Article pubs.acs.org/jpr
Early Events in Plastid Protein Degradation in stay-green Arabidopsis Reveal Differential Regulation beyond the Retention of LHCII and Chlorophyll Julia Grassl,†,‡ Adriana Pružinská,†,‡ Stefan Hörtensteiner,§ Nicolas L. Taylor,†,‡ and A. Harvey Millar*,†,‡ †
ARC Centre of Excellence in Plant Energy Biology and ‡Centre for Comparative Analysis of Biomolecular Networks (CABiN), Bayliss Building M316, The University of Western Australia, 35 Stirling Highway, Crawley WA 6009, Western Australia, Australia § Zurich-Basel Plant Science Center, Institute of Plant Biology, University of Zurich, CH-8008 Zurich, Switzerland S Supporting Information *
ABSTRACT: An individually darkened leaf model was used to study protein changes in the Arabidopsis mutant stay-green1 (sgr1) to partially mimic the process of leaf covering senescence that occurs naturally in the shaded rosettes of Arabidopsis plants. Utilizing this controlled and predictable induced senescence model has allowed the direct comparison of sgr1 with Col-0 during the developmental period preceding the retention of chlorophyll and light harvesting complex II (LHCII) in sgr1 and the induction of senescence in Col-0. Quantitative proteomic analysis of soluble leaf proteins from sgr1 and Col-0 before the initiation of senescence has revealed a range of differences in plastid soluble protein abundance in sgr1 when compared to Col-0. Changes were also observed in membrane located machinery for photosystem II (PSII), in Calvin cycle components, proteins involved in redox control of the stromal compartment and ammonia assimilation that differentiated sgr1 during the early stages of the senescence process. The changes in PSII abundance were accompanied with a lower capacity of photosynthetic CO2 assimilation in sgr1 than Col-0 after return of plants to lighted conditions following 3 and 5 days of darkness. A light-harvesting chlorophyll-a/b binding protein (LHCB2) was retained during the later stages of senescence in sgr1 but this was accompanied by an enhanced loss of oxygen evolving complex (OEC) subunits from PSII, which was confirmed by Western blotting, and an enhanced stability of PSII repair proteins in sgr1, compared to Col-0. Together these data provide insights into the significant differences in the steady-state proteome in sgr1 and its response to senescence, showing this cosmetic stay-green mutant is in fact significantly different to wild-type plants both before and during leaf senescence. KEYWORDS: sgr, LHC, leaf senescence
■
INTRODUCTION The loss of chlorophyll (Chl) and yellowing of leaves is a prominent characteristic of plant senescence.1 Mutants that retain green pigments during senescence are collectively called ‘‘stay-green’’ mutants and have been identified as belonging to either functional or cosmetic stay-green phenotypes. In the functional group, the mutants have altered developmental patterns and timing of senescence.2,3 The cosmetic phenotypes (also called type C stay-green) are associated with alteration in the timing and extent of Chl breakdown, but in the background, the leaf senescence program appears to be progressing normally.4 These mutants have become a useful tool to study the Chl breakdown process and its consequences and most are thought to represent mutants that have a defect in a catalytic or regulatory gene of Chl breakdown.1 In Arabidopsis, three type C stay-green genes have been identified: PaO, NYC1 (chlorophyll b reductase) and SGR.4 In 2007, research by several independent groups led to the identification of SGR from different plant species, that is, Festuca prantensis,5 Arabidopsis,6 rice,7 and pea.8 The latter was of particular interest from a © 2012 American Chemical Society
historical point of view as the gene responsible for the green cotyledon phenotype in pea was one of the seven traits Gregor Mendel used to determine the laws of Mendelian inheritance in garden peas.5,8 SGR is a senescence-associated gene that is typically upregulated during senescence; nye1 mutants in Arabidopsis show a nonyellowing phenotype during natural and darkinduced senescence.6 The proteins encoded by SGR genes from different species are 25−30 kDa and lack a clear transmembrane domain or any other known protein domains other than the one defined by the SGR family (PF12638). Homologues of SGR are found among higher plants, moss and algae, and are related to bacterial proteins of unknown function in anaerobic bacteria, notably of the genus Clostridium. In rice and Arabidopsis, SGR is located in the plastids of cells suggesting a direct role in the initiation of a plastid-localized degradation event that regulates chlorophyll degradation.6,7 Received: July 26, 2012 Published: October 2, 2012 5443
dx.doi.org/10.1021/pr300691k | J. Proteome Res. 2012, 11, 5443−5452
Journal of Proteome Research
Article
Transient overexpression of SGR and in vivo pull-down assays have shown that SGR interacts directly with LHCPII in rice and that SGR-LHCPII complexes are formed in thylakoid membranes.7 However, a missense mutation in rice SGR (V99M) does not affect the binding activity to LHCPII, showing that the functional impairment of this mutation is not associated with photosystem II (PSII) binding per se.7 In addition to the retention of chlorophyll, the LHCs of PSII appear to remain intact and stacked during senescence in the mutant, while the complex is disassembled in wild-type (WT) plants. Recently, five chlorophyll catabolism enzymes (CCEs) were shown to specifically interact with LHCII and SGR was essential for recruiting CCEs in senescing chloroplasts. The SGR-CCE-LHCII interaction during the breakdown of LHCIIlocated chlorophyll was proposed to allow the metabolic channelling of phototoxic Chl breakdown intermediates.9 Despite these recent advances, there is still little information on the broader biochemical processes in plastids that differ in sgr mutants during the early stages of senescence. To frame the events that lead to, or correlate with, the later differential stability of the LHCII core subunits and the retention of Chl in sgr mutants, more information at the protein level is needed. While LHCs stay intact during dark-induced senescence in sgr mutants, the efficiency of PSII and the rate of photosynthesis have been shown to decline in the same manner as WT.6 Hence, it seems likely that some factor or factors related to PSII function are changing in sgr considering the role of PSII in photosynthesis and Chl fluorescence. Also, while senescence is not visually apparent in sgr, it seems plausible that other protein components will be altered in this mutant. These changes are likely the cause of alterations in fresh weight and pathogenic responses of the mutant when compared to matched WT plants.2,10−12 Here we report, using quantitative proteomics, changes in PSII, in Calvin cycle components, in proteins involved in redox control of the stromal compartment and in ammonia assimilation that differentiated Arabidopsis sgr1 during the early stages of the senescence process. The light-harvesting chlorophyll-a/b binding protein (LHCB2) was retained during the later stages of senescence in sgr1 but this was accompanied by an enhanced loss of oxygen evolving complex (OEC) subunits, explaining the loss of photosynthetic capacity of sgr1 during senescence.
■
darkness using a IMAGING−PAM (Walz) according to the manufacturer’s instructions. Semiquantitative RT-PCR
RNA extraction, DNase treatment, and first-strand cDNA synthesis were performed according to the manufacturer’s instructions using the Qiagen RNeasy kit and SuperScript III reverse transcriptase (Invitrogen). PCR was performed for 30− 35 cycles with gene-specific primers as follows for SGR1 (AT4G22920): SGR1-L, ACAAGTTCCCATCTCCATGC; and SGR1-R, GGAAAATGTCGCTTCACGTT. For SAG12 (AT5G45890): SAG12-L, TCCTTACAAAGGCGAAGACG; and SAG12-R, TCATTAACCGGGACATCCTC. For WRKY53 (AT4G23810): WRKY53-L, CAGACGGGGATGCTACGG; and WRKY53-R, GGCGAGGCTAATGGTGGTG, with actin as a control. For actin2-8 (AT3G18780AT1G49240): Actin L, GGTAACATTGTGCTCAGTGGTGG; and Actin R, AACGACCTTAATCTTCATGCTGC. For PAO (At3g44880): PAO-L GTTTCCAAGGTGCGAATGAT; PAO-R ACCGACGATTGGTAGTTTCG, (size 108 bp). PCR products were visualized on an agarose gel stained with ethidium bromide. Fragment sizes for SGR1 (141 bp), SAG12 (93 bp), WRKY53 (91 bp), and actin (107 bp) were all of the expected size. Protein Extraction and Quantification
All protein extraction and purification steps were carried out keeping samples on ice or at 4 °C. Leaves were collected and immediately frozen in liquid N2. Total protein extracts were prepared by grinding the tissue using a pestle and mortar and solubilization with extraction buffer (50 mM Tris-HCl, 10% (v/ v) glycerol, 0.05% (v/v) β-mercaptoethanol and complete, mini protease inhibitor cocktail (Roche) pH 7.5). The homogenate was vortexed shortly and clarified by filtering through miracloth (Merck Millipore). The filtrate was then centrifuged at 300g for 2 min at 4 °C to remove all plant cell debris. The supernatant was collected and centrifuged at 20 000g for 20 min to separate soluble and membrane proteins. The soluble fraction was collected and the concentration of total protein was determined using a Bradford assay (Pierce). Western Blotting
Soluble protein extracts (2 μg protein or 0.75 mg of FW) and membrane proteins (3.3 μg protein or 3.3 mg of FW) were separated by SDS-PAGE on 10−20% Criterion Tris-HCl polyacrylamide gels (BioRad). For immunodetection, separated proteins were then transferred to Hybond-C Extra nitrocellulose membranes (GE Healthcare Life Sciences) using a semidry apparatus (Hoefer) and incubated at room temperature for 1 h with primary antibodies. Primary antibodies to PSII subunits were all purchased from Agrisera. Appropriate secondary antibodies conjugated to horseradish peroxidase were applied to washed membranes for 1 h prior to allow detection of the chemiluminescent signal using the ECL Advance Western Blotting Detection Kit (GE Healthcare Life Sciences) and an ImageQuant RT ECL imager (GE Healthcare Life Sciences) by standard procedures.
MATERIALS AND METHODS
Plant Growth Conditions and Measurements
Arabidopsis thaliana (ecotype Columbia-0) and RNAi line sgr1 #2 (termed sgr1;5,13) were grown in soil under short-day (8 h day/16 h night) conditions with fluorescent light of 150 μmol photons m−2 s−1 at 22 °C and 65% relative humidity. For induction of senescence, leaves from 8-week-old plants were individually covered with aluminum foil for up to 9 days. Chl abundance was quantified at various time points from leaves of control and covered leaves at 0−9 days of darkness. Leaves were frozen in liquid nitrogen and stored at −80 °C. Chl was extracted with 80% (v/v) acetone. Chl absorbance was measured spectrophotemetrically at 647 and 663 nm and the total Chl content determined as [7.15 × (A663 − A750) + 18.71 × (A647 − A750)]. Chl fluorescence and the photochemical efficiency of PSII (measured as Fv/Fm) was also quantified at various time points from leaves of control and covered leaves at 0−9 days of
Protein Labeling and Fractionation
For each sample, 100 μg of protein was precipitated by the addition of 4 vol of cold acetone and stored in −20 °C overnight. The precipitated protein was then centrifuged at 20 000g for 20 min and the resulting pellet was then resuspended in dissolution buffer, denatured, and cysteines were blocked according to the manufacturer’s instructions (iTRAQ Reagents 5444
dx.doi.org/10.1021/pr300691k | J. Proteome Res. 2012, 11, 5443−5452
Journal of Proteome Research
Article
-8plex Amine-modifying Labeling Reagents for Multiplexed Relative and Absolute Protein Quantitation, Revision C, AB Sciex). Each sample was digested by addition of 10 μL of 1 μg/ μL trypsin (Invitrogen) at 37 °C overnight and labeled with the iTRAQ reagents (according to the manufacturer’s instructions) in triplicate in the following experiments: (i) 0dd Col-0, 114, 117, and 119; 0dd sgr 1, 115, 116, and 121. (ii) 3dd Col-0, 115, 117, and 119; 3dd sgr 1, 114, 118, and 121. (iii) 5dd Col-0, 113, 116, and 121; 5dd sgr 1, 114, 115, and 119. The labeled samples were pooled prior to further analysis. To remove excess labeling reactants and to reduce interference of salts during LC−MS/ MS analysis, the pooled samples were divided in two aliquots. One aliquot was diluted 4-fold with SCX buffer A (10 mM KH2PO4 in 25% (v/v) acetonitrile (ACN), pH 3.0) and subjected to strong cation exchange (SCX) chromatography using an OPTI-LYNX cartridge (Optimize Technologies). The eluent was dried in a vacuum concentrator and stored at −20 °C for LC−MS/MS analysis. The other aliquot (300 μg) was separated into 1 min fractions over a 35 min gradient 0−60% buffer B (10 mM KHPO4 in 1 M KCl and 25% [v/v] ACN, pH 3) SCX column (4.6 mm, 10 cm, 300 A, PolyLC, Columbia, MD). The fractions were dried in vacuo and desalted using C18 cartridges (Nest Group).
initial analysis protein score, >46 was used as a threshold for identification and subsequent quantification. For proteins in this set classified as plastid, based on experimental published evidence as outlined in Supplementary Data S1, a further Mascot ion score cut off (34 or 35), was used to yield a false discovery rate of 34/35 (FDR 5%); 5451
dx.doi.org/10.1021/pr300691k | J. Proteome Res. 2012, 11, 5443−5452
Journal of Proteome Research
Article
photosensitizes the hypersensitive response elicited by Pseudomonas syringae in Arabidopsis. New Phytol. 2010, 188, 161−174. (13) Aubry, S.; Mani, J.; Hörtensteiner, S. Stay-green protein, defective in Mendel’s green cotyledon mutant, acts independent and upstream of pheophorbide a oxygenase in the chlorophyll catabolic pathway. Plant Mol. Biol. 2008, 67, 243−256. (14) Heazlewood, J. L.; Verboom, R. E.; Tonti-Filippini, J.; Small, I.; Millar, A. H. SUBA: the Arabidopsis Subcellular Database. Nucleic Acids Res. 2007, 35, D213−D218. (15) Thimm, O.; Blaesing, O.; Gibon, Y.; Nagel, A.; Meyer, S.; Krüger, P.; Selbig, J.; Müller, L. A.; Rhee, S. Y.; Stitt, M. MAPMAN: a user-driven tool to display genomics data sets onto diagrams of metabolic pathways and other biological processes. Plant J. 2004, 37, 914−939. (16) Jiang, H.; Chen, Y.; Li, M.; Xu, X.; Wu, G. Overexpression of SGR results in oxidative stress and lesion-mimic cell death in rice seedlings. J. Integr. Plant Biol. 2011, 53, 375−387. (17) Buchanan-Wollaston, V. The molecular biology of leaf senescence. J. Exp. Bot. 1997, 48, 181−199. (18) Martinez, D. E.; Costa, M. L.; Gomez, F. M.; Otegui, M. S.; Guiamet, J. J. Senescence-associated vacuoles’ are involved in the degradation of chloroplast proteins in tobacco leaves. Plant J. 2008, 56, 196−206. (19) Balazadeh, S.; Parlitz, S.; Mueller-Roeber, B.; Meyer, R. C. Natural developmental variations in leaf and plant senescence in Arabidopsis thaliana. Plant Biol. 2008, 10, 136−147. (20) Nakabayashi, K.; Ito, M.; Kiyosue, T.; Shinozaki, K.; Watanabe, A. Identification of clp genes expressed in senescing Arabidopsis leaves. Plant Cell Physiol. 1999, 40, 504−514. (21) Nakashima, K.; Kiyosue, T.; Yamaguchi-Shinozaki, K.; Shinozaki, K. A nuclear gene, erd1, encoding a chloroplast-targeted Clp protease regulatory subunit homolog is not only induced by water stress but also developmentally up-regulated during senescence in Arabidopsis thaliana. Plant J. 1997, 12, 851−861. (22) Chen, H.; Zhang, D.; Guo, J.; Wu, H.; Jin, M.; Lu, Q.; Lu, C.; Zhang, L.; Psb2, A homologue in Arabidopsis thaliana is required for efficient repair of photodamaged photosystem II. Plant Mol. Biol. 2006, 61, 567−575. (23) Ishihara, S.; Takabayashi, A.; Ido, K.; Endo, T.; Ifuku, K.; Sato, F. Distinct functions for the two PsbP-like proteins PPL1 and PPL2 in the chloroplast thylakoid lumen of Arabidopsis. Plant Physiol. 2007, 145, 668−679. (24) Toufighi, K.; Brady, S. M.; Austin, R.; Ly, E.; Provart, N. J. The Botany Array Resource: e-Northerns, expression angling, and promoter analyses. Plant J. 2005, 43, 153−163. (25) Bonaventure, G.; Ohlrogge, J. B. Differential regulation of mRNA levels of acyl carrier protein isoforms in Arabidopsis. Plant Physiol. 2002, 128, 223−235. (26) Ferro, M.; Brugiere, S.; Salvi, D.; Seigneurin-Berny, D.; Court, M.; Moyet, L.; Ramus, C.; Miras, S.; Mellal, M.; Le Gall, S.; KiefferJaquinod, S.; Bruley, C.; Garin, J.; Joyard, J.; Masselon, C.; Rolland, N. AT-CHLORO, a comprehensive chloroplast proteome database with subplastidial localization and curated information on envelope proteins. Mol. Cell. Proteomics 2010, 9, 1063−1084. (27) Olinares, P. D.; Ponnala, L.; van Wijk, K. J. Megadalton complexes in the chloroplast stroma of Arabidopsis thaliana characterized by size exclusion chromatography, mass spectrometry, and hierarchical clustering. Mol. Cell. Proteomics 2010, 9, 1594−1615. (28) Zybailov, B.; Rutschow, H.; Friso, G.; Rudella, A.; Emanuelsson, O.; Sun, Q.; van Wijk, K. J. Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. PLoS One 2008, 3, e1994. (29) Buchanan-Wollaston, V.; Earl, S.; Harrison, E.; Mathas, E.; Navabpour, S.; Page, T.; Pink, D. The molecular analysis of leaf senescence-a genomics approach. Plant Biotechnol. J. 2003, 1, 3−22. (30) Zhou, C.; Han, L.; Pislariu, C.; Nakashima, J.; Fu, C.; Jiang, Q.; Quan, L.; Blancaflor, E. B.; Tang, Y.; Bouton, J. H.; Udvardi, M.; Xia, G.; Wang, Z.-Y. From model to crop: functional analysis of a STAYGREEN gene in the model legume Medicago truncatula and effective
use of the gene for alfalfa improvement. Plant Physiol. 2011, 157, 1483−1496. (31) Zimmermann, P.; Zentgraf, U. The correlation between oxidative stress and leaf senescence during plant development. Cell Mol. Biol. Lett. 2005, 10, 515−534. (32) Zimmermann, P.; Heinlein, C.; Orendi, G.; Zentgraf, U. Senescence-specific regulation of catalases in Arabidopsis thaliana (L.) Heynh. Plant Cell Environ. 2006, 29, 1049−1060. (33) Causin, H. F.; Jauregui, R. N.; A.J., B. The effect of light spectral quality on leaf senescence and oxidative stress in wheat. Plant Sci. 2006, 171, 24−33. (34) Causin, H. F.; Roberts, I. N.; Criado, M. V.; Gallego, S. M.; Pena, L. B.; del Carmen Ríos, M.; Barneix, A. J. Changes in hydrogen peroxide homeostasis and cytokinin levels contribute to the regulation of shade-induced senescence in wheat leaves. Plant Sci. 2009, 177, 698−704. (35) Hö rtensteiner, S.; Feller, U. Nitrogen metabolism and remobilization during senescence. J. Exp. Bot. 2002, 53, 927−937. (36) Peoples, M. B.; Dalling, M. J. The interplay between proteolysis and amino acid metabolism during senescence and nitrogen reallocation. In Senescence and Aging in Plants; Noodén, L. D., Leopold, A. C., Eds.; Academic Press: San Diego, CA, 1988; pp 181− 217. (37) Kichey, T.; Le Gouis, J.; Sangwan, B.; Hirel, B.; Dubois, F. Changes in the cellular and subcellular localization of glutamine synthetase and glutamate dehydrogenase during flag leaf senescence in wheat (Triticum aestivum L.). Plant Cell Physiol. 2005, 46, 964−974. (38) Brugière, N.; Dubois, F.; Masclaux, C.; Sangwan, R. S.; Hirel, B. Immunolocalization of glutamine synthetase in senescing tobacco (Nicotiana tabacum L.) leaves suggests that ammonia assimilation is progressively shifted to the mesophyll cytosol. Planta 2000, 211, 519− 527.
5452
dx.doi.org/10.1021/pr300691k | J. Proteome Res. 2012, 11, 5443−5452
