rind; YP = young pith; MR = mature rind; MP = mature pith. 4715


Article


Figure 6. Lignin content in the rind and pith from the stem of plants of sugarcane genotypes IACSP94-2094 (A) and IACSP95-5000 (B) grown under different water regimes. Different uppercase letters indicate significant differences among the water regimes in the same internode, whereas different lowercase letters indicate differences among the internodes (immature or mature) under the same water regime. Data are means ± standard error of four or five replications. Abbreviations: YR = young rind; YP = young pith; MR = mature rind; MP = mature pith.

Figure 7. Relative expressions of lignin biosynthesis related genes in the pith and rind from the stem of plants of IACSP94-2094 and IACSP95-5000 sugarcane genotypes grown under different water regimes (A−L). Expression values were normalized by means of GAPDH as a reference gene; relative expression was calculated by the ΔΔCt method. Severely stressed plants (SD) marked with an asterisk differ from the respective control plants (C) within the same genotype group. Data are means ± standard error of three replicates. Abbreviations: YR = young rind; YP = young pith; MR = mature rind; MP = mature pith.

■

DISCUSSION

pathway have indicated that both polymer content and composition influence vegetative biomass recalcitrance.27,29,30 The present study has evaluated two commercial sugarcane genotypes, regarding the “modulating” effect of water deficit on lignin content and structure in the stem. Some papers have reported the effect of water stress on lignin biosynthesis in different plant species, indicating complex genetic regulation, the influence of the severity/time of exposure to stress, phenological phase, and organ/tissue of the plant, among other

Sugarcane bagasse is a material that is coproduced by sucroalcohol industries, readily available for utilization in the production of cellulosic ethanol. The conversion of the vegetative biomass into ethanol is mainly limited by biomass recalcitrance to chemical, enzymatic, or microbial attack.27,28 Studies involving gene manipulation in the lignin biosynthesis 4716


Article

Journal of Agricultural and Food Chemistry factors.14,15,31 As far as we are concerned, there is no available information on the mechanisms regulating lignin biosynthesis and deposition on the cellular wall or on how environmental stress, such as droughts, may affect the lignification process. The sugarcane genotypes used in our study, IACSP94-2094 and IACSP95-5000, were affected by water stress in different manners. Although IACSP94-2094 genotype is deemed to be drought-resistant,17,18 plants submitted to severe and prolonged water restriction presented significant reduction in all assessed biometric parameters (Nl, Ni, Ls, FMs, DMl, and DMr), while IACSP95-5000 was less affected, posing decreased Nl, DMl, and DMr values (Table 2). The number of green leaves (Nl) and root biomass (DMr) had the highest reductions, in both sugarcane genotypes: i.e., 39% and 31% in IACSP94-2094 plants and 51% and 35% in IACSP95-5000 plants, respectively. The impact of drought on sugarcane growth accounted for losses of up to 35%.32 Additionally, the low performance of IACSP94-2094 plants under water restriction might be related to severity and/or time of exposure to water stress, since only Nl was significantly reduced under moderate stress (MD). The reduction in the number of leaves and leaf senescence in sugarcane plants during water deficit might indicate a strategy to diminish transpiration surface, thus also mitigating energetic expenditure and ensuring basal tissue metabolism.33−35 The impact of water deficit on sugarcane productivity is related to specific plant growth stages. Some studies indicate that sugarcane becomes more vulnerable to water deficit during early growth, characterized by accelerated growth and tillering.18,36 At the same time, other authors claim that higher susceptibility to drought occurs during the stem-lengthening phase, with significant reductions of both mass and sucrose accumulation.33,37 Our results confirm that water restriction imposed during the stem-lengthening phase has caused stress, expressed in lower growth rates and consequent lower biomass production. Sugarcane accumulates sucrose in its stem, raising contents as internodes mature.38 Sucrose and reducing sugars account for the highest fraction of total soluble sugars present in the stem. The proportions of such sugars are altered throughout the different internode maturation stages, being negatively correlated to one another.39 The results obtained for IACSP94-2094 and IACSP95-5000 plants confirm that in the early stages of development, when growth rates are at their apex, reducing sugar contents (fructose and glucose) were proportionally higher than sucrose contents in immature internodes. The opposite was observed during maturity, when sucrose accumulation was potentiated and reducing sugar contents became significantly low (Figure 2A−C). Water stress is well known for negatively affecting photosynthesis in plants, as a result of stomatal and nonstomatal limitations.40 Our data have clearly shown that low water availability has caused sugar balance alterations in the stem, which causes a major drain of photoassimilates in sugarcane. In immature internodes, the accumulation of sucrose contents and the reduction of fructose contents were simultaneously induced by lack of water in both genotypes (Figures 2A−C), which is probably related to reduced growth rates of these internodes during water deficit. On the other hand, the results obtained with Q117 sugarcane genotype revealed that water deficit did not cause significant alteration in the amount of sucrose and reducing sugars in young internodes.41

In mature internodes, the contents of sucrose and reducing sugars were not affected by water stress. Considering that photosynthesis is usually affected by drought and consequently the sucrose biosynthesis and export to the culms, the maintenance of the sugar pool in those internodes might be related to cleavage dynamics and sucrose cellular resynthesis, a process regulated by the activity of sucrose phosphate synthase, sucrose synthase, and invertase enzymes.42 Additionally, our results are partially in agreement with those obtained by others,41 demonstrating that, despite the absence of alteration in sucrose contents, glucose and fructose contents happened to increase in mature internodes of sugarcane plants during water deficit. The intensity and/or time of exposure to water stress, in addition to the genotypes employed, might explain the different physiological responses. We aimed here to characterize water stress, rather than tolerance, as information in that respect is available solely for the IACSP94-2094 genotype.17,18 Free proline contents in the stem were similar in irrigated control plants for both analyzed genotypes; under severe water deficit conditions, no significant alteration in the amount of that amino acid was detected in the stem (Figure 2D). Such results indicate that proline plays no osmoprotective role in the stem, in the event of prolonged water deficit, when the plant might recruit more effective mechanisms. Likewise, the adoption of proline as a biochemical indicator for water stress must be seen with caution;43 when it comes to sugarcane, contents of such amino acid may vary according to severity and/or time of exposure to stress,44 as well as the developmental phase of the plant.45 Our anatomy analyses are consistent with those previously described,10 evidencing typical internode organization in two morphologically distinct regions: the rind, characterized by a great number of vascular bundles, and the pith, where predominates reserve parenchyma cells. An estimate of the number of vascular bundles in sugarcane internodes has shown that approximately 50% are located within 3 mm from the rind,46 thus constituting a region naturally enriched with such types of cellular organization, a rather interesting object for the study of lignin biosynthesis. A comparison of different lignin deposition patterns in stem internodes in two sugarcane genotypes showed that lignification in IACSP94-2094 plants occurs earlier than that in IACSP95-5000 plants (Figures 3 and 4). The analysis of immature internodes supports such findings: while only protoxylem was lignified in the vascular bundles of IACSP955000, both protoxylem and metaxylem were lignified in IACSP94-2094, in addition to the initial lignification of fibers and subepidermal layers. Likewise, parenchyma cells of mature internodes are also lignified, and xylem fibers feature rather thickened and lignified walls. Walsh et al.46 have revealed that parenchyma cell walls are lignified as internodes mature; in the fourth internode the lignification level is around 5%, while in the tenth internode it may reach 60%. The lignin contents found in the genotypes studied here confirmed that polymer accumulation varied according to internode maturation (immature or mature) and also according to the tissue region in the stem (rind or pith). Mature internodes were more lignified than immature internodes, and inside each internode, the rind featured higher lignin content than the pith, which was associated with the higher concentration of vascular bundles in the rind region of the internode and with progressive epidermal and hypodermal lignification. We have also observed that mature rind was up to 4717


Article


S(8-8)S, G(8-O-4)G(8-5)G, and G(8-O-4)S(8-5)G in young rind solely under stressing conditions, while other oligomers such as G(8-O-4)G(8-5)G and G(8-O-4)S(8-8)S tended to be less abundant in mature rind, in comparison to those in the irrigated control. Lignin structural complexity appears to be directly associated with the relative frequency of different interunit linkages, which in turn depend upon the abundance of each monomer during the polymerization process. Therefore, lignins constituted mainly by G units, as in conifers, contain a higher number of resistant linkages, such as 8-5, 8-8, 5-5 and 5-O-4, than lignin rich in S units and thus are more resistant to chemical degradation.4 Unfortunately, we have not determined the ratio S/G, but given the consistencies between our results and those by Bottcher et al.,11 the observed pattern is very likely to occur in the genotypes studied here. Lignin deposition is associated with vegetative organ maturity and final differentiating stages of cellular types,4 which naturally tends to raise the levels of gene expression of lignin biosynthesis in those regions. In irrigated control plants, we have observed that transcript accumulation in mature sugarcane internodes was higher than that in immature internodes (Figure 7). A comparative analysis between the expression profiles of the two sugarcane genotypes has evidenced that, in IACSP94-2094 plants, the abundance of transcripts in mature rinds was higher than that in IACSP955000 plants (except for Sh4CL2 and ShC3H1). The high levels of expression observed in IACSP94-2094 support the results of the anatomical analysis of lignin, thus suggesting that this sugarcane genotype features a higher stem lignification level. When plants of both sugarcane genotypes were submitted to severe water deficit (SD), there were significant alterations in the expression levels of most analyzed genes, with generalized increased transcripts in young internodes (except for ShCAD8) and reduced expression in mature internodes, as opposed to the findings in control plants, which tended to feature higher levels of gene expression of lignin biosynthesis in mature internodes (Figure 7). Such data were consistent with the higher lignin content (>60%, when compared to control plants) observed in the pith of young internodes for both sugarcane genotypes under water deficit (Figure 6). On the other hand, reduced expression of most lignin biosynthesis genes (except for ShC4H1) in mature internodes of the stem under drought conditions fails to explain the approximately 30% increase of lignin content in mature rind of IACSP95-5000 plants, in comparison to that in irrigated sugarcane plants. The high-complexity genomes of modern sugarcane cultivars (allopolyploid hybrids), associated with possible functional redundancies among the various members of the same gene family,11 might justify the apparent lack of correlation between low gene expression and high lignin content observed in this context. Under severe water restriction, ShF5H and ShCCR1 have proven to be the most differentially expressed genes in IACSP94-2094, approximately 13 and 24 times more expressed in young rind under severe water deficit in comparison with control plants, respectively (Figure 7I,J). ShF5H codes for a key enzyme in the production of lignin S units, and the accumulation of its transcripts in the rind region (rich in vascular bundles) might be related to intensified lignin deposition in young internodes induced by stress. In conclusion, we have demonstrated here that lignin deposition in stem internodes is affected by severe water stress

4.6 times as lignified as young rind in IACSP94-2094, whereas this increase was 3.2 times in IACSP95-5000; in the pith region, lignin content was 2.7 times higher in mature pith than in young pith, in both sugarcane genotypes (Figure 6). Higher rind lignification, as identified in sugarcane stems, is consistent with higher peroxidase activity rates detected in this region, which might be involved in lignin polymerization.19 Lignin biosynthesis is under a complex genetic control, resulting in different adaptive responses, which may vary during plant growth and development.12,47 As for water stress, a number of studies have revealed that gene expression of the biosynthesis pathway and/or lignin content may be altered according to stress time and/or intensity,15,16 organ and its specific regions,13,14 and certain cellular types.48 The water stress imposed in our study induced significant accumulation of lignin in the rind and pith of immature internodes of both genotypes, in comparison to the respective irrigated control plants. Additionally, IACSP95-5000 plants submitted to severe drought have accumulated 30% more lignin in mature rind, in comparison to irrigated plants. The lignin accumulation in IACSP95-5000, particularly in the rind, might indicate a strategy to enhance xylem vessel resistance, so as to cope with higher tension during water deficit, by reducing water loss. Voelker et al.49 have shown that the reduced lignification level of transgenic Populus spp. plants silenced to 4CL gene increased xylem vulnerability to embolism. Different methodologies,50 among other major factors, such as tissue type, plant age,48 and genotypic variation51 may explain the differences found in the literature regarding lignin content in sugarcane. In the present study, lignin content was determined with thioglycolic acid and ranged from 0.4% in young pith to 4.2% in mature rind. Using the same method, de Souza et al.48 found 4.9% in the leaves and 2.5% in the stem of young sugarcane plants. The high specificity associated with the method, added to the fact that a significant fraction of lignin in grasses has an acid-soluble property (thus remaining in solution during the precipitation phase in acid), might lead to underestimated total lignin values.50 Regardless of methodrelated inquiries, our results demonstrate differential lignin accumulation in immature and mature internodes and also between the pith and the rind. The analysis of soluble lignin in IACSP94-2094 and IACSP95-5000 has shown that, regardless of maturation level (young or mature) and stem region (rind or pith), the frequency of G monomer (coniferyl) was constantly higher than that of S (sinapyl). As observed by Bottcher et al.,11 H units (p-hydroxyphenyl) were not found in sugarcane, probably due to low concentration (typically

Water Stress Alters Lignin Content and Related Gene Expression in

Recommend Documents