Effect of E-Beam Treatment on the Chemistry and on the Antioxidant

Article pubs.acs.org/JAFC

Effect of E‑Beam Treatment on the Chemistry and on the Antioxidant Activity of Lycopene from Dry Tomato Peel and Tomato Powder M. Carmen Gámez,† Marta M. Calvo,*,‡ M. Dolores Selgas,† M. Luisa García,† Katrin Erler,§ Volker Böhm,§ Assunta Catalano,∥ Rossella Simone,∥ and Paola Palozza∥ †

Department of Nutrition, Bromatology and Food Technology, Faculty of Veterinary, Complutense University, 28040 Madrid, Spain Institute of Food Science Technology and Nutrition, ICTAN-CSIC. C/Juan de la Cierva 3, 28006 Madrid, Spain § Institute of Nutrition, Friedrich Schiller University Jena, Dornburger Straße 25-29, D-07743 Jena, Germany ∥ Institute of General Pathology, Catholic University School of Medicine, Largo F Vito, I-00168 Roma, Italy ‡

ABSTRACT: Tomato powder (TP) and dry tomato peel (DTP) have been previously used in our laboratory as a source of lycopene to manufacture meat products ready-to-eat (RTE) submitted to E-beam irradiation with good technological and sensory results. Present work describes the studies performed in order to investigate the effect of radiation on chemical changes and antioxidant properties of lycopene. DTP and TP were irradiated (4 kGy). Changes on lycopene were analyzed by HPLC; inhibition of reactive oxygen species (ROS), possible modulation of mitogen-activated protein kinases (MAPK) cascade, nuclear factor κ-light-chain-enhancer of activated B cells (NP-κB) activation and expression of proteins involved in oxidation stress were analyzed in RAT-1 fibroblasts cell culture. Radiation reduced the content of all-E-lycopene and increased (Z)-lycopene, lycopene isomerization, and degradation being higher in DTP than in TP. E-Beam treatment increased the antioxidant ability of both DTP and TP in inhibiting spontaneous and H2O2-induced oxidative stress in cultured fibroblasts. Antioxidant activity was higher in DTP than in TP samples. KEYWORDS: tomato peel, tomato powder, radiation, lycopene antioxidant activity, lycopene changes

■

INTRODUCTION

problem that involves the removal of the surplus and byproducts from the tomato industry. E-Beam treatment has been identified as a new nonthermal technology that can eliminate pathogenic microorganisms from raw foods in both the fresh and frozen state,15 and it has been successfully used in fish and crustacean,16,17 chestnuts,18 mushrooms,19 meat products, etc.20,21 Radiation is known to cause several changes in lipids and proteins that lead to undesirable changes in odor and color, which can affect consumer acceptance of the product; the changes depend on the product and on the radiation dosage. In previous works performed in our laboratory, ready-to-eat functional meat products were designed in which the E-beam treatment was applied to ensure the hygienic quality. DTP and TP were used as source of lycopene as bioactive compound. The results obtained indicated that doses up to 4 kGy are useful to obtain a good microbiological and technological quality.22,23 At the moment, however, it is not clear if the E-beam treatment may result in changes in the lycopene from tomato products (DTP and TP) which could compromise the physiological activity of this carotene. For that, the objective of this work is to analyze the effect of this irradiation treatment on the levels of lycopene isomerization and degradation and its antioxidant activity, its ability in inhibiting intracellular reactive

Epidemiological and clinical studies have suggested health benefits of tomatoes and tomato-based food products.1,2 Dietary intake of tomato and tomato products has been shown to be associated with decreased risk of cardiovascular diseases3 and of certain cancers, including those of the digestive tract, prostate, and pancreas.4 Lycopene is responsible for the deep-red color of tomatoes and tomato-based foods, and it is the most representative carotenoid in ripe tomato. In recent years, there have been suggestions that lycopene may be responsible for the health benefits of tomato-based food products. Although several mechanisms have been implicated in such beneficial effects, one of the most evoked is lycopene’s ability as an antioxidant agent.5 Food enrichment with lycopene and/or tomato products may represent a good strategy to improve health. Ahuja et al.6 added tomato to olive oil and Sahin et al.7 to quail egg. In the case of meat products, tomato paste was added to beef patties,8 to frankfurters,9 or to low-fat sausages;10 tomato juice was added to low-fat pork sausages.11 Calvo et al.12 patented a method to add dry tomato peel (DTP) to meat and fish products with good results.13,14 They proposed partial removal of water by centrifugation, and consequently soluble compounds, before drying to obtain tomato powder (TP) (unpublished data). Both DTP and TP can be considered as good sources of lycopene for food enrichment. The main advantage of addition of DTP and TP is that it is not necessary for lycopene extraction by organic solvents or supercritical fluids, eliminating the associated costs. Moreover, they contribute to solving the environmental © 2014 American Chemical Society

Received: Revised: Accepted: Published: 1557

October 29, 2013 January 23, 2014 January 29, 2014 January 29, 2014 dx.doi.org/10.1021/jf4048012 | J. Agric. Food Chem. 2014, 62, 1557−1563

Journal of Agricultural and Food Chemistry

Article

HPLC of lycopene isomers, peak areas were used to calculate isomer ratios. Thus, exact contents of different lycopene isomers were not determined. Cell Culture. RAT-1 fibroblasts have been used because they are a cellular line successfully used to study the antioxidant activity of lycopene.26 The RAT-1 fibroblasts (American Type Culture Collection, Rockville, MD) were grown in Minimun Essential Medium Eagle (MEM) with streptomycin 100 μg/mL, penicillin 100 μg/mL, and supplemented with 10% fetal calf serum and 2 mM glutamine. Cells were maintained in log phase by seeding twice a week at density of 3 × 105 cells/mL at 3 °C under 5% CO2 air atmosphere. One milliliter of tetrahydrofuran (THF) was added to DTP and TP (0.5 g), and 2 μL of these solutions were added per 1 mL of MEM medium containing 106 cells for 24 h, and ROS production was measured after 30 and 60 min of incubation in the absence or in the presence of 100 μM H2O2. The solutions with THF were prepared immediately before each experiment in order to avoid lost of lycopene. After the addition of tomato extracts, the medium was not further replaced throughout the experiments. Control cultures received an equal amount of solvent (THF) but without tomato extracts. Experiments were routinely carried out on triplicate cultures. Intracellular radical species were detected by measuring the fluorescence intensity values due to oxidation of DCF (see below). Measurement of ROS. Cells were harvested to evaluate the ROS production using the di(acetoxymethyl ester) analogue (C-2938) of 6carboxy-2′,7′-dichlorodihydrofluorescein diacetate.27 Before the addition of the fluorescent probes, 2 × 106 cells were washed to eliminate the amount of tomato products not cell-associated. Fluorescent units were measured in each well after 30 min incubation with DCF (10 μM) by use of a Cytofluor 2300/2350 fluorescence measurement system (Millipore Corp., Bedford, MA). Tomato products did not alter the basal fluorescence of DCF. Then cells were treated with 100 μM H2O2 for 30−60 min in order to amplify ROS production. Western Blot Analysis of p38 and p-p38, ERK1/2, pERK1/2, JNK, p-JNK, Nox-4, and Cox-2 Expression. Cells (10 × 106) were harvested, lysed, and centrifuged. The supernatants were used for Western blot analysis.28 The anti-p38 (clone C-20, catalogue no. SC535), anti p-p38 (clone D-8, catalogue no. 7973), anti-ERK1/2 (clone K-23, catalogue no. SC-94), anti p-ERK1/2 (clone E-4, catalogue no. SC-7383), anti-JNK (clone C-17, catalogue no. SC-474), anti-p-JNK (clone G-7, catalogue no. SC-6254), anti-Nox-4 (clone N-15, catalogue no. sc-21860), and anti-Cox-2 (clone C-20, catalogue no. 1745) monoclonal antibodies, and the antihsp 70 (clone K-20, catalogue no. sc-1060) and the anti-hsp90α (clone C-20, catalogue no. sc-8262 goat) polyclonal antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The blots were washed and exposed to horseradish peroxidase-labeled secondary antibodies (Amersham Pharmacia Biotech, Arlington Heights, IL) for 45 min at room temperature. The immunocomplexes were visualized by the enhanced chemiluminescence detection system and quantified by densitometric scanning. Electrophoretic Mobility Shift Assay. Frozen cell pellets were processed to obtain nuclear extracts. The pellet was treated as previously indicated by Joo et al.29 Binding reactions containing 5 μg of nuclear extracts, 10 mM Tris-HCl (pH 7.6), 5% glycerol, 1 mM EDTA, 1 mM DTT, 50 mM NaCl, and 3 mg poly(dI-dC) were incubated for 30 min with 5000 cpm of α-32P-end-labeled doublestranded oligonucleotide in a total volume of 20 μL. The probe was 5′AGTTGAGGGGACTTTCCCAGGC3′. Labeling of the probe was obtained by incubating 5 pmol of oligonucleotide with 10 pmol [α-32P] ATP and 3U T4 polynucleotide kinase for 30 min at 37 °C. The probe was then purified with MicroBIO-Spin P-30 columns. Complexes were separated on 60 g/L polyacrylamide gels with 45 mM Tris-borate, 1 mM EDTA, pH 8, buffer. After drying under vacuum, gels were exposed on phosphor screens which were then analyzed by phosphor/fluorescence imager STORM 840 (Molecular Dynamics, Sunnyvale, CA). The intensity of the revealed bands were directly quantified by Image QuaNT software (Molecular Dynamics, Sunnyvale, CA).

oxygen species (ROS) production, and in modifying redoxsensitive molecular pathways.

■

MATERIALS AND METHODS

Chemicals. Tomatoes (Solanum lycopersicum L.) were obtained from a local market. Methanol (MeOH), methyl tert-butyl ether (MTBE), tetrahydrofuran (THF), and all others solvents used were of HPLC grade. A Millipore Milli-Q purification system (Millipore GmbH, Schwalbach, Germany) was used to obtain HPLC-grade water (18 MΩ). Carotenoids used were obtained from CaroteNature (Ostermundigen, Switzerland). Di(acetoxymethyl ester) analogue (C-2938) 6-carboxy-2′,7′-dichlorodihydrofluorescein diacetate (DCF) (Molecular Probes, Inc., Eugene, OR). Ethylene diamine tetraacetic acid (EDTA), DL-dithiothreitol (DTT), poly(deoxyinosinicdeoxycytidylic) acid (Poly(dI-dC)), and T4 polynucleotide kinase were obtained from Sigma-Aldrich at highest quality available (95− 99%). Buffer salts and all other chemicals were of analytical grade. The concentrations of the carotenoid standard solutions were determined using standard spectrophotometric methods.24 Dry Tomato Peel (DTP) Preparation. Tomato peel was separated from the pulp using a tomato processing machine after cleaning with fresh water, then peel was freeze-dried in a Virtis lyophilizer (model FM12XL). DTP were grounded with a mill (particle size 0.025−0.05 mm) and stored in darkness at −30 °C until use. Tomato Powder (TP) Preparation. Tomatoes were cleaned, ground, and centrifuged at 6000 g by 10 min at 5 °C. Supernatant was eliminated, and the pellet was dried in a Virtis lyophilizer (model FM12XL). The TP was ground with a mill (0.025−0.05 mm particle size) and stored in darkness at −30 °C until use. E-Beam Treatment. Both tomato products were packed (1 g weigh) into laminated bags of low permeability (35 cm3/24 h m2 bar for oxygen, 150 cm3/24 h m2 bar for CO2), vacuum-packaged, and transported in refrigeration to the irradiation plant (IONISOS Ibérica SA, Tarancón, Spain). This type of film is industrially used to manufacture vacuum packaged foods and guarantee the vacuum during storage of our samples. The treatment was performed with an electron accelerator which operated at 10 MeV. Doses of 4 kGy were applied which have been found to be effective to ensure spoilage and pathogen microbiota control.22,23 Cellulose triacetate dosimeters were used to check the actual dose absorbed.25 Experiments were made in triplicate and at a temperature of 15−18 °C. The temperature increased in the product less than 2 °C during E-beam treatment. DTP and TP were always protected from the light. The samples were under refrigerated conditions (4 °C) during transport, and subsequently they were stored at −30 °C until analysis. Both irradiated and nonirradiated samples were analyzed as follows. Analysis of Lycopene Composition and Quantification. Lycopene isomer composition as well as contents of lycopene were analyzed using a gradient C30-HPLC method using a Merck−Hitachi HPLC system (Darmstadt, Germany) and a Jetstream Plus column oven (JASCO, Groß-Umstadt, Germany).25 For quantification of lycopene, a sample extract of 500 mg was diluted in 25 mL of methanol/methyl tert-butyl ether (MTBE) (20/80 v/v). β-apo-8Carotenal was used as internal standard. A C30 column Trentec Stability 100 C30 PEEK (250 mm × 4.6 mm, 5 μm) (Trentec, Rutesheim, Germany), preceded by a C18 ProntoSil 120−5-C18 H (10 mm × 4.0 mm, 5 μm) column (Bischoff, Leonberg, Germany) was used. As mobile phase (1.0 mL/min), a gradient procedure consisting of MeOH (solvent A) and MTBE (solvent B) was used. Column temperature was 10 ± 1 °C and detection wavelength 470 nm. Lycopene contents were quantified using (all-E)-lycopene as external standard. For lycopene isomers, a different HPLC method was used: mobile phase (1.0 mL/min), MTBE/methanol/ethylacetate (50/45/5 v/v/v); column, polymeric C30 (250 mm × 4.6 mm, 5 μm) column (YMC Europe, Dinslaken, Germany); column temperature, 32 ± 1 °C; detection wavelength, 470 nm. Retention time of (Z)-isomer) in relation to that of (all-E)-lycopene was used to identify lycopene isomers. As only very low amounts of samples were available for 1558

dx.doi.org/10.1021/jf4048012 | J. Agric. Food Chem. 2014, 62, 1557−1563


Article

Table 1. Lycopene Isomers in Dry Tomato Peel (DTP) Tomato Powder (TP) Following Irradiationa ratios of (all-E)-lycopene to the different (Z) isomers DTP all-E/5Z all-E/5Z,9Z all-E/5Z,9′Z all-E/9Z all-E/13Z a

14.4 42.8 728.0 57.8 4.6

± ± ± ± ±

irradiated DTP a

0.5 1.2a 2.1c 0.9a 0.7c

7.3 32.3 317.0 33.4 3.0

± ± ± ± ±

b

0.4 1.3b 1.5d 2.1d 0.3d

TP 12.5 30.2 1360.0 61.4 10.6

± ± ± ± ±

irradiated TP c

0.8 0.7c 1.6a 1.5b 0.6a

10.7 26.9 1051.0 56.0 8.8

± ± ± ± ±

0.5d 1.4d 2.5b 1.9c 0.3b

Values not sharing the same letter were significantly different (P < 0.05, Fisher’s test).

Analysis of p65 Protein. Nuclear extracts, 25−30 μg of protein, were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis with 40−120 g/L Bis-Tris gels (NOVEX, San Diego, CA) and transferred to Immobilon-P membranes (Millipore Corp, Bedford, MA) with the use of a semidry system. Membranes were blocked overnight at 4 °C in 50 g/L dried milk in PBS, pH 7.4, plus 0.05% Tween 20. Blots were incubated with polyclonal primary antibodies to p65 (Santa Cruz, Biotechnology, CA, clone 49.Ser 311, catalogue no. SC-135769) in PBS plus 0.05% Tween 20 for 1−2 h at room temperature. The blots were visualized as described in Western blotting assay. Statistical Analysis. Values were presented as means ± standard error of the mean (SEM). One-way ANOVA was used to determine differences between different treatments (control and irradiated and nonirradiated tomato samples) in ROS production (Figure 1), MAPK expression (Figure 3) in NF-κB activation (Figure 4), and Cox-2 and Nox-4 expression (Figure 5). A posthoc comparison of means was made, using Fisher’s test, when significant values (P < 0.05) were found. Multifactorial two-way analysis of variance (ANOVA) was adopted to assess any differences among the treatments and the doses (Figure 2). A posthoc comparison of means was made, using the Tukey’s Honestly Significant Differences test, when significant values (P < 0.05) were found. Differences were analyzed using Minitab Software (Minitab, Inc., State College, PA).

agent H2O2. Antioxidant tomato efficiency was evaluated as inhibition of intracellular reactive oxygen species (ROS) production induced spontaneously or in the presence of the prooxidant (Figure 1). In the absence of the prooxidant, a very

■

Figure 1. ROS production in RAT-1 fibroblasts incubated, without tomato products (C), tomato powder (TP), and dry tomato peel (DTP), pretreated (I) or untreated with E-beam, as indicated in Materials and Methods section. Spontaneous (−H2O2) and H2O2induced ROS production in control cells and in treated cells, exposed, as indicated, to 100 μM H2O2 for 30−60 min. Values were the means ± SEM of three experiments. The treatment interaction was significant (P < 0.05). Values not sharing the same letter were significantly different (P < 0.005, Tukey’s test).

RESULTS AND DISCUSSION Influence of irradiation on lycopene concentration was measured. The dry tomato peel showed almost double lycopene content (0.2 ± 0.02 mM) compared to tomato powder (0.1 ± 0.01 mM). Irradiation exposure consumed the carotenoid by almost 50% for both extracts (0.10 ± 0.01 and 0.06 ± 0.01 mM to DTP and TP, respectively). A decrease in lycopene content by E-beam irradiation has been reported in grapefruit;30 these authors discussed evidence that lycopene levels decreased as the E-beam dose increased. The HPLC analyses revealed a reduction of (all-E)-lycopene with increasing peaks of lycopene (Z)-isomers following irradiation (Table 1). This effect was significantly stronger in the DTP samples than in TP. Lycopene has 11 conjugated double bonds, and each of them could be either in an E or Z configuration. all-E-Lycopene is the predominant isomer in plants, representing about 80−97% of total lycopene in tomatoes and related products.31 In the human body fluids and tissues such as plasma, breast milk, prostate, testis, and skin, 25−70% of lycopene is found in various Z forms.32,33 Shi and Le Maguer31 indicated that the biological potency of Zlycopene isomers is different from that of the all-E form. In terms of bioefficacy, some Z-isomers had a stronger in vitro antioxidant activity than the all-E form.34 These data may be particularly interesting in view of the high concentrations of Zisomers in vivo. The antioxidant activity of DTP and TP extracts, before and after irradiation, was analyzed in RAT-1 fibroblasts in the absence and in the presence of the well-known prooxidant

small amount of ROS production was observed but it increased significantly in the presence of H2O2. Treatment of RAT-1 fibroblasts with the different tomato extracts caused a significant decrease in ROS production with respect to control cells (C), which was remarkably evidenced during the incubation with H2O2. A weak, but significant inhibition of ROS production in the absence of H2O2 was also observed following tomato extracts treatment. Such an effect was more remarkable for DTP than for TP extracts and more evident for irradiated samples than for unirradiated ones. Such effects were specific for both extracts because cells treated with H2O2 and THF alone as a vehicle did not differ in ROS expression from cells treated with H2O2 alone (data not shown). The antioxidant effects of tomato extracts were clearly dosedependent as can be observed by the progressive decrease of H2O2-induced ROS production after the addition of increasing concentrations of the different tomato extracts to RAT-1 fibroblasts (Figure 2). The possible modulation of the MAPK cascade was analyzed in macrophages pretreated with the different tomato extracts to investigate intracellular redox signal transduction in RAT-1 cells 1559



Article

for TP and more evident for irradiated samples than for unirradiated ones. These data are not surprising in view of evidence showing that lycopene is a powerful in vitro antioxidant. Among naturally occurring carotenoids, lycopene has shown to possess ability in scavenging free radicals and in interacting with ROS, preventing ROS-induced cell damage.35 Accordingly, several epidemiological studies have evaluated the role of lycopene and tomato products as potential in vivo antioxidants. Although the data are sometimes controversial, using tomatoes or tomato products, numerous studies have demonstrated decreased DNA damage,36 decreased susceptibility to oxidative stress in lymphocytes,37 and decreased LDL oxidation5 or lipid peroxidation.38 Moreover, tomato extracts acted in this study as a potent inhibitor of the phosphorylation of MAPKs, which are reported to be activated by ROS. These data are in agreement with previous observations showing that lycopene, alone or in combination with other natural products, modulate MAPK phosphorylation.39 In particular, the carotenoid was reported to attenuate the phenotypic and functional maturation of murine bone marrow dendritic cells, especially in lipopolysaccharide (LPS)-induced DC maturation.40 The carotenoid was also able to inhibit platelet derived growth factor (PDGF)-BB-induced signaling and migration in human fibroblasts by inhibiting the activation of extracellular signalregulated kinase (ERK)1/2, p38, and jun N-terminal kinase (JNK).41 In view of recent studies suggesting that NF-κB plays an important role in regulating redox signaling, the involvement of this redox-sensitive transcription factor in THP-1 macrophages following the different tomato extracts was investigated (Figure 4A). In control cells, a net enhancement of nuclear trans-

Figure 2. H2O2-induced ROS production in the presence of varying concentrations (1−4 μL/mL) of tomato powder (TP) and dry tomato peel (DTP) or without tomato products (C), pretreated (I) or untreated with E-beam, as indicated in Materials and Methods section. RAT-1 fibroblasts were exposed to 100 μM H2O2 for 60 min. Values were the means ± SEM of three experiments. The treatment/dose interaction was significant (P < 0.05). Values were the means ± SEM of three experiments. Values not sharing the same letter were significantly different (P < 0.002, Tukey’s test).

(Figure 3). These kinases have been reported to be activated by various stress stimuli, including an overproduction of ROS, and they have been also implicated in the modulation of several intracellular redox functions. Remarkable levels of the phosphorylated forms of ERK1/2 (p-ERK1/2) (Figure 3A, B), JNK (p-JNK) (Figure 3C, D), and p-38 (p-p38) (Figure 3E, F) were observed in control cells after 3 h. Such levels were all decreased significantly by the addition of the different tomato extracts. Such inhibitions were more remarkable for DTP than

Figure 3. MAPK expression in RAT-1 fibroblasts pre-incubated with tomato powder (TP) and dry tomato peel (DTP) or without tomato products (C), pretreated (I) or untreated with E-beam, as indicated in Materials and Methods section. (A, C, E) Representative Western blotting analyses. (B, D, F) Densitometric analyses. Values were the means ± SEM of three experiments. Values not sharing the same letter were significantly different (P < 0.05, Fisher’s test). 1560



Article

Figure 4. NF-κB activation in THP in RAT-1 fibroblasts pre-incubated with tomato powder (TP) and dry tomato peel (DTP) or without tomato products (C), pretreated (I) or untreated with E-beam, as indicated in Materials and Methods section. (A) DNA binding activities of NF-κB subunits complexes. After treatment, the binding activities of NF-κB subunits to DNA were determined using EMSA. The specifity was demonstrated by using excess unlabeled NF-κB oligonucleotides (= cold ssNF-κB), which competed away binding. (B) Representative Western blotting analyses of p65 subunits. (C) Densitometric analyses. Values were the means ± SEM of three experiments. Values not sharing the same letter were significantly different (P < 0.05, Fisher’s test).

Figure 5. Cox-2 and Nox-4 expression in RAT-1 fibroblasts pre-incubated with tomato powder (TP) and dry tomato peel (DTP) or without tomato products (C), pretreated (I) or untreated with E-beam, as indicated in Materials and Methods section. (A, C) Representative Western blotting analyses and (B, D) densitometric analyses. Values were the means ± SEM of three experiments. Values not sharing the same letter were significantly different (P < 0.05, Fisher’s test).

location was evident at 3 h treatment. However, the upregulation of NF-κB nuclear binding was prevented by the addition of the different tomato extracts. In agreement with the previous results, the reductions were significantly higher for DTP extract than for TP extract and more evident for irradiated samples than for unirradiated ones. Similar results were found when nuclear extracts were prepared from fibroblasts treated with the different tomato extracts and nuclear translocation of

the NF-κB p65 subunit was detected by Western blotting (Figure 4B, C). In control cells, a nuclear translocation of the NF-κB subunit p65 was evidenced within 3 h. Such an effect was inhibited by the addition of the different tomato extracts and, once again, the inhibition was significantly greater for DTP than for TP extract and also was significantly affected by irradiation. 1561


Journal of Agricultural and Food Chemistry In recent studies from our laboratory, lycopene suppressed both MAPK phosphorylation and NF-κB activation in oxysterol-stimulated macrophages as well as in prostatic cancer cells.42 In addition, in this study, tomato extracts also inhibited H2O2-induced NF-κB activation, which has been reported to be the first eukaryotic transcription factor shown to respond directly to oxidative stress.43 It has been found that lycopene inhibited the binding activity of NF-κB in human hepatoma cells44 and in THP-1 cells exposed to cigarette smoke extract.45 Such inhibition was mediated by the down-regulation of IκB phosphorylation, NF-κB expression, and NF-κB p65 subunit translocation from cytosol to nucleus.46 Moreover, tomato lycopene extract prevented LPS-induced pro-inflammatory gene expression by blocking NF-κB signaling.29 Because it has been reported that cyclooxygenase-2 (Cox-2) and nicotinamide adenine dinucleotide phosphate oxidase (Nox) are proteins involved in oxidative stress, the expression of both of them in RAT-1 fibroblasts following the different tomato extracts was measured (Figure 5). The addition of all tomato extracts decreased significantly the expression of both Cox-2 and Nox-4 with respect to untreated control cells. The inhibition was significantly greater for DTP than for TP extract, and a significant influence of irradiation was observed showing irradiated samples a greater inhibition. Tomato extracts inhibited the expression of proteins involved in stress signaling, such as Nox-4, one of the homologues of NADPH oxidase, and Cox-2. These results confirming those obtained in THP-1 cells47 and in RAW 264.7 macrophages.48 The obtained results demonstrate that DTP had significantly (p < 0.05) higher concentration of total lycopene than TP. The higher lycopene content of DTP compared to the TP could probably explain its better antioxidant activity in our cell model. These results are not surprising because it has been reported that tomato peel can contain up to 5 times more lycopene than the whole tomato.49 Our study confirms the potency of tomato extracts containing lycopene in inhibiting oxidative stress in a cell model. In fact, all the extracts studied were able to counteract the effects of H2O2 on ROS formation and on redox-sensitive molecular targets involved in cell signaling, including MAPK and NF-κB, and on the expression of redox-sensitive proteins, including Nox-4 and Cox-2. All these events occurred in a range of carotenoid concentrations which can be reached in vivo after lycopene or tomato supplementation.36 The present study shows that E-beam treatment increased the antioxidant ability of both DTP and TP in inhibiting H2O2induced oxidative stress. Concomitantly, it reduced the content of all-E-lycopene and increased the levels of Z-lycopene. The addition of the two irradiated tomato products (DTP or TP) could be suitable to manufacture meat functional products, improving their antioxidant capacity.

■

■

ACKNOWLEDGMENTS

■

REFERENCES

Article

M.C. Gámez has been awarded a grant of personal mobility from the Spanish Ministerio de Educación y Ciencia.

(1) Agarwal, S.; Rao, A. V. Tomato lycopene and its role in human health and chronic diseases. Can. Med. Assoc. J. 2000, 163, 739−744. (2) Blum, A.; Monir, M.; Wirsansky, I.; Ben-Arzi, S. The beneficial effects of tomatoes. Eur. J. Intern. Med. 2005, 16, 402−404. (3) Willcox, J. K.; Catignani, G. L.; Lazarus, S. Tomatoes and cardiovascular health. Crit. Rev. Food Sci. Nutr. 2003, 43, 1−18. (4) Giovannucci, E. Tomatoes, tomato-based products, lycopene, and cancer: review of the epidemiologic literature. J. Natl. Cancer Inst. 1999, 91, 317−331. (5) Agarwal, S.; Rao, A. V. Tomato lycopene and low density lipoprotein oxidation a human dietary intervention study. Lipids 1998, 33, 981−984. (6) Ahuja, K. D. K.; Pittaway, J. K.; Ball, M. J. Effects of olive oil and tomato lycopene combination on serum lycopene, lipid profile, and lipid oxidation. Nutrition 2006, 22, 259−265. (7) Sahin, N.; Akdemir, F.; Orhan, C.; Kucuk, O.; Hayirli, A.; Sahin, K. Lycopene-enriched quail egg as functional food for humans. Food Res. Int. 2008, 41, 295−300. (8) Candogan, K. The effect of tomato paste on some quality characteristics of beef patties during refrigerated storage. Eur. Food Res. Technol. 2002, 215, 305−309. (9) Deda, M. S.; Bloukas, J. G.; Fista, G. A. Effect of tomato paste and nitrite level on processing and quality characteristics of frankfurters. Meat Sci. 2007, 76, 501−508. (10) Kim, S.; Sang-Keun, J.; Kumar, M. P. Quality of low-fat pork sausages with tomato powder as colour and functional additive during refrigerated storage. J. Food Sci. Technol. 2011, 48, 591−597. (11) Yilmaz, I.; Simsek, O.; Isikli, M. Fatty acid composition and quality characteristics of low-fat cooked sausages made with beef and chicken meat, tomato juice and sunflower oil. Meat Sci. 2002, 62, 253− 258. (12) Calvo, M. M.; Rodríguez. M. J.; Santa-María. J. G.; Selgas, M. D.; García, M. L. Productos cárnicos y de la pesca enriquecidos en licopeno mediante la adición de piel de tomate. Patent P200701670, 2007. (13) Calvo, M. M.; García, M. L.; Selgas, M. D. Dry fermented sausages enriched with lycopene from tomato peel. Meat Sci. 2008, 80, 167−172. (14) García, M. L.; Calvo, M. M.; Selgas, M. D. Beef hamburgers enriched in lycopene using dry tomato peel as an ingredient. Meat Sci. 2009, 83, 45−49. (15) Facts about Food Irradiation; ICGFI International Consultative Group on Food Irradiation: Geneva, 1999; https://apps.who.int/fsf/ whopb3.htm#ICGFI. (16) Cambero, M. I.; Cabeza, M. C.; Escudero, R.; Manzano, S.; Ordoñez, J. A. Sanitation of selected ready-to-eat intermediatemoisture foods of animal origin by E-beam irradiation. Foodborne Pathog. Dis. 2012, 9, 594−599. (17) Hocaoglu, A.; Demirci, A. S.; Gumus, T.; Demirci, M. Effect of gamma irradiation on chemical, microbial quality and shelf life of shrimp. Radiat. Phys. Chem. 2012, 81, 1923−1929. (18) Antonio, A. L.; Carocho, M.; Bento, A.; Quintana, B.; Botelho, M. L.; Ferreira, I. C. F. R. Effects of gamma radiation on the biological, physico-chemical, nutritional and antioxidant parameters of chestnutsa review. Food Chem. Toxicol. 2012, 50, 3234−4242. (19) Fernandes, A.; Antonio, A. L.; Oliveira, M. B. P. P.; Martins, A.; Ferreira, I. C. F. R. Effect of gamma and electron beam irradiation on the physico-chemical and nutritional properties of mushrooms: A review. Food Chem. 2012, 135, 641−650. (20) Dempster, J. F. Radiation preservation of meat and meat productsa review. Meat Sci. 1985, 12, 61−89. (21) Hoz, L.; Cambero, M. I.; Cabeza, M. C.; Herrero, A. M.; Ordoñez, J. A. Elimination of Listeria monocytogenes from vacuum-

AUTHOR INFORMATION

Corresponding Author

*Phone: +34 915492300. Fax: +34 916644853. E-mail: [email protected]. Funding

This research was funded by Project CONSOLIDER-Ingenio 2010 (ref. CSD2007-00016) and Group of Investigation BSCH-UCM no. 920276 (ref GR58/08). Notes

The authors declare no competing financial interest. 1562



Article

packed dry-cured ham by E-beam radiation. J. Food Protect. 2008, 71, 2001−2006. (22) Selgas, M. D.; García, M. L.; Calvo, M. M. Effect of irradiation and storage on the physico-chemical and sensory properties of hamburgers enriched with lycopene. Int. J. Food Sci .Technol. 2009, 44, 1983−1998. (23) Gámez, M. C.; García, M. L.; Selgas, M. D.; Calvo, M. M. Irradiation of ready-to-eat sausages containing lycopene. Ital. J. Food Sci. 2011, 23, 260−269. (24) Müller, L.; Goupy, P.; Fröhlich, K.; Dangles, O.; Caris-Veyrat, C.; Böhm, V. Comparative study on antioxidant activity of lycopene (Z)-isomers in different assays. J. Agric. Food Chem. 2011, 59, 4504− 4511. (25) Standard Practice for Use of Cellulose Acetate Dosimetry Systems, E1650−97e1; Standards on disc; ASTM American Society for Testing and Materials: West Conshohocken, PA, 2000; Vol. 12.02. (26) Lorenz, M.; Stangl, V.; Jacob, C.; Daemen, K.; Böhm, V.; Fröhlich, K.; Baumann, G.; Stangl, K.; Simone, R.; Palozza, P. Delivery of lycopene to physiologically relevant vascular cells. J. Food Lipids 2009, 16, 259−272. (27) Palozza, P.; Piccioni, E.; Avanzi, L.; Vertuani, S.; Calviello, G.; Manfredini, S. Design, synthesis, and antioxidant activity of FeAOX-6, a novel agent deriving from a molecular combination of the chromanyl and polyisoprenyl moieties. Free Radical Biol. Med. 2002, 33, 1724− 1735. (28) Palozza, P.; Sheriff, A.; Serini, S.; Boninsegna, A.; Maggiano, N.; Ranelletti, F. O.; Calviello, G.; Cittadini, A. Lycopene induces apoptosis in immortalized fibroblast exposed to tobacco smoke condensate through arresting cell cycle and down regulating cyclin D1, pAKT and pBad. Apoptosis 2005, 10, 1445−1456. (29) Joo, Y. E.; Karrasch, T.; Mühlbauer, M.; Allard, B.; Narula, A.; Herfarth, H. H.; Jobin, C. Tomato lycopene extract prevents lipopolysaccharide-induced NF-kappaB signaling but worsens dextran sulfate sodium-induced colitis in NF-kappaBEGFP mice. PloS One 2009, 4, 4562−4573. (30) Girennavar, B.; Jayaprakasha, G. K.; Mclin, S. C.; Maxim, J.; Yoo, K. S.; Patil, B. S. Influence of electron-beam irradiation on bioactive compounds in grapefruits (Citrus paradise Macf.). J. Agric. Food Chem. 2008, 56, 10941−10946. (31) Shi, J.; Le Maguer, M. Lycopene in tomatoes: chemical and physical properties affected by food processing. Crit. Rev. Biotechnol. 2000, 20, 293−334. (32) Stahl, W.; Sies, H. Uptake of lycopene and its geometrical isomers is greater from heat-processed than from unprocessed tomato juice in humans. J. Nutr. 1992, 122, 2161−2166. (33) Ferreira, A. L.; Yeum, K.-J.; Russell, R. M.; Krinsky, N. I.; Tang, G. W. Enzymatic and oxidative metabolites of lycopene. J. Nutr. Biochem. 2004, 15, 493−502. (34) Böhm, V.; Puspitasari-Nienaber, N. L.; Ferruzzi, M. G.; Schwartz, S. J. Trolox equivalent antioxidant capacity of different geometrical isomers of α-carotene, β-carotene, lycopene, and zeaxanthin. J. Agric. Food Chem. 2002, 50, 221−226. (35) Palozza, P.; Parrone, N.; Catalano, A.; Simone, R. Tomato lycopene and inflammatory cascade: basic interactions and clinical implications. Curr. Med. Chem. 2010a, 17, 2547−2563. (36) Bowen, P.; Chen, L.; Stacewicz-Sapuntzakis, M.; Duncan, C.; Sharifi, R.; Ghosh, L.; Kim, H. S.; Christov-Tzelkov, K.; van Breemen, R. Tomato sauce supplementation and prostate cancer: lycopene accumulation and modulation of biomarkers of carcinogenesis. Exp. Biol. Med 2002, 227, 886−893. (37) Riso, P.; Visioli, F.; Grande, S.; Guarnieri, S.; Gardana, C.; Simonetti, P.; Porrini, M. Effect of a tomato-based drink on markers of inflammation, immunomodulation, and oxidative stress. J. Agric. Food Chem. 2006, 54, 2563−2566. (38) Bub, A.; Watzl, B.; Abrahamse, L.; Delincée, H.; Adam, S.; Wever, J.; Müller, H.; Rechkemmer, G. Moderate intervention with carotenoid-rich vegetable products reduces lipid peroxidation in men. J. Nutr. 2000, 130, 2200−2206.

(39) Sarkar, F. H.; Li, Y.; Wang, Z.; Kong, D. Cellular signaling perturbation by natural products. Cell Signalling 2009, 21, 1541−1547. (40) Kim, G. Y.; Kim, J. H.; Ahn, S. C.; Lee, H. J.; Moom, D. O.; Lee, C. M.; Park, Y. M. Lycopene suppresses the lipopolysaccharideinduced phenotypic and functional maturation of murine dendritic cells through inhibition of mutagen-activated protein kinases and nuclear factor-kappa B. Immunol. 2004, 113, 203−211. (41) Chan, C. M.; Fang, J. Y.; Lin, H. H.; Yang, C. Y.; Hung, C. Lycopene inhibits PDGF-BB-induced retinal pigment epithelial cell migration by suppression of PI3K Akt and MAPK pathways. Biochem. Biophys. Res. Commun. 2009, 388, 172−176. (42) Palozza, P.; Simone, R.; Catalano, A.; Boninsegna, A.; Böhm, V.; Fröhlich, K.; Mele, M. C.; Monego, G.; Ranelletti, F. O. Lycopene prevents 7-ketocholesterol-induced oxidative stress, cell cycle arrest and apoptosis in human macrophages. J. Nutr. Biochem. 2010b, 21, 34−46. (43) Schrek, R.; Bauerle, P. A. Reactive oxygen intermediates as apparently widely used messengers in the activation of NF-κB transcription factor and HIV-1. Trends Cell Biol. 1991, 1, 39−42. (44) Huang, C. S.; Fan, Y. E.; Lin, C. Y.; Hu, M. L. Lycopene inhibits matrix metalloproteinase-9 expression and down-regulates the binding activity of nuclear factor-kappa B and stimulatory protein-1. J. Nutr. Biochem. 2007, 18, 449−456. (45) Simone, R. E.; Russo, M.; Catalano, A.; Monego, G.; Froehlich, K.; Boehm, V.; Palozza, P. Lycopene inhibits NF-κB-mediated IL-8 expression and changes redox and PPARγ signaling in cigarette smokestimulated macrophages. PloS One 2011, 6, e19652. (46) Hung, C. F.; Huang, T. F.; Chen, B. H.; Shieh, J. M.; Wu, P. H.; Wu, W. B. Lycopene inhibits TNF-alpha-induced endothelial ICAM-1 expression and monocyte-endothelial adhesion. Eur. J. Pharmacol. 2008, 586, 275−282. (47) Palozza, P.; Simone, R.; Catalano, A.; Parrone, N.; Monego, G.; Ranelletti, F. O. Lycopene regulation of cholesterol synthesis and efflux in human macrophages. J. Nutr. Biochem. 2011, 22, 971−978. (48) De Stefano, D.; Maiuri, M. C.; Simeon, V.; Grassia, G.; Soscia, A.; Cinelli, M. P.; Carnuccio, R. Lycopene, quercetin and tyrosol prevent macrophage activation induced by gliadin and IFN-γ. Eur. J. Pharmacol. 2007, 566, 192−199. (49) Sharma, S. K.; Le Maguer, M. Lycopene in tomatoes and tomato pulp fractions. Ital. J. Food Sci. 1996, 2, 107−113.

1563


Effect of E-Beam Treatment on the Chemistry and on the Antioxidant

Recommend Documents