Article pubs.acs.org/biochemistry
Effect of a K72A Mutation on the Structure, Stability, Dynamics, and Peroxidase Activity of Human Cytochrome c Shiloh M. Nold,†,§ Haotian Lei,†,§ Tung-Chung Mou,§,‡ and Bruce E. Bowler*,†,§ †
Department of Chemistry and Biochemistry, University of Montana, Missoula, Montana 59812, United States Division of Biological Sciences, University of Montana, Missoula, Montana 59812, United States § Center for Bimolecular Structure and Dynamics, University of Montana, Missoula, Montana 59812, United States ‡
S Supporting Information *
ABSTRACT: We test the hypothesis that Lys72 suppresses the intrinsic peroxidase activity of human cytochrome c, as observed previously for yeast iso-1-cytochrome c [McClelland, L. J., et al. (2014) Proc. Natl. Acad. Sci. U. S. A. 111, 6648− 6653]. A 1.25 Å X-ray structure of K72A human cytochrome c shows that the mutation minimally affects structure. Guanidine hydrochloride denaturation demonstrates that the K72A mutation increases global stability by 0.5 kcal/mol. The K72A mutation also increases the apparent pKa of the alkaline transition, a measure of the stability of the heme crevice, by 0.5 unit. Consistent with the increase in the apparent pKa, the rate of formation of the dominant alkaline conformer decreases, and this conformer is no longer stabilized by proline isomerization. Peroxidase activity measurements show that the K72A mutation increases kcat by 1.6−4-fold at pH 7−10, an effect larger than that seen for the yeast protein. X-ray structures of wild type and K72A human cytochrome c indicate that direct interactions of Lys72 with the far side of Ω-loop D, which are seen in X-ray structures of horse and yeast cytochrome c and could suppress peroxidase activity, are lacking. Instead, we propose that the stronger effect of the K72A mutation on the peroxidase activity of human versus yeast cytochrome c results from relief of steric interactions between the side chains at positions 72 and 81 (Ile in human vs Ala in yeast), which suppress the dynamics of Ω-loop D necessary for the intrinsic peroxidase activity of cytochrome c. ytochrome c (Cytc) was first recognized for its role as an intermediary in the electron transport chain.1 More recently, the range of its functions has expanded to include scavenging of reactive oxygen species, redox-mediated protein import, and most notably apoptosis.2 Initial work on the role of Cytc in apoptosis3 demonstrated that Cytc was released into the cytoplasm, where it interacts with apoptosis protease activating factor 1, Apaf-1, forming the apoptosome. The apoptosome activates caspase-9, ultimately leading to cell death. More recently, it has been shown that Cytc acts as a peroxidase when bound to the mitochondrial lipid cardiolipin (CL).4,5 Oxidation of cardiolipin leads to release of Cytc from the inner mitochondrial membrane and appears to aid in permeabilization of the outer mitochondrial membrane. Thus, the peroxidase activity is believed to be the earliest signal in the intrinsic pathway of apoptosis.5 When Cytc binds to CL-containing membranes, it is known to lead to loss of heme−Met80 ligation.5−7 Thus, it seems likely that the highly conserved surface loop, Ω-loop D, that encompasses residues 70−858,9 may be involved in mediating peroxidase activity. To act as a signaling agent, it is essential that the basal peroxidase activity of Cytc be minimal so that it can act as a true on/off switch. In the work presented here, we aim to understand how the sequence of the highly conserved Ω-loop D is designed to suppress peroxidase activity. In
C
© XXXX American Chemical Society
particular, we investigate the role of the absolutely conserved lysine at position 72 in modulating the basal peroxidase activity of human Cytc (Hu Cytc). In the X-ray structures of yeast iso1-cytochrome c (iso-1-Cytc)10 and horse Cytc,11 this residue lies across Ω-loop D making steric or hydrogen bonding contacts with residues 80−82 on the opposite side of the loop. These interactions might stabilize Ω-loop D, which positions Met80 for heme binding, limiting the basal peroxidase activity of Cytc. Previous work with iso-1-Cytc, which contains a trimethylated lysine at position 72 (tmK72),10 showed that when an alanine is introduced at position 72 (tmK72A variant), an alternate conformer of the protein with Met80 replaced with hydroxide in the sixth coordination site of the heme can form.12 An increase in peroxidase activity was also observed for this variant of iso-1-Cytc. Studies of the kinetics and thermodynamics of a His79-mediated alkaline transition with iso-1-Cytc showed that replacement of tmK72 with alanine destabilizes the native conformer relative to the alkaline conformer and increases the rate of formation of the alkaline conformer.13,14 These kinetic and thermodynamic results are consistent with Received: April 14, 2017 Revised: June 7, 2017 Published: June 9, 2017 A
DOI: 10.1021/acs.biochem.7b00342 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry
K3[Fe(CN)6], followed by separation from the oxidizing agent and exchange into 50 mM Tris (pH 7) using Sephadex G-25 chromatography. It was then concentrated to ∼16.5 mg/mL using centrifuge ultrafiltration (Amicon Ultra-4 10000 molecular weight cutoff). Screening for crystallization conditions was performed using the JCSG core I, JCSG core II, JCSG core III, JCSG core IV, PEGS, PEGS II, Wizard classic 1&2, Wizard classic 3&4, Classic, Classic II, and Classic Lite commercial screening suites at 20 °C. The ratio of protein to reservoir solution in the drops in the 96-well sitting drop screening plates was 1:1. We obtained initial crystals from JCSG core I, well A2, which has a reservoir solution that consists of 0.1 M Bicine (pH 8.5) and 20% (w/v) PEG 6000. Additional vapor diffusion crystallization experiments were set up in a 24-well VDX plate by expanding upon the pH and precipitant concentration of this initial condition. After equilibration for 4 days to 2 weeks at 20 °C, crystals were obtained from a drop containing 1 μL of protein and 1 μL of 25% PEG 6000 and 0.1 M Tris (pH 8), which diffracted to 1.8 Å at SSRL beamline 14-1. Further trials in the presence of sodium dodecyl sarcosine as an additive at a final concentration of 4.16 mM (60 mM stock) with a reservoir solution containing 30% PEG 3350 and 0.1 M sodium citrate (pH 6.4) and protein at 17.2 mg/mL (0.14:0.93:0.93 ratio) yielded crystals diffracting to 1.25 Å resolution in the P21 space group. All crystals were cryoprotected with 20% glycerol and flash-frozen in liquid N2 for data collection. The X-ray diffraction data set was collected under cryogenic conditions at 100 K at SMB beamline 9-2 of the Stanford Synchrotron Radiation Lightsource (SSRL) using a Pilatus 6 M detector. Diffraction data were processed using HKL2000.23 The initial electron density map was determined using phases obtained with the molecular replacement method using Phaser, incorporated in the PHENIX software suite,24 and the coordinates of the wild type human Cytc structure [Protein Data Bank (PDB) entry 3ZCF]25 as a search model. The initial model was built into a continuous electron density map and subsequently refined using PHENIX. The structural model was further refined to 1.25 Å resolution by multiple rounds of manual model rebuilding with COOT26 and restrained refinement with PHENIX using 5% of reflections for calculation of Rfree. Data collection and refinement statistics of the final model are summarized in Table 1. The coordinates and structure factors for K72A Hu Cytc have been deposited in the PDB as entry 5TY3. Global Unfolding by Guanidine Hydrochloride Denaturation. Global unfolding thermodynamics of WT and K72A Hu Cytc were determined by guanidine hydrochloride (GdnHCl) denaturation monitored by circular dichroism (CD) spectroscopy. Protein was oxidized with potassium ferricyanide and separated from oxidant by G-25 size exclusion chromatography in CD buffer [20 mM Tris (pH 7.5) and 40 mM NaCl]. Concentrations of GdnHCl stock solutions were determined using the empirical equation of Nozaki for the change in the refractive index relative to the background buffer.27 GdnHCl unfolding titrations were performed with an Applied Photophysics Chirascan CD spectrophotometer coupled to a Hamilton Microlab 500 Titrator. The change in ellipticity was monitored at 222 nm using 250 nm as background, θ222corr (θ222 − θ250). The protein concentration was 4 μM. θ222corr versus GdnHCl concentration denaturation curves were fit to eq 1 with SigmaPlot version 13 (Systat Software, Inc.), which assumes two-state unfolding and a linear
the enhanced peroxidase activity of the tmK72A variant of iso1-Cytc. However, a K72G variant of horse Cytc changes neither the midpoint pH for the alkaline conformational transition nor the stability of Ω-loop D,15 indicating that this residue may not affect the peroxidase activity of mammalian cytochromes c. In this work, we probe the effect of a K72A mutation on the properties of Hu Cytc. We show that the native structure is unaffected by this mutation. However, we observe significant perturbation of the kinetics and thermodynamics of the alkaline transition. We also show a significant enhancement of the peroxidase activity of K72A Hu Cytc relative to that of wild type (WT) Hu Cytc.
■
EXPERIMENTAL PROCEDURES Preparation of Human K72A Cytochrome c. The K72A variant of Hu Cytc was prepared via site-directed mutagenesis using the pBTR(HumanCc) plasmid provided by the laboratory of G. Pielak at the University of North Carolina (Chapel Hill, NC).16 pBTR(HumanCc) is derived from the pBTR1 plasmid17,18 through replacement of the yeast iso-1Cytc gene (CYC1) with a synthetic human cytochrome c gene.16,19 pBTR(HumanCc) like pBTR1 co-expresses the yeast heme lyase (CYC3) and uses it to covalently attach heme to the CSQCH heme recognition sequence of Hu Cytc. Doublestranded pBTR(HumanCc) DNA was prepared using BL21Gold(DE3) (Agilent Technologies) competent Escherichia coli cells and used as a template for site-directed mutagenesis with the Agilent Technologies QuikChange Lightning Site-Directed Mutagenesis Kit. The K72A oligonucleotide, d(GGAATACCTCGAGAACCCGGCGAAATACATCCCGGGCACG), and its reverse complement, K72A-r, were used for mutagenesis. The mutated DNA was transformed into TG-1 E. coli cells. Individual colonies were then grown in L-broth with ampicillin (10 mL of L-broth with 10 μL of 100 mg/mL ampicillin) at 37 °C overnight. The DNA was extracted and purified with the Promega Wizard Plus Miniprep DNA Purification System. The sequence was confirmed with an ABI 3130 genetic analyzer at the Genomics Core Facility at the University of Montana. Expression of Human Cytochrome c. WT and K72A Hu Cytc were expressed from the pBTR(HumanCc) plasmid after transformation into Ultra BL21 (DE3) E. coli competent cells (EdgeBio, Gaithersburg, MD) using the manufacturer’s protocol. Transformed cells were grown on 2xYT bacterial medium, as described previously,20 except with the addition of 100 μL of antifoam per liter of culture. On average, a 1 L culture yielded 4.7 g of pelleted cells. Protein extraction and purification were performed as described previously.14,20−22 In brief, cells were lysed with a French pressure cell followed by precipitation of contaminating proteins with 50% ammonium sulfate. After CM-sepharose cation exchange chromatography, protein was exchanged into 50 mM sodium phosphate (pH 7) by centrifuge ultrafiltration, flash-frozen in liquid N2, and stored at −80 °C until being used. Prior to experiments, WT and K72A Hu Cytc were purified by high-performance liquid chromatography using a Bio-Rad UNO S6 column, as previously described.20 Purified proteins were characterized by matrix-assisted laser desorption ionization time-of-flight (MALDI-ToF) mass spectrometry using a Bruker microflex mass spectrometer: m/ z 12234.78 for for WT Hu Cytc (expected, m/z 12234.03) and m/z 12175.17 for K72A Hu Cytc (expected, m/z 12176.94). Crystallization and Structure Determination of Human K72A Cytc. K72A Hu Cytc was oxidized with B
DOI: 10.1021/acs.biochem.7b00342 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry
weak absorbance band that reports on Met80−heme ligation of the native state of oxidized Cytc.31 The absorbance data were corrected for baseline drift using the absorbance at 750 nm, A750, as a baseline (A695corr = A695 − A750) and then converted to extinction coefficient ε695corr by dividing by concentration. Titrations were monitored at room temperature (22 ± 3 °C) at 175−200 μM protein in 100 mM NaCl. Titrations were performed by adding equal amounts of an appropriate concentration of NaOH and a 2× protein stock (350−400 μM protein in 200 mM NaCl) to keep the protein concentration constant throughout the experiment.32,33 Plots of ε695corr versus pH were used to determine the apparent pKa (pKapp) by fitting the data to eq 2 (SigmaPlot version 13), a modified form of the Henderson−Hasselbalch equation that evaluates the number of protons, n, linked to the alkaline conformational transition.
Table 1. X-ray Crystallography and Data Collection and Refinement Statistics PDB entry beamline wavelength (Å) resolution range (Å) space group unit cell dimensions a, b, c (Å) α, β, γ (deg) total no. of reflections no. of unique reflections redundancy completeness (%) mean I/σ(I) Wilson B factor Rsymb
5TY3 SSRL SMB 9-2 1.07 25.00−1.25 (1.29−1.25)a P21 56.8, 37.9, 60.3 90, 116.8, 90 1539904 62478 (5985)a 6.5 (5.3)a 97.8 (93.6)a 24.5 (6.1)a 10.85 0.07 (0.27)a Refinement
Rworkc Rfreec no. of total atoms protein ligands solvent total no. of protein residues root-mean-square deviation for bonds (Å) root-mean-square deviation for angles (deg) Ramachandran favored (%)d rotamer outliers (%)d average B factor macromolecules ligands solvent
ε695corr =
0.147 (0.194)a 0.166 (0.201)a 2204 1660 96 448 210 0.017 1.38 98 0.2 17.69 14.89 11.44 29.40
1 + 10n(pKapp− pH)
(2)
where εN and εAlk are the corrected extinction coefficients at 695 nm of the native and alkaline conformers, respectively. pH Jump Stopped-Flow Kinetic Measurements. The kinetics of the alkaline conformation transition were monitored via pH jump stopped-flow experiments performed with an Applied Photophysics SX20 stopped-flow apparatus at 25 °C. The conformational transition was monitored at 406 nm in the heme Soret region. Oxidized protein [Fe(III)−heme] was separated from ferricyanide using a G25 column equilibrated to and run with 0.1 M NaCl. The solution was adjusted to a protein concentration of 20 μM and pH 6 for upward pH jumps and pH ∼10 for downward pH jumps; 1:1 mixing with 0.1 M NaCl containing 20 mM buffer yields a final protein concentration of 10 μM in 10 mM buffer and 0.1 M NaCl. The following buffers were used for pH jump stopped-flow experiments: MES, pH 5.5−6.5; NaH2PO4, pH 6.75−7.5; Tris, pH 7.75−8.75; boric acid, pH 9.0−10.0; CAPS, pH 10.25−11.0. Samples were taken from the stopped-flow waste line, and the pH was measured directly after mixing experiments at each pH. Data were fit to a single- to quadruple-exponential equation, as appropriate. Peroxidase Activity Measurements. The peroxidase activity was measured with the colorimetric reagent, guaiacol, using previously reported conditions and procedures.12,34 The reaction was monitored using an Applied Photophysics SX20 stopped-flow apparatus at 25 °C. The formation of tetraguaiacol from guaiacol and H2O2 in the presence of Cytc is monitored at 470 nm. A 4 μM Cytc solution in 50 mM buffer was mixed with guaiacol in 50 mM buffer at 4-fold the desired final concentration to produce a 2 μM Cytc and 2-fold concentrated guaiacol stock in 50 mM buffer. This solution was mixed in a 1:1 ratio with 100 mM H2O2 in 50 mM buffer, yielding a final solution containing 1 μM Cytc, 50 mM H2O2, and guaiacol at the desired concentration in 50 mM buffer. The concentration was determined using the extinction coefficients of H2O2 (ε240 = 41.5 M−1 cm−1, the average of published values)35,36 and guaiacol (ε274 = 2150 M−1 cm−1).37 Buffers used for peroxidase experiments were the same as those used in pH jump experiments. Final guaiacol concentrations were 0, 2, 4, 6, 8, 10, 15, 20, 25, 30, 40, 50, 60, 80, 100, 150, and 200 μM. Data were fit using SigmaPlot version 13. The segment of the A470 versus time data with the greatest slope following the initial lag phase was used to obtain the initial velocity, v, at each
a
Data for the highest-resolution shell are given in parentheses. bRsym = ∑hkl∑i|Ii(hkl) − ⟨I(hkl)⟩|/∑hkl∑iIi(hkl), where Ii(hkl) is the ith observation of the intensity of reflection hkl. cRwork = ∑hkl||Fobs| − | Fcalc||/∑hkl|Fobs|, where Fobs and Fcalc are the observed and calculated structure factor amplitudes, respectively, for each reflection hkl. Rfree was calculated with 5% of the diffraction data that were selected randomly and excluded from refinement. dCalculated using MolProbity.28
dependence of the free energy of unfolding, ΔGu, on GdnHCl concentration.29,30 Native and denatured state baselines were also varied linearly with GdnHCl concentration. ⎧ θ222corr = ⎨θN + mN[GdnHCl] + (θD + mD[GdnHCl]) ⎩ ⎡ m[GdnHCl] − ΔGu°′(H 2O) ⎤⎫ ⎧ × exp⎢ ⎥⎬ ⎨1 ⎣ ⎦⎭ ⎩ RT ⎡ m[GdnHCl] − ΔGu°′(H 2O) ⎤⎫ + exp⎢ ⎥⎬ ⎣ ⎦⎭ RT
εN + εAlk × 10n(pKapp− pH)
(1)
where θN and mN are the intercept and slope of the native state baseline, respectively, θD and mD are the intercept and slope of the denatured state baseline, respectively, m is the slope of ΔGu with respect to GdnHCl concentration, and ΔGu°′(H2O) is the free energy of unfolding extrapolated to 0 M GdnHCl. Measurement of the Alkaline Transition by pH Titration. The alkaline conformational transition of WT and K72A Hu Cytc was monitored with a Beckman DU800 spectrophotometer using the absorbance at 695 nm, A695, a C
DOI: 10.1021/acs.biochem.7b00342 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry guaiacol concentration. The data were fit to a linear equation, and the slope from five repeats was averaged. The slope (dA470/ dt) was divided by the extinction coefficient of tetraguaiacol at 470 nm (ε470 = 26.6 mM−1 cm−1)38 and multiplied by 4 to produce the initial rate of guaiacol consumption, v. The initial rate, v, was divided by cytochrome c concentration, plotted against guaiacol concentration, and fit with eq 3 to obtain Km and kcat values.
■
kcat[guaiacol] v = [Cytc] K m + [guaiacol]
(3)
RESULTS Structure of K72A Human Cytc. Crystals of K72A Hu Cytc were prepared in the absence and presence of sodium dodecyl sarcosine as an additive. In both cases, K72A Hu Cytc crystallized in the P21 space group. The crystal obtained in the presence of the additive diffracted to a resolution of 1.25 Å (Table 1). A high-quality structural model with Rwork and Rfree values of 0.15 and 0.17, respectively (Table 1), was obtained. Figure 1 shows an overlay of the K72A Hu Cytc structure with
Figure 1. Overlay of the structures of K72A Hu Cytc (PDB entry 5TY3) and WT Hu Cytc (PDB entry 3ZCF).25 The K72A variant is colored light gray, and WT Hu Cytc is colored dark gray. The heme crevice loop (Ω-loop D, residues 70−85) is colored salmon for the K72A variant and tan for WT Hu Cytc. The heme and its environment, Met80, His18, and Tyr 67, are shown as stick models. The three lysine residues in Ω-loop D (Lys/Ala72, Lys73, and Lys79) are also shown as stick models.
Figure 2. Hydrogen bond network across Ω-loop D: (A) horse Cytc (PDB entry 1HRC), (B) WT Hu Cytc (PDB entry 3ZCF, chain A), and (C) K72A Hu Cytc (PDB entry 5TY3, chain A). Ω-Loop D is colored salmon. Residues in the H-bond network are labeled. Waters are shown as red spheres and hydrogen bonds as yellow dashed lines. In panel C, the 2mFobs − Fcalc electron density map for Ω-loop D (light blue) and for the waters (dark blue) is contoured at 1.2σ.
that of WT Hu Cytc. The structures are very similar. An allatom alignment of the K72A Hu Cytc structure with the WT Hu Cytc crystal structure (PDB entry 3ZCF;25 PyMol align function using chain A of each structure) yields a root-meansquare deviation (rmsd) of 0.18 Å. The methyl side chain of Ala72 of K72A Hu Cytc is in the same position as the β-carbon of Lys72 of WT Hu Cytc (Figure 1). Lys72 of horse Cytc11 and trimethyllysine 72 (tmK72) of yeast iso-1-Cytc10 both lie across Ω-loop D making contacts with residues 80−82 on the far side of the loop. In the case of horse Cytc, Lys72 makes three hydrogen bonds to backbone atoms of Met80 and Phe82 (Figure 2A). In our previous work on a K72A variant of iso-1-Cytc,12 we proposed that removal of this cross loop interaction by replacement of tmK72 with
alanine labilized Ω-loop D, permitting enhanced peroxidase activity. Thus, it seemed likely that a similar phenomenon might be operative for Hu Cytc. However, in the structure of WT Hu Cytc,25 Lys72 does not make direct contacts with the backbone atoms of Met80 and Phe82 as seen for horse Cytc. In chain A of the WT Hu Cytc crystal structure, Lys72 makes water-mediated contacts with the backbone atoms of Thr78, Met80, and Phe82 (Figure 2B). In our K72A Hu Cytc crystal D
DOI: 10.1021/acs.biochem.7b00342 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry structure, the position of the ε-NH2 group of Lys72 in chain A of the WT structure is occupied by a water molecule (Figure 2C). However, in the other three molecules in the asymmetric unit of the WT Hu Cytc crystal structure, the hydrogen bond network around Lys72 does not lead to cross loop contacts (Figure S1). Instead, the water-mediated cross loop interactions in these molecules of WT Hu Cytc are similar to those in the two molecules in the asymmetric unit of our K72A Hu Cytc structure (Figure 2C and Figure S2). In particular, irrespective of the presence of lysine at position 72, there is always a hydrogen bond between the carbonyl of Leu68 and the amide NH of Ile85 at the neck of Ω-loop D (Figures 2, S1, and S2). Similarly, there is always a water-mediated hydrogen bond between the amide NH of residue 72 and the carbonyl of Phe82, which is often further supported by a water-mediated hydrogen bond to the side chain of Asn70 (Figures 2, S1, and S2). In many cases, the water-mediated hydrogen bond network extends the entire length of Ω-loop D. Global Unfolding of Human Cytc Variants. Global unfolding thermodynamics of WT20 and K72A Hu Cytc were monitored by CD at 25 °C and pH 7.5 with the use of GdnHCl as a denaturant. Figure 3 compares the denaturation curves,
midpoint, Cm, by ∼0.2 M and the stability, ΔGu°′(H2O), by ∼0.5 kcal/mol. Our previously reported stability parameters for Hu WT Cytc are similar to those listed in Table 2.20 Cm is unchanged; however, m increases by ∼0.2 kcal mol−1 M−1 when a sloping native state baseline is used, which leads to an increase of ∼0.5 kcal/mol in the stability of WT Hu Cytc. Local Unfolding via the Alkaline Conformational Transition. The local unfolding thermodynamics for the alkaline conformational transition of WT and K72A Hu Cytc were determined by pH titration, monitored at 695 nm to observe the loss of Met80−heme iron ligation31 when a lysine from Ω-loop D binds to the heme. A schematic representation of the human alkaline conformational transition is shown in Figure 4A. Lysines 72, 73, and 79 could all potentially bind to the heme. However, while all three lysines contribute to the alkaline conformer of yeast iso-1-Cytc expressed from E. coli,18 nuclear magnetic resonance (NMR) studies suggest only two distinguishable alkaline conformers exist for horse Cytc.39 Mutational analysis indicates that lysines 73 and 79 contribute to the alkaline transition of horse Cytc, but that Lys72 does not.15 Representative pH titration data for K72A Hu Cytc are compared to previously reported data for WT Hu Cytc20 in Figure 4B. Within error, ε695corr of the native form of Hu Cytc (pH His variant of iso1-cytochrome c: implications for the alkaline conformational transition of cytochrome c. Biochemistry 39, 13584−13594. (34) Wang, Z., Matsuo, T., Nagao, S., and Hirota, S. (2011) Peroxidase activity enhancement of horse cytochrome c by dimerization. Org. Biomol. Chem. 9, 4766−4769. (35) Nelson, D. P., and Kiesow, L. A. (1972) Enthalpy of decomposition of hydrogen peroxide by catalase at 25 °C (with molar extinction coefficients of H2O2 solutions in the UV). Anal. Biochem. 49, 474−478. (36) Noble, R. W., and Gibson, Q. H. (1970) The reaction of ferrous horseradish peroxidase with hydrogen peroxide. J. Biol. Chem. 245, 2409−2413. (37) Goldschmid, O. (1953) The effect of alkali and strong acid on the ultraviolet absorption spectrum of lignin and related compounds. J. Am. Chem. Soc. 75, 3780−3783. (38) Diederix, R. E. M., Ubbink, M., and Canters, G. W. (2001) The peroxidase activity of cytochrome c-550 from Paracoccus versutus. Eur. J. Biochem. 268, 4207−4216. (39) Hong, X., and Dixon, D. W. (1989) NMR study of the alkaline isomerization of ferricytochrome c. FEBS Lett. 246, 105−108. (40) Shah, R., and Schweitzer-Stenner, R. (2008) Structural changes of horse heart ferricytochrome c induced by changes of ionic strength and anion binding. Biochemistry 47, 5250−5257. (41) Hagarman, A., Duitch, L., and Schweitzer-Stenner, R. (2008) The conformational manifold of ferricytochrome c explored by visible and far-UV electronic circular dichroism spectroscopy. Biochemistry 47, 9667−9677. (42) Fersht, A. (1998) Structure and Mechanism in Protein Science, W. H. Freeman and Company, New York. (43) Bandi, S., and Bowler, B. E. (2015) Effect of an Ala81His mutation on the Met80 loop dynamics of iso-1-cytochrome c. Biochemistry 54, 1729−1742. (44) Hoang, L., Maity, H., Krishna, M. M., Lin, Y., and Englander, S. W. (2003) Folding units govern the cytochrome c alkaline transition. J. Mol. Biol. 331, 37−43. (45) Saigo, S. (1981) A transient spin-state change during alkaline isomerization of ferricytochrome c. J. Biochem. 89, 1977−1980. (46) Saigo, S. (1981) Kinetic and equilibrium studies of alkaline isomerization of vertebrate cytochromes c. Biochim. Biophys. Acta, Protein Struct. 669, 13−20. (47) Kihara, H., Saigo, S., Nakatani, H., Hiromi, K., Ikeda-Saito, M., and Iizuka, T. (1976) Kinetic study of isomerization of ferricytochrome c at alkaline pH. Biochim. Biophys. Acta, Bioenerg. 430, 225− 243. (48) Hasumi, H. (1980) Kinetic studies on isomerization of ferricytochrome c in alkaline and acid pH ranges by the circular dichroism stopped-flow method. Biochim. Biophys. Acta, Protein Struct. 626, 265−276. J
DOI: 10.1021/acs.biochem.7b00342 Biochemistry XXXX, XXX, XXX−XXX
Article
Biochemistry
Increased dynamics in the 40−57 Ω-loop of the G41S variant of human cytochrome c promote its pro-apoptotic conformation. Sci. Rep. 6, 30447. (65) Pandiscia, L. A., and Schweitzer-Stenner, R. (2015) Coexistence of native-like and non-native cytochrome c on anionic liposomes with different cardiolipin content. J. Phys. Chem. B 119, 12846−12859. (66) Pandiscia, L. A., and Schweitzer-Stenner, R. (2015) Coexistence of native-like and non-native partially unfolded ferricytochrome c on the surface of cardiolipin-containing liposomes. J. Phys. Chem. B 119, 1334−1349. (67) Mandal, A., Hoop, C. L., DeLucia, M., Kodali, R., Kagan, V. E., Ahn, J., and van der Wel, P. C. A. (2015) Structural changes and proapoptotic peroxidase activity of cardiolipin-bound mitochondrial cytochrome c. Biophys. J. 109, 1873−1884. (68) Margoliash, E., and Schejter, A. (1996) How does a small protein become so popular?: A succinct account of the developement of our understanding of cytochrome c. In Cytochrome c: A Multidisciplinary Approach (Scott, R. A., and Mauk, A. G., Eds.) pp 3−31, University Science Books, Sausalito, CA. (69) Rytömaa, M., and Kinnunen, P. K. J. (1995) Reversibility of the binding of cytochrome c to liposomes. J. Biol. Chem. 270, 3197−3202. (70) Yu, T., Wang, X., Purring-Koch, C., Wei, Y., and McLendon, G. L. (2001) A mutational epitope for cytochrome c binding to the apoptosis protease activation factor-1. J. Biol. Chem. 276, 13034− 13038. (71) Kluck, R. M., Ellerby, L. M., Ellerby, H. M., Naiem, S., Yaffe, M. P., Margoliash, E., Bredesen, D., Mauk, A. G., Sherman, F., and Newmeyer, D. D. (2000) Determinants of cytochrome c pro-apoptotic activity. The role of lysine 72 trimethylation. J. Biol. Chem. 275, 16127−16133. (72) Hao, Z., Duncan, G. S., Chang, C.-C., Elia, A., Fang, M., Wakeham, A., Okada, H., Calzascia, T., Jang, Y., You-Ten, A., Yeh, W.C., Ohashi, P., Wang, X., and Mak, T. W. (2005) Specific ablation of the apoptotic functions of cytochrome c reveals a differential requirement for cytochrome c and Apaf-1 in apoptosis. Cell 121, 579−591.
(49) Davis, L. A., Schejter, A., and Hess, G. P. (1974) Alkaline isomerization of oxidized cytochrome c. Equilibrium and kinetic measurements. J. Biol. Chem. 249, 2624−2632. (50) Rosell, F. I., Ferrer, J. C., and Mauk, A. G. (1998) Proton-linked protein conformational switching: definition of the alkaline conformational transition of yeast iso-1-ferricytochrome c. J. Am. Chem. Soc. 120, 11234−11245. (51) Alber, T., Sun, D. P., Nye, J. A., Muchmore, D. C., and Matthews, B. W. (1987) Temperature-sensitive mutations of bacteriophage T4 lysozyme occur at sites with low mobility and low solvent accessibility in the folded protein. Biochemistry 26, 3754−3758. (52) Ying, T., Zhong, F., Xie, J., Feng, Y., Wang, Z.-H., Huang, Z.-X., and Tan, X. (2009) Evolutionary alkaline transition in human cytochrome c. J. Bioenerg. Biomembr. 41, 251−257. (53) Martinez, R. E., and Bowler, B. E. (2004) Proton-mediated dynamics of the alkaline conformational transition of yeast iso-1cytochrome c. J. Am. Chem. Soc. 126, 6751−6758. (54) Radi, R., Thomson, L., Rubbo, H., and Prodanov, E. (1991) Cytochrome c-catalyzed oxidation of organic molecules by hydrogen peroxide. Arch. Biochem. Biophys. 288, 112−117. (55) Krishna, M. M., Maity, H., Rumbley, J. N., Lin, Y., and Englander, S. W. (2006) Order of steps in the cytochrome c folding pathway: evidence for a sequential stabilization mechanism. J. Mol. Biol. 359, 1410−1419. (56) Krishna, M. M., Lin, Y., Rumbley, J. N., and Englander, S. W. (2003) Cooperative omega loops in cytochrome c: role in folding and function. J. Mol. Biol. 331, 29−36. (57) Morison, I. M., Cramer Bordé, E. M., Cheesman, E. J., Cheong, P. L., Holyoake, A. J., Fichelson, S., Weeks, R. J., Lo, A., Davies, S. M. K., Wilbanks, S. M., Fagerlund, R. D., Ludgate, M. W., da Silva Tatley, F. M., Coker, M. S. A., Bockett, N. A., Hughes, G., Pippig, D. A., Smith, M. P., Capron, C., and Ledgerwood, E. C. (2008) A mutation of human cytochrome c enhances the intrinsic apoptotic pathway but causes only thrombocytopenia. Nat. Genet. 40, 387−389. (58) De Rocco, D., Cerqua, C., Goffrini, P., Russo, G., Pastore, A., Meloni, F., Nicchia, E., Moraes, C. T., Pecci, A., Salviati, L., and Savoia, A. (2014) Mutations of cytochrome c identified in patients with thrombocytopenia THC4 affect both apoptosis and cellular bioenergetics. Biochim. Biophys. Acta, Mol. Basis Dis. 1842, 269−274. (59) Johnson, B., Lowe, G. C., Futterer, J., Lordkipanidzé, M., MacDonald, D., Simpson, M. A., Sanchez-Guiú, I., Drake, S., Bem, D., Leo, V., Fletcher, S. J., Dawood, B., Rivera, J., Allsup, D., Biss, T., Bolton-Maggs, P. H. B., Collins, P., Curry, N., Grimley, C., James, B., Makris, M., Motwani, J., Pavord, S., Talks, K., Thachil, J., Wilde, J., Williams, M., Harrison, P., Gissen, P., Mundell, S., Mumford, A., Daly, M. E., Watson, S. P., and Morgan, N. V. (2016) Whole exome sequencing identifies genetic variants in inherited thrombocytopenia with secondary qualitative function defects. Haematologica 101, 1170− 1179. (60) Ong, L., Morison, I. M., and Ledgerwood, E. C. (2017) Megakaryocytes from CYCS mutation-associated thrombocytopenia release platelets by both proplatelet-dependent and -independent processes. Br. J. Haematol. 176, 268−279. (61) Josephs, T. M., Morison, I. M., Day, C. L., Wilbanks, S. M., and Ledgerwood, E. C. (2014) Enhancing the peroxidase activity of cytochrome c by mutation of residue 41: implications for the peroxidase mechanism and cytochrome c release. Biochem. J. 458, 259−265. (62) Josephs, T. M., Liptak, M. D., Hughes, G., Lo, A., Smith, R. M., Wilbanks, S. M., Bren, K. L., and Ledgerwood, E. C. (2013) Conformational change and human cytochrome c function: mutation of residue 41 modulates caspase activation and destabilizes Met-80 coordination. JBIC, J. Biol. Inorg. Chem. 18, 289−297. (63) Liptak, M. D., Fagerlund, R. D., Ledgerwood, E. C., Wilbanks, S. M., and Bren, K. L. (2011) The proapoptotic G41S mutation to human cytochrome c alters the heme electronic structure and increases the electron self-exchange rate. J. Am. Chem. Soc. 133, 1153−1155. (64) Karsisiotis, A. I., Deacon, O. M., Wilson, M. T., Macdonald, C., Blumenschein, T. M. A., Moore, G. R., and Worrall, J. A. R. (2016) K
DOI: 10.1021/acs.biochem.7b00342 Biochemistry XXXX, XXX, XXX−XXX
