Easy Applied Gelatin-Based Hydrogel System for ... - ACS Publications

Article Cite This: ACS Biomater. Sci. Eng. 2019, 5, 3022−3031

pubs.acs.org/journal/abseba

Easy Applied Gelatin-Based Hydrogel System for Long-Term Functional Cardiomyocyte Culture and Myocardium Formation Feng Zhang, Ning Zhang, Hong-Xu Meng, Hai-Xia Liu, Ying-Qi Lu, Chao-Ming Liu, Zhao-Ming Zhang, Kai-Yun Qu, and Ning-Ping Huang* State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering, Southeast University, Si Pai Lou 2#, Nanjing 210096, P.R.China

Downloaded via NOTTINGHAM TRENT UNIV on August 13, 2019 at 07:01:39 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

S Supporting Information *

ABSTRACT: Harnessing biomaterials for in vitro tissue construction has long been a research focus because of its powerful potentials in tissue engineering and pharmaceutical industry. Myocardium is a critical cardiac tissue with complex multiple muscular layers. Considering the specific characters of native cardiac tissues, it is necessary to design a biocompatible and biomimetic platform for cardiomyocyte culture and myocardium formation with sustained physiological function. In this study, we developed gelatin-based hydrogels chemically cross-linked by genipin, a biocompatible cross-linker, as cell culture scaffolds. Moreover, to achieve and maintain the functionality of myocardium, for instance, well-organized cardiomyocytes and synchronized contractile behavior, we fabricated gelatin-based hydrogels with patterned microstructure using a microcontact printing technique. Furthermore, graphene oxide (GO), with unprecedented physical and chemical properties, has also been incorporated into gelatin for culturing cardiomyocytes. Our results show that micropatterned genipincross-linked gelatin hydrogels are very helpful to promote alignment and maturation of neonatal rat ventricular cardiomyocytes. More interestingly, the presence of GO significantly enhances the functional performance of cardiomyocytes, including an increase in contraction amplitude and cardiac gene expression. The cultured cardiomyocytes reach a well-synchronized contraction within 48 h of cell seeding and keep beating for up to 3 months. Our study provides a new and easy-to-use gelatinbased scaffold for improving physiological function of engineered cardiac tissues, exhibiting promising applications in cardiac tissue engineering and drug screening. KEYWORDS: gelatin hydrogel, micropattern, graphene oxide, engineered myocardium, cardiac tissue engineering

1. INTRODUCTION The heart is the first functional organ that forms in the human body with very limited capacity of regeneration after its development is completed.1 Cardiovascular diseases remain the main cause of death worldwide, prompting the need for developing new strategies to generate functional cardiac tissue constructs in vitro, for either implanting or drug screening. Although heart tissue was first cultured in vitro nearly 100 years ago, the maintenance of differentiated cardiac cells by traditional cell culture methods continues to be an issue, as adult cardiomyocytes quickly dedifferentiate in vitro and isolated primary neonatal cardiomyocytes are still immature.1,2 Neonatal rat ventricular myocytes, for being relatively easy to obtain, are generally chosen as cell source in research of cardiac tissue engineering. To produce physiologically functional cardiac tissue in vitro, optimizing scaffolds in terms of conductive, mechanical, and topographical properties becomes a critical issue.3−5 Culturing cardiomyocytes (CMs) under dynamic environments, such as applying electrical and mechanical stimulation, is another important concern.6,7 © 2019 American Chemical Society

Native myocardium contains cardiomyocytes being anatomically aligned in network, with functions of synchronized contraction and electrical signal propagation.8 Techniques such as electrospinning, microfabrication, and microcontact printing have been utilized to prepare patterned scaffolds, such as aligned nanofibers, patterned grooves, and pillars, to guide cell growth.9 The physicochemical and topographical properties of the chosen scaffold in developing ideal cell−matrix interactions and cell alignment are critical for producing engineered cardiac tissue.10 Hydrogel scaffolds have been widely used in soft tissue engineering. They can be made from a variety of natural polymers, such as collagen, chitosan, hyaluronic acid, alginate, and so on. The extracellular matrix of myocardium contains a majority of collagen.11 Gelatin is a derivative of collagen and desirable for promoting cell adhesion and proliferation.5 Received: April 13, 2019 Accepted: May 2, 2019 Published: May 2, 2019 3022

DOI: 10.1021/acsbiomaterials.9b00515 ACS Biomater. Sci. Eng. 2019, 5, 3022−3031

Article

ACS Biomaterials Science & Engineering

Figure 1. Preparation and characterization of gelatin-based scaffolds. (A) Schematic diagram of fabrication process of gelatin hydrogel scaffolds with micropatterns (not in scale). (B) Physical picture of gelatin hydrogel incorporated with different concentration of GO before and after crosslinking with genipin. (C) Young’s modulus of gelatin hydrogels incorporated with different concentration of GO after cross-linking measured by AFM.

GO and cross-linked by genipin, offering the desirable mechanical property and topographic morphology for generating functional cardiac tissue in vitro. Furthermore, we conducted substantial biological studies to investigate cardiac cell development, cytoskeletal organization, expression of specific cardiac markers, as well as beating velocity and calcium dynamics. We predict that the easy-to-use gelatinbased platform will improve physiological function of engineered cardiac tissues, demonstrating a potential for cardiac tissue engineering and drug screening.

Because of its low cost and low immunogenicity, gelatin has been widely used in tissue engineering. However, hydrogels made from pure gelatin is too soft and not physically stable and thus needs to be reinforced by cross-linkers; for example, gelatin grafted with methacrylate (GelMA) can be photo-crosslinked.12 Genipin, an extract from gardenoside, has been used as a nontoxic and water-soluble cross-linker for gelatin.13 Compared with the traditional cross-linkers, such as glutaraldehyde and NHS/EDC, the biocompatible genipin is showing promising applications in biomedical engineering.14 Moreover, nanomaterials such as gold nanowires, graphene, and its derivatives can be incorporated into the gels to improve the physical and chemical properties of gels.15,16 In recent years, graphene oxide (GO) has been increasingly explored in the area of biomaterials and tissue engineering, because of its good biocompatibility, as well as unprecedented physical and chemical properties (e.g., high surface area, thermal conductivity, mechanical strength).16,17 GO has many oxygencontaining functional moieties, such as hydroxyl, carboxyl, and epoxy groups, which enable greater interactions with proteins and cells through covalent, electrostatic, and hydrogen bonding.18,19 It was reported that GO can enhance both the mechanical properties of the substrates and the cellular behaviors including adhesion, proliferation, and differentiation.20,21 For example, GO flakes can effectively improve paracrine secretion of mesenchymal stem cells (MSCs), which in turn promote cardiac tissue repair and cardiac function restoration.22 Functional nanoscaled GO has been applied to the controlled loading and targeted delivery of multiple drugs.23 GO-GelMA hybrid hydrogels can support cellular spreading and arrangement with improved viability and proliferation in a 3D microenvironment.16 GO/PEDOT nanocomposite films have a positive effect on differentiation of neural stem cells in vitro.24 Therefore, to design a biocompatible and biomimic platform with functional components for cardiomyocyte culture and myocardium formation is highly desired. In this study, we develop the gelatin-based hydrogel scaffolds (with and without micropatterns) that are incorporated with

2. MATERIALS AND METHODS 2.1. Fabrication of Gelatin-Based Hydrogel Scaffolds. Gelatin and GO-containing gelatin hydrogels were prepared by a simple protocol. Briefly, a 6% (w/v) gelatin solution was prepared by dissolving gelatin powder (molecular weight 10−70 kDa, extracted from bovine skin, Shengxing Biotechnology, China) in ultrapure water at 45 °C. Gelatin−GO mixture solution was prepared by dissolving 6% (w/v) of gelatin powder in 0.25, 0.5, 1.0, 1.5, or 2.0 mg/mL GO solution (10 mg/mL GO in ultrapure water, Niumeitai, Beijing, China) at 45 °C. The cross-linker solution was prepared by dissolving genipin (Zhixin Biotech Ltd., Linchuan, China) in 10 mM HEPES at pH 7.4 (HEPES, ShengXing Biotechnology, China), yielding 0.1%, 0.2%, 0.3%, 0.4%, and 0.8% (w/v) solution. To fabricate the scaffolds, first, a silicon mold containing grooved micropatterns with 15 μm in width and 1 μm in depth, was produced via photolithography technology as previously described.25 Second, PDMS stamps were made by transferring the structure from the silicon mold to PDMS. In detail, Sylgard 184 elastomer (Dake, Beijing, China) was mixed 1:10 (w/w) with the related curing agent to form PDMS, which was poured over the silicon mold and vacuumed. After curing 2 h at 60 °C, the PDMS stamps were manually separated from the mold and used directly without additional modification. Third, a 30 μL drop of the gelatin solution or gelatin-GO solution was poured on the PDMS stamps, and gelling was allowed to proceed for 4 h at room temperature to obtain the hydrogel scaffolds, as illustrated in Figure 1A. After removal of the PDMS mold, the rest were cross-linked in genipin solution (0.2%, w/v) at 25 °C for 24 h and rinsed with ultrapure water. In this study, gelatin hydrogels without patterns (Gel), gelatin hydrogels with micropatterns (Gel-P), and GOcontaining gelatin hydrogels with micropatterns (Gel-GO-P) were used as cell culture scaffolds. 3023


Article

ACS Biomaterials Science & Engineering 2.2. AFM Measurement and SEM Characterization. Threedimensional topographical scans of the hydrogels were recorded using contact mode atomic force microscopy (AFM) on a BioScope Resolve AFM (Bruker Corporation, U.S.A.). Probes with spring constants of 0.1 N/m (MLCT-A, Bruker Corporation, U.S.A.) were used for measurements. Usually, the elastic deformation of samples is described by Hertz’s and Sneddon’s contact model, and the compressive Young’s modulus is calculated by using different geometries.26 In our experiment, hydrogels were prepared as film coatings on circular glass slides, with a thickness greater than 10 μm. Then, the glass slides were fixed on a Petri dish filled with PBS. Hertz’s model for mechanics was employed to analyze the Young’s modulus of hydrogels. Young’s modulus images were directly collected in PBS using a cantilever with a calibrated spring constant, k, of 0.133 N/m (PFQNM-LC Probe, value given by the manufacturer), a scan rate of 0.5 Hz, and a peak force frequency of 2 kHz. Mean values of Young’s modulus were obtained by Nasoscope Analysis 1.7 (Bruker Corporation, U.S.A.). The structure morphology of hydrogels were imaged using a fieldemission scanning electron microscopy (FE-SEM, Ultra Plus, Carl Zeiss, Germany). Prior to the observation, the hydrogels were submerged in liquid nitrogen followed by freeze-drying for 48 h. 2.3. Harvest, Seeding, and Culture of Cardiomyocytes. All procedures were conducted in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC) at Southeast University. Cardiomyocytes were extracted from neonatal rat ventricles of two-day-old Sprague−Dawley rats using previously described protocols.27 Briefly, ventricles were quartered, incubated overnight at 4 °C in a 0.06% (w/v) solution of trypsin in Hank’s balanced salt solution (HBSS), washed in culture medium, and subjected to a series of digestions (3 min, 37 °C, 200 rpm) in 0.1% (w/v) solution of collagenase type II in HBSS. The first digestate was discarded, and the cell suspensions from the subsequent 2−3 digestions were centrifuged (800 rpm, 5 min), resuspended in HBSS, pooled, and resuspended in α-MEM (Hyclone, cat: SH30265.01B) supplemented with 10% FBS, 1% penicillin− streptomycin. Cells were preplated for one 60 min period to enrich for cardiomyocytes. Cell number was determined by hemocytometer and flow cytometry. The gelatin-based hydrogels were sterilized in 75% (v/v) ethanol overnight and soaked in culture media at 37 °C for 4 h prior to seeding neonatal rat cardiomyocytes. Cells were cultured on scaffolds in 48-well plates at a cell density of 20 000/cm2 in αMEM supplied with 15% fetal bovine serum (Gibco, cat: 10099141) and 1% penicillin/streptomycin (Gibco, cat: 15070063) for 1 day. After attachment on the hydrogels, cells were washed with PBS and incubated in fresh culture medium to remove the nonadherent cell. On day 2, the serum concentration was reduced to 10% and media were changed every second day. The biocompatibility of Gel-GO hydrogels was evaluated using the Cell Counting Kit-8 (CCK-8) assay. After being cultured for 1, 3, and 5 days, the hydrogels were washed with PBS solution and incubated with the CCK-8 along with cell culture media at a ratio of 1:10 for 2 h in 5% CO2 at 37 °C. The absorbance of the solutions was measured at 450 nm using a microplate reader (Biotek Epoch, U.S.A.) 2.4. Intracellular Calcium Transient Measurement. CMs cultured for 1 and 2 days were gently washed for three times with modified Tyrode’s solution (137 mM NaCl, 5.4 mM KCl, 1.2 mM MgCl2, 1 mM CaCl2, 20 mM HEPES, pH 7.4) and incubated in a 2 μM Fluo-4, AM solution (Invitrogen, cat: F14201) for 20 min. The cells were gently washed for three times and then incubated for another 25 min in Tyrode’s solution. Intracellular calcium fluorescence was analyzed under a Nikon Ti-E inverted microscope using laser at 488 nm excitation. Noncompressed videos in*.avi format were recorded with an Olympus DP721 charged couple device (CCD) digital camera. The videos were directly processed in ImageJ and transformed into image stacks. Fluorescence changes were measured as the ratio of activated fluorescence (F) over the initial background fluorescence intensity (F0). 2.5. Immunostaining. On day 1, 3, and 5, CMs on different scaffolds were gently rinsed three times with DPBS buffer and fixed

with 4% (w/v) paraformaldehyde (PFA) for 15 min coupled with 0.2% Triton X-100 for 10 min at room temperature. 3% bovine serum albumin (BSA, SunShine Biotechnology, China) in PBS was used as blocking solution to prevent nonspecific binding of antibody. After they were rinsed three times with PBS, samples were incubated with primary antibodies (anti-α-actinin (Sarcomeric), mouse monoclonal, 1:200 in PBS, Sigma-Aldrich; anticonnexin 43, rabbit polyclonal, 1:75 in PBS, Cell Signaling, U.S.A.) for 1 h at 37 °C, followed by incubation with corresponding secondary antibodies (1:200 in PBS; Alexa Fluor 594 goat antirabbit IgG, Alexa Fluor 488 goat antimouse IgG, Invitrogen). To stain the nucleus, samples were immersed in Hoechst 33342 (Sigma, U.S.A.) at a concentration of 10 μg/mL for 15 min at room temperature. Finally, cells were observed with a Revolution XD confocal laser scanning microscope (Andor, Northern Ireland). To better view immunostained α-actinin and connexin 43 in one image, α-actinin is set to red and connexin 43 is set to green using ImageJ. 2.6. Structure Characterization of α-Actinin. Fluorescent immunostains of α-actinin in the cardiomyocytes were processed using a MATLAB code based on fingerprint detection as previously described.28 After extraction of the main pattern, the angle distribution was analyzed, and the orientational order parameter (OOP) was reported.29 Briefly, the OOP was calculated using the mean resultant vector from circular statistics according to the following equation OPP =

1 N

N

∑ eivj j=1

(1)

where i = √−1 is the complex unit, e is Euler’s number (∼2.71), and νj is the jth orientation in {ν1, ν1,., νN}. 2.7. Beating Velocity Analysis. Noncompressed videos in *.avi format were recorded with an Olympus DP721 CCD digital camera. The videos were directly processed in software as previous described and then counted.30 Briefly, the beating velocity was calculated by matching a block of pixels to an identically sized block of pixels in the i + dth frame, where d is a delay in frames that the user selects. Then the velocity is calculated based on the distance traveled by the pixel and the known time. 2.8. Gene Expression. Cells were lysed in Trizol (Invitrogen), and RNA extraction was performed according to the manufacturer’s protocol. In order to obtain enough RNA, cells grown on five scaffolds of each type were pooled. After RNA extraction, aliquots of 500 ng total RNA from each group were reverse transcribed into cDNA, using a cDNA synthesis kit (TaKaRa, Japan). Subsequently, the cDNAs were purified utilizing the spin columns and buffers provided with the cDNA synthesis kit. Gene expression was analyzed by RTqPCR using an Applied Biosystem 7500 Real Time PCR System (ABI, U.S.A.). For each RT-qPCR analysis, 2 μL of the abovementioned cDNA (equals10 ng total RNA) was used; total reaction volume was 20 μL each and cycling conditions were as follows: 30 s initial denaturation at 95 °C followed by 40 cycles of 5 s denaturation at 95 °C and 34 s annealing at 60 °C. At the end of the cycling program, a melt curve analysis was performed starting at the actual annealing temperature. All samples were run in duplicates. Genespecific primers were obtained from (Jinsirui, Biotechnology, China). All primers were designed using the web-based “Primer 3” program. The SYBR Green based qPCR mix was purchased from Takara (Japan). Threshold levels for Ct-determination were chosen manually. RT-PCR data were analyzed according to the ΔΔCt method using the mean Ct value of the housekeeping genes (GAPDH). Primer sequences are shown in Table 1. 2.9. Statistical Analysis. Data were compared using one-way analysis of variance followed by Bonferroni’s posthoc test (GraphPad Prism 5.02) software. Error bars represent the mean ± standard deviation (SD) of measurements (* p < 0.05, * * p < 0.01, and * * * p < 0.001). 3024


Article

ACS Biomaterials Science & Engineering Table 1. Primer Sequences for Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) gene Cx43 Serca2a Tnnt Actn GAPDH

primer sequence (5′−3′) forward: TCCTTGGTGTCTCTCGCTTT reverse: GAGCAGCCATTGAAGTAGGC forward: TGCTGGAACTTGTGATCGAG reverse: AGCGTTTCTCTCCTGCCATA forward: CCTGCAGGAAAAGTTCAAGC reverse: GTGCCTGGCAAGACCTAGAG forward: CGAGTGCACAAGATCTCCAA reverse: CTCTGACACCACAGGAGCAA forward: GGCATTGCTCTCAATGACAA reverse: TGTGAGGGAGATGCTCAGTG

3. RESULTS AND DISCUSSION 3.1. Fabrication and Characterization of GelatinBased Hydrogel Scaffolds. Gelatin, produced by partial

Figure 2. Characterization of pure and hybrid hydrogels. SEM surface images of gelatin hydrogels (A) and hydrogels containing 0.25 mg/ mL GO (B); SEM cross-sectional images of gelatin hydrogels (C) and hydrogels containing 0.25 mg/mL GO (D). Scale bar: 100 μm. Figure 3. Cardiomyocytes cultured on gelatin scaffolds within 2 days after seeding. Immunofluorescent staining of Cx43 (green) and αactinin (red) in (A) and (B). Scale bars: 50 μm. Calcium transient of cardiomyocytes on day 1 (C) and day 2 (D). Electrophysiological signal recording curves of cardiomyocytes on day 1 (E) and day 2 (F). Y axis of F/F0 refers to measured fluorescence normalized to background fluorescence, while X axis refers to the time point. Scale bars in (C) and (D): 100 μm. (G) and (H): Schematic of typical cardiomyocyte states on day 1 and day 2 of culture.

hydrolysis of collagen, is sensitive to temperature. The gelatin solution maintains liquid state when the temperature is above 37 °C and sets to a gel on cooling. Figure 1 provides a schematic diagram of fabrication process of gelatin hydrogel scaffolds with micropatterns. A drop of gelatin solution was put on the patterned PDMS mold (Figure 1A (i) and Figure S1A) and covered by a clean glass coverslip (Figure 1A (ii)). To fabricate gelatin films with ridges and grooves on the surface, a dehydration period of 24 h at room temperature ensured gelatin films with high-fidelity patterns (Figure 1A (iii)), which also helps gelatin films easily peeled from the PDMS mold. After removal of the mold, the rest were cross-linked in genipin solution at room temperature for 24 h, in order to maintain the gel state when the temperature reaches to 37 °C for cell culture. According to our experiment, the genipin-cross-linked gelatin hydrogels have no obvious morphological changes and remain stable even after 3 months of immersing under cell culture conditions. Similar to the fabrication process of gelatin hydrogels with micropatterns (Gel-P), the gelatin hydrogels without patterns (Gel) were fabricated using flat nonpatterned PDMS mold. Graphene oxide (morphology shown in Figure

S1B), derivated from graphene, was mixed with gelatin at different GO concentrations (0, 0.25, 0.5, 1, and 2 mg/mL) to prepare GO-containing gelatin hydrogel scaffolds with micropatterns (Gel-GO-P). The color of resulting hydrogels gradually darkens with the increase of GO concentrations (Figure 1B). Surface topography of gelatin-based scaffolds was assessed by atomic force microscopy (AFM). The surface of GOincorporated hydrogels is rougher than that without GO (Figure S2A,C). Nevertheless, the height of surface structure on both scaffolds (within 150 nm, Figure S2A,C) is much less than the height of cardiomyocytes (around 10 μm) and 3025


Article


Figure 4. Comparison of cardiomyocytes growth cultured on different gelatin-based scaffolds. (A) Immunofluorescent staining of cardiac specific proteins (Cx43: in green; α-actinin: in red; nucleus: in blue). Scale bars: 50 μm. (B) Evaluation of sarcomere length of cardiomyocytes on different scaffolds, number of statistical n = 50. (C) Evaluation of sarcomeric orientational order parameter (OOP) of cardiomyocytes on different scaffolds, n = 50.***p < 0.001, **p < 0.01, *p < 0.05. (D) Beating behavior of cardiomyocytes on different scaffolds on day 5 of culture. Red arrow represents the cell contraction vector diagram. Scale bars: 100 μm.

results (Figure 1 C) show that the Young’s modulus of gelatin scaffolds significantly increases when increasing the concentration of GO (within 0−2 mg/mL), ranging from 53.4 ± 3.0 kPa to 502.2 ± 30.0 kPa. Previous research has shown that the stiffness of the extracellular environment affects the phenotype and contractile properties of the heart cells.32,33 When the extracellular environment is too stiff or too elastic, the cells begin to structurally and functionally remodel. To mimic the stiffness of the native heart is an effective strategy when designing scaffolds for cardiac tissue engineering. The range of the stiffness of heart is 10−20 kPa at the early stage of diastole and around 200−300 kPa at the end of the diastole.34 The gelatin hydrogels incorporated with GO solution at a concentration of 0.25 mg/mL (GO0.25) result in Young’s modulus of 96.8 ± 9.7 kPa, demonstrating an acceptable

therefore will not have negative effects on the junction formation of CMs. The average functional intercapillary distance in rat heart is around 20 μm, and previous studies have proposed 10−15 μm in spacing width and ∼700 nm in groove depth as the ideal size for enhancing the elongation of neonatal rat CM.2,10,31 In order to induce CMs to form the anisotropic cell construction on scaffolds behaving like native myocardium, we adopted the micropatterns on hydrogels with a width of 15 μm and the average groove depth of 600 nm (Figure S2B,D). The depth is shallower than the PDMS mold (1 μm in depth) because the gelatin shrinks slightly after crosslinking with genipin. The mechanical properties of wet hydrogel scaffolds with and without GO were characterized to evaluate their ability to accommodate strain from cardiac beating using AFM. The 3026


Article


24 h after seeding on gelatin scaffolds. The proteins of sarcomeric α-actinin and connexin-43 (Cx43) in cardiomyocytes were immunostained to visualize the intracellular architecture and gap junction. The results showed that αactinin in red was expressed in abundance on day 1, while the sarcomere was not well organized. The green signal from Cx43 was weak, meaning that the gap junction protein was rarely expressed (Figure 3A). On day 2, the sarcomere structure related to α-actinin has become better organized and the Cx43 expression was getting higher compared to those occurred on day 1 (Figure 3B). Moreover, the α-actinin coverage of cardiomyocytes experienced a dramatic increase on gelatin scaffolds after 2 days of culture, from 1393 ± 169 μm2 on day 1 to 5178 ± 310 μm2 on day 2 (Figure 3C,D), corresponding to the enlargement trend from fetal cardiomyocytes to maturing cardiomyocytes.28 Electrophysiological behavior of cardiomyocytes has been assessed by incubating with a calcium-sensitive dye (Fluo-4 AM), and the green fluorescence intensity of the dye in cardiomyocytes was obtained by computational analysis of the recorded video. Four randomly selected individual cardiomyocytes were analyzed and quantified according to the fluorescence intensity (Figure 3C−F). According to Figure 2C, the corresponding quantified fluorescence intensity (Figure 3E) revealed that the cells were beating randomly, in an unsynchronized beating manner on day 1. While on day 2, the individual cardiomyocytes were beating synchronously (Figure 3F), demonstrating a delicate coupling of both impulse propagation and contractile behavior. The differences of cell behavior on gelatin scaffolds on day 1 and day 2 are schematically summarized in Figure 3G,H. The significant differences are in the aspect of cell size, actin cytoskeleton, gap junction, and calcium transient. In this system, the cardiomyocytes seeded on gelatin scaffolds start to beat on day 1 of culture. Their electrophysiological and contractile function can be significantly improved within 2 days. When cultured for 4 days, cardiomyocytes can drive the scaffold swimming in the medium (Movie S1). When cultured for 1 month, it is observed that cardiomyocytes spontaneously assemble to form myocardium strips (Movie S2). Functional cardiomyocytes on gelatin scaffolds can survive and keep beating for up to 3 months (Movie S3). The above fact has exhibited the advantage of our gelatin scaffolds for application in cardiac tissue engineering. 3.3. CM Alignment on Micropatterned Scaffolds. Micropatterned structure was popularly used to culture cardiomyocytes to obtain good cell alignment.35 Combined with our previous study, we further tested the different behavior of CMs cultured on gelatin (Gel), micropatterned scaffold (Gel-P), and micropatterned scaffold containing 0.25 mg/mL GO (Gel-GO-P). After 3 and 5 days of culture, CMs were stained for nuclei, sarcomeric α-actinin, and Cx43. As illustrated in the α-actinin immunostains, sarcomere structures of the CMs cultured on the micropatterned scaffolds are better aligned. The sarcomeres within individual cells generally aligned in the same direction (Figure 4A). Thus, micropatterned scaffolds adopted in this study could provide cues for cardiac cells to form anisotropic tissue. However, no significant difference of Cx43 expression from CMs cultured on different gelatin-based scaffolds has been observed. Moreover, compared with 3 days of culture of CMs on all kinds of scaffolds, more CMs became binucleated on day 5, which is the indication of mature CM phenotype.28

Figure 5. Statistical evaluation of the beating velocity of cardiomyocytes on different gelatin-based scaffolds on day 5 of culture, n = 50. ***p < 0.001, **p < 0.01, *p < 0.05.

mechanical property for cardiac cell growth and tissue development. Furthermore, we performed the CCK-8 assay to detect the cell viability at different dosages of graphene oxide. As shown in Figure S3, GO presented no significant cytotoxicity at a concentration no higher than 0.25 mg/mL. Therefore, GO solution at a concentration of 0.25 mg/mL (GO0.25) is used in the following experiments when preparing GO-containing gelatin hydrogels. Scanning electron microscopy (SEM) was employed to compare the morphology of the pure Gel (Figure 2A,C) and Gel-GO hydrogels (Figure 2B,D). Both hydrogels showed highly porous surfaces with a uniform pore size. A large number of wrinkled structures on Gel-GO hydrogel surface suggest that the GO sheets were homogeneously distributed inside the hydrogels and increased the surface roughness (Figure 2B). However, the internal morphology of Gel-GO hydrogels appeared to be significantly affected by the addition of GO sheets. Gel hydrogels have more regular structures (Figure 2C) compared with Gel-GO hydrogels. The pore wall surfaces with wrinkled and crumpling edges within Gel-GO hydrogels confirmed the distribution of GO sheets inside the hydrogels (Figure 2D). So far, we have prepared gelatin-based hydrogel scaffolds with desired properties based on the following strategies: biocompatible genipin is applied to moderately cross-link thermosensitive gelatin hydrogels to achieve stable and biocompatible hydrogel scaffolds; the incorporation of GO at a proper concentration can render the scaffolds a similar stiffness to the native heart, providing an acceptable mechanical property for cardiac cell growth and tissue development; the groove-ridge-like micropatterns are introduced on hydrogel surfaces to promote better cell alignment and development of elongated cell constructs behaving like native myocardium. Among the above strategies, mimicking the stiffness of the native heart is the key point when designing scaffolds for cardiac tissue engineering.32,33 The combination of above strategies may provide an ideal hydrogel scaffold to support long-term culture of functional cardiomyocytes. The preparation procedure is straightforward and reproducible, offering a simple and effective method to produce scaffolds for cardiomyocytes. 3.2. Cardiomyocyte Attachment and Spontaneous Contraction on Gelatin Scaffolds. We tested the performance of cardiomyocytes seeded on gelatin scaffolds chemically cross-linked by genipin. Cardiomyocytes started to beat within 3027


Article


Figure 6. Gene expression analysis of α-actinin (Actn), cardiac troponin T (Tnnt), connexin-43 (Cx43), and sarcoplasmic reticulum Ca2+ATPase2a (Serca2a) from cardiomyocytes on different scaffolds. **p < 0.01, *p < 0.05 compared to Gel, n = 3−6.

N = 9) and day 5 (2.09 ± 0.08 μm, N = 12). The sarcomere lengths of CMs on micropatterned scaffolds (Gel-P and GelGO-P) are significantly larger than those on unpatterned scaffolds (Gel). For CMs on all three different scaffolds, the sarcomere length is increased with the culture time from 3 days to 5 days (Figure 4B). Additionally, for CM alignment, we adopted a previously developed detection algorithm to quantify sarcomeric orientational order parameter (OOP).36

For cardiomyocytes, the alignment and length of sarcomere structures are two vital parameters of assessing functional intracellular architecture. More aligned and longer sarcomere structures were found in mature heart cells compared to neonatal heart cells.28 The sarcomere length of mature rat cardiac myocytes in vivo ranges from 2.0 to 2.2 μm. As illustrated in Figure 4B, CMs cultured on Gel-GO-P scaffolds have the longest sarcomere length on day 3 (2.03 ± 0.06 μm, 3028


Article


distinct upregulation of mRNA on Gel-GO-P scaffolds, suggesting a more mature phenotype has developed. Maturation of calcium handling in cardiomyocytes involves sarcoplasmic reticulum (SR) calcium storage. Sarcoplasmic reticulum Ca2+-ATPase2a is the predominant active Ca2+ transporter in SR of CMs, functioning in both contraction and relaxation by regulating the amount of SR Ca2+.37 The upregulation of Serca2a contributed to the higher beating velocity of CMs on scaffolds containing GO on day 5 as shown in Figure 6. Another possible factor for the increased beating velocity in Gel-GO-P groups is the increased expression of Cx43, a cardiac gap-junctional protein which can accelerate the transmission of electrical signals among cells. The experimental results show upregulation of Cx43 on both patterned and GOcontained scaffolds. Taken together, CMs seeded on Gel-GOP were enhanced in Serca2a gene expression, sarcomeric alignment and length, cell size, and beating velocity, consequently resembling the features of in vivo physiological cardiac hypertrophy.

The values of quantified OOP from Gel-GO-P group on day 3 are larger than those from Gel-P group (Figure 4C). On day 5, the OPP values for both groups reach to a similar level. The OPP values for CMs on micropatterned scaffolds (Gel-GO-P and Gel-P) are larger than those on unpatterned scaffolds (Gel). Qualitative analysis of both sarcomere length and OPP also reveal significant improvement in forming functional cardiac tissue within micropatterned cardiomyocytes. CM alignment has functional consequences for electromechanical coupling and contractile force generation, rather than just an elongated anisotropic rod-like shape. Therefore, the ultimate demand of engineering aligned cardiac tissue in vitro is to induce aligned cell constructs and develop synchronous, robust cell beating behavior. Beating behavior of cardiomyocytes on different scaffolds were recorded as videos. The examples of cell contraction vector diagram with red arrows were shown in Figure 4D. The red arrow direction indicates the movement direction of pixels between two frames, while the length represents the moving distance. CMs indicated by computational motion-tracking on micropatterned scaffolds revealed that individual cells aligned with each other and started beating in a uniaxial manner, compared with the random beating behavior on gel scaffolds. Hence, the micropatterned scaffolds described here were effective in inducing CMs to form an elongated construct, leading to more enhanced sarcomeric alignment and synchronous contraction. Moreover, the length of most red arrows on Gel-GO-P is clearly longer than that on Gel or Gel-P, which indicated that the addition of GO further enhanced CM alignment and contractility. 3.4. Beating Velocity. To quantitatively investigate the difference of CMs beating behavior on different scaffolds, beating velocity has been calculated through computational motion-tracking information. Beating velocity is determined by the Ca2+ handling of sarcoplasmic reticulum (SR), as well as the developmentally regulated myocardium fiber.28 As illustrated in Figure 5, the quantified beating velocity (77 ± 11 μm/s, contraction; 62 ± 10 μm/s, relaxation) of CMs on Gel-GO-P has significantly increased compared with that on Gel-P (56 ± 12 μm/s, contraction, 42 ± 5 μm/s, relaxation) or on Gel (34 ± 16 μm/s, contraction; 29 ± 19 μm/s, relaxation) in both contraction and relaxation processes. These results demonstrated that the presence of GO further promoted beating velocity of CMs. 3.5. Quantitative PCR Test. Beating velocity is tightly related to the electromechanical ability of cardiomyocytes and regulated by diversified mRNAs. Therefore, in order to further investigate whether the incorporation of GO into gelatin scaffolds can facilitate functional cardiac activity, we tested the expression of cardiac-relevant genes, including genes for αactinin (Actn), cardiac troponin T (Tnnt), sarcoplasmic reticulum Ca 2+ -ATPase2a (Serca2a), and connexin-43 (Cx43), using RT-qPCR analysis after 3 and 5 days of culture. The analysis data are summarized in Figure 6. α-Actinin, a sarcomeric contractile protein, is necessary for the attachment of actin filaments to the Z-lines which form the borders of the sarcomere. The expressions of Actn showed significant upregulated on GO-contained scaffolds on day 5 compared with those on Gel and Gel-P scaffolds. Cardiac troponin T, a protein essential for the cardiac contraction, can be used to determine if a new biomaterial, culture condition, or stimulation regime promotes better maturation in comparison to a control or static culture.29 It was also observed with the

4. CONCLUSIONS In this study, we prepared gelatin-based hydrogels chemically cross-linked by genipin as scaffolds which are favorable for the maturation of cultured neonatal rat ventricular cardiomyocytes, including rapid development of cell size, actin cytoskeleton, gap junction, and calcium transient. By introducing the grooveridge-like micropatterns on hydrogel surfaces, sarcomere structures within the individual cardiomyocytes are better aligned in the same direction. Moreover the micropatterned scaffolds described here are effective in inducing CMs to develop elongated constructs and promoting synchronous contraction. The further addition of GO to the scaffolds is demonstrated to enhance cell alignment and beating velocity of cultured cardiomyocytes, as illustrated by quantified sarcomere length, OOP values, and the gene expression levels. This study could be of great importance in the design of biomaterial scaffolds that can improve the maturation, contractility, and electrophysiological function of cardiomyocytes for cardiac tissue regeneration.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsbiomaterials.9b00515. Characterization of PDMS mold and graphene oxide; 3D height images of gelatin-based scaffolds by AFM; viability of cardiac cells on gelatin scaffolds with different concentration of graphene oxide (PDF) Supporting movie S1: cardiomyocytes drive the material swimming (AVI) Supporting movie S2: myocardium strips formation (AVI) Supporting movie S3: long-term culture of cardiomyocytes on the hydrogels (AVI)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Tel: +86 25 83790820. Fax: +86 25 83795635. ORCID

Ning-Ping Huang: 0000-0001-6522-840X 3029


Article

ACS Biomaterials Science & Engineering Notes

hydrogels for engineering cardiac tissue constructs. Acta Biomater. 2016, 41, 133−146. (16) Shin, S. R.; Aghaei-Ghareh-Bolagh, B.; Dang, T. T.; Topkaya, S. N.; Gao, X.; Yang, S. Y.; Jung, S. M.; Oh, J. H.; Dokmeci, M. R.; Tang, X. S.; Khademhosseini, A. Cell-laden Microengineered and Mechanically Tunable Hybrid Hydrogels of Gelatin and Graphene Oxide. Adv. Mater. 2013, 25, 6385−6391. (17) Wang, Y.; Li, Z.; Wang, J.; Li, J.; Lin, Y. Graphene and graphene oxide: biofunctionalization and applications in biotechnology. Trends Biotechnol. 2011, 29, 205−212. (18) Nel, A. E.; Mädler, L.; Velegol, D.; Xia, T.; Hoek, E. M. V.; Somasundaran, P.; Klaessig, F.; Castranova, V.; Thompson, M. Understanding biophysicochemical interactions at the nano−bio interface. Nat. Mater. 2009, 8, 543−557. (19) Adeel, M.; Bilal, M.; Rasheed, T.; Sharma, A.; Iqbal, H. M. N. Graphene and graphene oxide: Functionalization and nano-biocatalytic system for enzyme immobilization and biotechnological perspective. Int. J. Biol. Macromol. 2018, 120, 1430−1440. (20) Ruiz, O. N.; Fernando, K. A. S.; Wang, B.; Brown, N. A.; Luo, P. G.; McNamara, N. D.; Vangsness, M.; Sun, Y.; Bunker, C. E. Graphene Oxide: A Nonspecific Enhancer of Cellular Growth. ACS Nano 2011, 5, 8100−8107. (21) Yang, D.; Li, T.; Xu, M.; Gao, F.; Yang, J.; Yang, Z.; Le, W. Graphene oxide promotes the differentiation of mouse embryonic stem cells to dopamine neurons. Nanomedicine 2014, 9, 2445−2455. (22) Park, J.; Kim, B.; Han, J.; Oh, J.; Park, S.; Ryu, S.; Jung, S.; Shin, J.; Lee, B. S.; Hong, B. H.; Choi, D.; Kim, B. Graphene Oxide Flakes as a Cellular Adhesive: Prevention of Reactive Oxygen Species Mediated Death of Implanted Cells for Cardiac Repair. ACS Nano 2015, 9, 4987−4999. (23) Zhang, L.; Xia, J.; Zhao, Q.; Liu, L.; Zhang, Z. Functional Graphene Oxide as a Nanocarrier for Controlled Loading and Targeted Delivery of Mixed Anticancer Drugs. Small 2010, 6, 537− 544. (24) Weaver, C. L.; Cui, X. T. Directed Neural Stem Cell Differentiation with a Functionalized Graphene Oxide Nanocomposite. Adv. Healthcare Mater. 2015, 4, 1408−1416. (25) Mathur, A.; Loskill, P.; Shao, K.; Huebsch, N.; Hong, S.; Marcus, S. G.; Marks, N.; Mandegar, M.; Conklin, B. R.; Lee, L. P.; Healy, K. E. Human iPSC-based Cardiac Microphysiological System For Drug Screening Applications. Scientific Reports 2015, 5, 8883. (26) Chen, A.; Mu, W.; Chen, Y. Compressive elastic moduli and polishing performance of non-rigid core/shell structured PS/SiO2 composite abrasives evaluated by AFM. Appl. Surf. Sci. 2014, 290, 433−439. (27) Radisic, M.; Euloth, M.; Yang, L.; Langer, R.; Freed, L. E.; Vunjak-Novakovic, G. High-density seeding of myocyte cells for cardiac tissue engineering. Biotechnol. Bioeng. 2003, 82, 403−414. (28) Robertson, C.; Tran, D. D.; George, S. C. Concise Review: Maturation Phases of Human Pluripotent Stem Cell-Derived Cardiomyocytes. Stem Cells 2013, 31, 829−837. (29) Stoppel, W. L.; Kaplan, D. L.; Black, L. D. Electrical and mechanical stimulation of cardiac cells and tissue constructs. Adv. Drug Delivery Rev. 2016, 96, 135−155. (30) Huebsch, N.; Loskill, P.; Mandegar, M. A.; Marks, N. C.; Sheehan, A. S.; Ma, Z.; Mathur, A.; Nguyen, T. N.; Yoo, J. C.; Judge, L. M.; Spencer, C. I.; Chukka, A. C.; Russell, C. R.; So, P.; Conklin, B. R.; Healy, K. E. Automated Video-Based Analysis of Contractility and Calcium Flux in Human-Induced Pluripotent Stem Cell-Derived Cardiomyocytes Cultured over Different Spatial Scales. Tissue Eng., Part C 2015, 21, 467−479. (31) Annabi, N.; Tsang, K.; Mithieux, S. M.; Nikkhah, M.; Ameri, A.; Khademhosseini, A.; Weiss, A. S. Highly Elastic Micropatterned Hydrogel for Engineering Functional Cardiac Tissue. Adv. Funct. Mater. 2013, 23, 4950−4959. (32) Bhana, B.; Iyer, R. K.; Chen, W. L. K.; Zhao, R.; Sider, K. L.; Likhitpanichkul, M.; Simmons, C. A.; Radisic, M. Influence of substrate stiffness on the phenotype of heart cells. Biotechnol. Bioeng. 2010, 105, 1148.

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was financially supported by the National Natural Science Foundation of China (Grant No. 31871017, 31671008), the Natural Science Foundation of Jiangsu Province, China (Grant No. BK20171352), the Key Program of Jiangsu Province (BE2016738), and the “111” Project (B17011, Ministry of Education of China).

■

REFERENCES

(1) Ogle, B. M.; Bursac, N.; Domian, I.; Huang, N. F.; Menasché, P.; Murry, C. E.; Pruitt, B.; Radisic, M.; Wu, J. C.; Wu, S. M.; Zhang, J.; Zimmermann, W.; Vunjak-Novakovic, G. Distilling complexity to advance cardiac tissue engineering. Sci. Transl. Med. 2016, 8, 342ps13. (2) Tandon, N.; Cannizzaro, C.; Chao, P. G.; Maidhof, R.; Marsano, A.; Au, H. T. H.; Radisic, M.; Vunjak-Novakovic, G. Electrical stimulation systems for cardiac tissue engineering. Nat. Protoc. 2009, 4, 155−173. (3) Dvir, T.; Timko, B. P.; Brigham, M. D.; Naik, S. R.; Karajanagi, S. S.; Levy, O.; Jin, H.; Parker, K. K.; Langer, R.; Kohane, D. S. Nanowired three-dimensional cardiac patches. Nat. Nanotechnol. 2011, 6, 720−725. (4) Kharaziha, M.; Shin, S. R.; Nikkhah, M.; Topkaya, S. N.; Masoumi, N.; Annabi, N.; Dokmeci, M. R.; Khademhosseini, A. Tough and flexible CNT−polymeric hybrid scaffolds for engineering cardiac constructs. Biomaterials 2014, 35, 7346−7354. (5) McCain, M. L.; Agarwal, A.; Nesmith, H. W.; Nesmith, A. P.; Parker, K. K. Micromolded gelatin hydrogels for extended culture of engineered cardiac tissues. Biomaterials 2014, 35, 5462−5471. (6) Radisic, M.; Park, H.; Shing, H.; Consi, T.; Schoen, F. J.; Langer, R.; Freed, L. E.; Vunjak-Novakovic, G. Functional Assembly of Engineered Myocardium by Electrical Stimulation of Cardiac Myocytes Cultured on Scaffolds. Proc. Natl. Acad. Sci. U. S. A. 2004, 101, 18129−18134. (7) Morgan, K. Y.; Black, L. D. Mimicking Isovolumic Contraction with Combined Electromechanical Stimulation Improves the Development of Engineered Cardiac Constructs. Tissue Eng., Part A 2014, 20, 1654−1667. (8) Parsa, H.; Ronaldson, K.; Vunjak-Novakovic, G. Bioengineering methods for myocardial regeneration. Adv. Drug Delivery Rev. 2016, 96, 195−202. (9) Alapan, Y.; Younesi, M.; Akkus, O.; Gurkan, U. A. Anisotropically Stiff 3D Micropillar Niche Induces Extraordinary Cell Alignment and Elongation. Adv. Healthcare Mater. 2016, 5, 1884−1892. (10) McDevitt, T. C.; Angello, J. C.; Whitney, M. L.; Reinecke, H.; Hauschka, S. D.; Murry, C. E.; Stayton, P. S. In vitro generation of differentiated cardiac myofibers on micropatterned laminin surfaces. J. Biomed. Mater. Res. 2002, 60, 472−479. (11) Valiente-Alandi, I.; Schafer, A. E.; Blaxall, B. C. Extracellular matrix-mediated cellular communication in the heart. J. Mol. Cell. Cardiol. 2016, 91, 228−237. (12) Erkoc, P.; Seker, F.; Bagci-Onder, T.; Kizilel, S. Gelatin Methacryloyl Hydrogels in the Absence of a Crosslinker as 3D Glioblastoma Multiforme (GBM)-Mimetic Microenvironment. Macromol. Biosci. 2018, 18, 1700369. (13) Liang, H. C.; Chang, W. H.; Liang, H. F.; Lee, M. H.; Sung, H. W. Crosslinking structures of gelatin hydrogels crosslinked with genipin or a water-soluble carbodiimide. J. Appl. Polym. Sci. 2004, 91, 4017−4026. (14) De Clercq, K.; Schelfhout, C.; Bracke, M.; De Wever, O.; Van Bockstal, M.; Ceelen, W.; Remon, J. P.; Vervaet, C. Genipincrosslinked gelatin microspheres as a strategy to prevent postsurgical peritoneal adhesions: In vitro and in vivo characterization. Biomaterials 2016, 96, 33−46. (15) Navaei, A.; Saini, H.; Christenson, W.; Sullivan, R. T.; Ros, R.; Nikkhah, M. Gold nanorod-incorporated gelatin-based conductive 3030


Article

ACS Biomaterials Science & Engineering (33) Galie, P. A.; Khalid, N.; Carnahan, K. E.; Westfall, M. V.; Stegemann, J. P. Substrate stiffness affects sarcomere and costamere structure and electrophysiological function of isolated adult cardiomyocytes. Cardiovasc. Pathol. 2013, 22, 219−227. (34) Prabhakaran, M. P.; Venugopal, J.; Kai, D.; Ramakrishna, S. Biomimetic material strategies for cardiac tissue engineering. Mater. Sci. Eng., C 2011, 31, 503−513. (35) Xu, C.; Wang, L.; Yu, Y.; Yin, F.; Zhang, X.; Jiang, L.; Qin, J. Bioinspired onion epithelium-like structure promotes the maturation of cardiomyocytes derived from human pluripotent stem cells. Biomater. Sci. 2017, 5, 1810−1819. (36) Pasqualini, F. S.; Sheehy, S. P.; Agarwal, A.; Aratyn-Schaus, Y.; Parker, K. K. Structural Phenotyping of Stem Cell-Derived Cardiomyocytes. Stem Cell Rep. 2015, 4, 340−347. (37) Godier-Furnémont, A. F. G.; Tiburcy, M.; Wagner, E.; Dewenter, M.; Lämmle, S.; El-Armouche, A.; Lehnart, S. E.; Vunjak-Novakovic, G.; Zimmermann, W. Physiologic force-frequency response in engineered heart muscle by electromechanical stimulation. Biomaterials 2015, 60, 82−91.

3031


Easy Applied Gelatin-Based Hydrogel System for ... - ACS Publications

Recommend Documents