Effect of Microbial Interaction on Urea Metabolism in Chinese Liquor

Research, P.O. Box 16, 6700 AA Wageningen, The Netherlands. J. Agric. Food Chem. , Article ASAP. DOI: 10.1021/acs.jafc.7b04099. Publication Date (...
19 downloads 10 Views 1MB Size
Download PDF
Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Effect of Microbial Interaction on Urea Metabolism in Chinese Liquor Fermentation Qun Wu,*,† Jianchun Lin,† Kaixiang Cui,† Rubin Du,† Yang Zhu,‡ and Yan Xu*,† †

The Key Laboratory of Industrial Biotechnology, Ministry of Education, State Key Laboratory of Food Science and Technology, Synergetic Innovation Center of Food Safety and Nutrition, School of Biotechnology, Jiangnan University, Wuxi, Jiangsu 214122, China ‡ Bioprocess Engineering Group, Agrotechnology and Food Sciences, Wageningen University and Research, P.O. Box 16, 6700 AA Wageningen, The Netherlands ABSTRACT: Urea is the primary precursor of the carcinogen ethyl carbamate in fermented foods. Understanding urea metabolism is important for controlling ethyl carbamate production. Using Chinese liquor as a model system, we used metatranscriptome analysis to investigate urea metabolism in spontaneous food fermentation processes. Saccharomyces cerevisiae was dominant in gene transcription for urea biosynthesis and degradation. Lysinibacillus sphaericus was dominant for urea degradation. S. cerevisiae degraded 18% and L. sphaericus degraded 13% of urea in their corresponding single cultures, whereas they degraded 56% of urea in coculture after 12 h. Compared to single cultures, transcription of CAR1, DAL2, and argA, which are related to urea biosynthesis, decreased by 51, 36, and 69% in coculture, respectively. Transcription of DUR1 and ureA, which are related to urea degradation, increased by 227 and 70%, respectively. Thus, coexistence of the two strains promoted degradation of urea via transcriptional regulation of genes related to urea metabolism. KEYWORDS: ethyl carbamate, urea, ethanol fermentation, spontaneous food fermentation, Saccharomyces cerevisiae, Lysinibacillus sphaericus

■

INTRODUCTION

Metatranscriptomic analysis is an effective method to reveal the individual microbial metabolic profiles in spontaneous food fermentations. For example, it has been used to evaluate a cheese production process11 and assess the carbohydrate and lactic acid metabolic activities of lactic acid bacteria during kimchi fermentation.12 However, this technique has never been used to investigate urea metabolism during spontaneous food fermentation. In this work, we used metatranscriptomic analysis to investigate urea metabolism in a multispecies food fermentation process using a Chinese strong-aroma type liquor fermentation as a model system. EC concentration increasesfrom 40.12 to 72.95 μg/kg in this liquor fermentation stage, indicating urea is important for production of EC in this liquor fermentation. We identified dominant species with respect to gene transcription associated with urea biosynthesis and degradation and confirmed their activities via lab-scale fermentation. We also assessed the effect of their interactions on urea metabolism. An understanding of urea metabolism and its regulation during spontaneous fermentation will help control the production of ethyl carbamate in various multispecies fermented foods.

Urea is a primary precursor of the carcinogen ethyl carbamate in fermented foods.1−3 It is important to understand urea metabolism for controlling ethyl carbamate formation during food fermentation. Saccharomyces cerevisiae is the primary species responsible for urea metabolism in fermentation of several foods including sake, rice wine, and wine.3−5 Urea metabolism is well understood in S. cerevisiae and is produced from arginine by arginase (CAR1) in the urea cycle and from allantoate by allantoicase (DAL2) in purine catabolism,6 with the former pathway considered to be the primary source of urea.4 Urea can be degraded into ammonium and CO2 via urea amidolyase (DUR1, DUR2).4 Thus, work was done with respect to both urea biosynthesis and degradation to control ethyl carbamate production. For example, deletion of CAR1 and overexpression of DUR1 and DUR2 in S. cerevisiae significantly decreased the concentrations of urea and ethyl carbamate in rice wine7,8 and wine.9,10 However, the mechanism of urea metabolism is still unclear in other spontaneous food fermentations which involve a complex microbiota. The task of understanding the microbiota with respect to urea metabolism remains challenging due to a high species diversity and complex microbial interactions. During spontaneous fermentation, other microbes may also possess urea metabolic activities and may interact with S. cerevisiae, influencing urea metabolism. Therefore, urea metabolism-related species and their interactions with S. cerevisiae with respect to urea metabolism need to be better understood. © XXXX American Chemical Society

■

MATERIALS AND METHODS

Sampling during Chinese Liquor Production. Samples were collected from the fermentation process of Chinese strong-aroma type liquor in the mud pit (Weifang, Shandong Province, China) in March

Received: Revised: Accepted: Published: A

September 24, 2017 November 23, 2017 November 27, 2017 November 27, 2017 DOI: 10.1021/acs.jafc.7b04099 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 1. Primers for RT-qPCR gene

enzyme

Saccharomyces cerevisiae CAR1

arginase

DAL2

allantoicase

DUR1

urea carboxylase

UBC6

ubiquitin-conjugating enzyme

Lysinibacillus sphaericus argA

arginase

ureA

urease subunit gamma

recA

DNA-dependent ATPase

primer

sequence

CAR-F CAR-R DAL-F DAL-R DUR-F DUR-R UBC-F UBC-R

TGATTTTTACATACCGTATATCCAA AAGGGCGGGGATCGCGGGCGACGGT ATGAAGTTTTTTAGTTTGGCAGATG ACCCAATCGTATTCCATCTCATTAT CGGCCACTATGTCACCAGAATCAAC CTAAAAGAAAGTGTCACAGTCAAAC GGACGTTTCAAGCCCAACAC CCTGTCGTGGCTTCATCACT

arg-F arg-R ure-F ure-R rec-F rec-R

ACAGATTACGGACAAACACGC AGCCGTACTAACTTCTACTACTTCC AGTTGAATTATCCAGAAGCAGTTGC TTACTGAATTGGACGGTGAACTGTG TAGAACAGGCTTTAAAACAAATTGA ATCGATAAATGCTGCTTGTCCA

concentration of urea was maintained at 60.00 mg/L, simulating industrial liquor fermentation. The starter culture was prepared in 250 mL Erlenmeyer flasks with 50 mL of sorghum extract. Fermentations were conducted at 150 rpm and 30 °C for 24 h. Total cell counts were determined with a hemocytometer for S. cerevisiae precultures, and a Helber counting chamber (Z30000; Helber, Hawksley, United Kingdom) was used for L. sphaericus precultures. The two species were cocultured using a six-well Transwell system (24 mm Transwell, Corning, NY). Each well consisted of an upper and a lower chamber, which were separated by a polycarbonate membrane (0.45 μm) that allows metabolite exchange and prevents cell contact between the two different chambers.18 S. cerevisiae JZ109 and L. sphaericus MT33 were inoculated in the upper and lower chambers, respectively. Initial cell concentrations of both strains were adjusted to 1 × 105 CFU/mL. For single cultures, each of the two strains was inoculated in both the upper and lower chambers. Transwell plates were incubated without shaking at 30 °C for 72 h. Experiments were carried out in triplicate. Dry cell weight (DCW) was determined from cell suspensions that were harvested by centrifugation, washed with distilled water, and dried at 80 °C to a constant weight. Determination of Urea Concentration. For liquor fermentation samples, fermented grains (5 g) were mixed with 20 mL of 0.1 mol/L HCl and were sonicated for 30 min, then were centrifuged at 8600 × g for 15 min to collect the supernatants. For lab-scale fermentation samples, cells were removed from 1 mL of fermentation broth by centrifugation at 10 000 × g for 10 min. The obtained supernatants (500 μL) from fermented grains or lab-scale fermentation cultures were mixed with 400 μL of a xanthydrol solution (0.02 mol/L), 500 μL of ethanol, and 100 μL of HCl (1.5 mol/L), then were reacted in dark at 25 °C for 30 min. The resulting solutions were then used for urea measurements. Urea was measured by high performance liquid chromatography on an Agilent 1200 series with a fluorescence detector as previously reported.19 RNA Extraction and cDNA Sample Preparation from LabScale Single and Coculture Fermentations. Total RNA was extracted from S. cerevisiae JZ109 and L. sphaericus MT33 grown in single and coculture in a Transwell system. The two cultures were separately collected and centrifuged at 10 000 × g at 4 °C for 5 min. The obtained cell pellets were immediately frozen in liquid nitrogen. Total RNA was extracted using an RNeasy Mini kit (Qiagen GmBH, Hilden, Germany). DNase I was used to remove contaminating DNA. The obtained RNA was quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA). Reverse transcription was performed using a QuantiNova Reverse Transcription kit (Qiagen, Hilden, Germany).

2016. In the fermentation process, the starter (Daqu), sorghum, and fermented grains from the previous fermentation batch were mixed at a ratio of 1:2:7. The mixture was then put into an underground mud pit (approximately 3.2 × 2.4 × 2.9 m3) and was sealed to allow for anaerobic fermentation for 30 days. Samples (approximately 200 g) were collected in the upper layer from three different locations in the diagonal as previously reported13 and were homogeneously mixed. Samples were collected at 0, 3, 5, 10, 15, 20, and 30 days and stored at −20 °C for urea determination. Data were the average of three different pits. In addition, samples (200 g) collected from the three different pits at day 3 (room temperature, 22 °C) were immediately frozen in liquid nitrogen after sampling and were then homogeneously mixed and stored at −80 °C for metatranscriptomic analysis. Strains. S. cerevisiae JZ109 and Lysinibacillus sphaericus MT33 were isolated from the liquor fermentation process (Weifang, Shandong Province, China) and were deposited in the China General Microbiological Culture Collection Center (Beijing, China) with the accession number of CGMCC No. 12417 and CGMCC No. 13046. RNA Extraction, cDNA Synthesis, and Metatranscriptomic Sequencing. Total RNA in fermented grains was extracted using a RNeasy Mini kit (Qiagen, Hilden, Germany). Residual DNA was removed using RNase-Free DNase (Qiagen, Hilden, Germany). The quality and quantity of total RNA were determined with a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA) and an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). The depletion of rRNA was performed using a Ribo-Zero rRNA Removal kit (Human/Mouse/Rat) (Illumina, San Diego, CA). A TruSeq RNA Sample Prep kit was used for sample preparation (Illumina, San Diego, CA). Sequencing was performed on an Illumina Genome Analyzer IIx (Illumina, San Diego, CA). All operations were performed following the manufacturer’s protocols. Sequence Processing. Poor quality bases in raw Illumina metatranscriptomic reads were removed by a previously reported method.14 After trimming and adaptor removal, high quality paired and single reads were reserved. To remove rRNA sequences, the SILVA database and sortMetRNA were used.15 Putative mRNA reads were assembled by the de novo assembly package Trinity. The best assembly results were assessed by longest contig length, the highest read utilization rate, and the N50 and N90 lengths. Gene prediction was performed using TransGeneScan.16 FPKM (fragments per kilobase of transcript per million fragments mapped) was used to estimate the expression level of each gene. Metatranscriptomic sequence reads were submitted to the DNA Data Bank of Japan under the accession number DRA005616. Lab-scale Single and Coculture Fermentation. S. cerevisiae JZ109 and L. sphaericus MT33 were studied in single and coculture fermentation with sorghum extract as a medium.17 The initial B

DOI: 10.1021/acs.jafc.7b04099 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 1. Profile of the concentration of urea during liquor fermentation. (A) Urea concentration. (B) Urea production rate. Pdm denotes the maximal urea degradation rate. Data are presented as the means ± SD of three individual experiments.

Figure 2. Cell density and metatranscriptomic analysis at day 3 of Chinese liquor fermentation. (A) Number of colony forming units per gram of yeast and bacteria. Data are presented as the means ± SD of three individual experiments. (B) Transcriptional abundance based on metatranscriptomic analysis.

Figure 3. Transcription of genes related to urea metabolism at day 3 of Chinese liquor fermentation based on metatranscriptomic analysis. Quantitative PCR. The transcription levels of genes were assessed by reverse transcription quantitative PCR (RT-qPCR) with a BIORAD CFX96 Touch q-PCR system (Hercules, CA). The relative transcription levels of genes were quantified by the 2−ΔΔCT method, using UBC6 and recA as internal controls in S. cerevisiae and L. sphaericus, respectively. The specificity of the primer pairs was shown in Table 1.

The yeast and bacterial populations generated during liquor fermentation were determined by RT-qPCR. Metagenomic DNA was isolated via an EZNA (Easy Nucleic Acid Isolation) Soil DNA kit (Omega Bio-Tek, Norcross, GA). Primers used for total yeasts20 and bacteria21 were reported previously. The linear qPCR standard curves of population quantification for yeast and bacteria were as follows: y = −0.2710x + 12.3437 (R2 = 0.997, amplification efficiency value, 103%), C

DOI: 10.1021/acs.jafc.7b04099 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 4. Cell growth and urea degradation in single and cocultures of S. cerevisiae JZ109 and L. sphaericus MT33 with sorghum extract medium containing 60.00 mg/L of urea. (A) Cell growth. (B) Urea concentration. (C) Specific degradation rate of urea. SC and LS denote S. cerevisiae and L. sphaericus, respectively. S and C denote single and coculture. Data represent the means ± SD of three replications. y = −0.3066x + 12.3471 (R2 = 0.992, amplification efficiency value, 106%), respectively, in which y represents the logarithm of the corresponding population (CFU/g) and x represents the cycle threshold (CT) value. All reagents used for quantitative PCR were obtained from BIO-RAD Laboratories, Inc. (Hercules, CA).

the highest transcribed genus in the whole microbiota, as its FPKM level was 352 979.33, which was 95.70% of the total eukaryotic transcriptome (368 707.70) and 84.04% of the total microbial transcriptome. In addition to Saccharomyces, other genera also exhibited vigorous transcriptional activity such as Sporosarcina (5.70%), Virgibacillus (1.47%), Bacillus (0.99%), Ogataea (0.82%), Lactobacillus (0.48%), Lysinibacillus (0.40%), and Salinicoccus (0.01%). Urea Metabolism during Liquor Fermentation. As shown in Figure 3, the level of transcription of the arginase gene was 7.84 at day 3 and consisted of genes from four species. S. cerevisiae was the dominant species, accounting for 57.37% of the observed transcription of the arginase gene, followed by Virgibacillus halodenitrif icans, Bacillus megaterium, and Ogataea parapolymorpha, which accounted for 19.59, 17.35, and 5.69%, respectively. This indicated that these four species all had the potential to produce urea via arginase during liquor fermentation. For the purine catabolism pathway, only S. cerevisiae showed transcriptional activity of the allantoicase gene, with a level of 2.16. This indicated that the urea cycle and purine catabolism were both potential urea biosynthesis pathways during liquor fermentation. As shown in Figure 3, we identified two degradation pathways that were expressed during liquor fermentation. In the first pathway, S. cerevisiae produced urea carboxylase and allophanate hydrolase to sequentially degrade urea to allophanic acid, then to ammonia and CO2, respectively.

■

RESULTS Urea Production during Liquor Fermentation. Figure 1A shows the observed urea concentration during liquor fermentation. The initial concentration of urea was approximately 58.67 mg/kg. This urea was from the fermented grains from the previous fermentation batch. The concentration of urea decreased to 48.40 mg/kg in the first 5 days, then increased to 88.54 mg/kg until the 15th day, after which it remained stable until the end of fermentation. Figure 1B shows the urea degradation rate during liquor fermentation. The maximal degradation rate was 2.23 mg/(kg d) at day 3. Metatranscriptomic Analysis of Liquor Fermentation. Figure 2A shows that the number of colony forming units per gram of yeast and bacteria was nearly identical, 7.7 × 106 and 9.7 × 106 CFU/g at day 3, respectively. We obtained a total of 155 669 670 raw reads, which resulted in 152 831 948 clean reads and 46 970 100 non-rRNA reads at day 3. The N50 and N90 values reached 1541 and 392 bp, respectively. As shown in Figure 2B, the total transcription level (FPKM) was 420 018 at day 3. Although the abundances of yeast and bacteria were similar, their transcriptional activity was different. Saccharomyces was D

DOI: 10.1021/acs.jafc.7b04099 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 5. Fold changes of gene transcription associated with urea metabolism in coculture compared to single culture based on RT−qPCR analysis. (A) Gene transcription in S. cerevisiae. (B) Gene transcription in L. sphaericus. Data represent the means ± SD of three replications.

including the urea biosynthesis-related genes CAR1 and DAL2, and the urea degradation-related gene DUR1 in S. cerevisiae JZ109 (Figure 5A), the urea biosynthesis-related gene argA, and the urea degradation-related gene ureA in L. sphaericus MT33 (Figure 5B). The transcription of CAR1 and DAL2 in S. cerevisiae decreased by 51 and 36%, respectively, and the transcription of argA also significantly decreased (by 69%) compared with that observed in single culture. Their decreased transcriptional activities indicated a decreased urea biosynthetic activity. In contrast, the transcription of DUR1 in S. cerevisiae and ureA in L. sphaericus in the coculture increased by 227 and 70%, respectively. The increased transcriptional activities of these two genes were associated with an increase in urea degradation.

The transcription levels of these two genes were identical (8.67). In the second pathway, urea was degraded directly to CO2 by urease. Four bacterial species showed transcriptional activity with respect to the urease gene, with a total transcription level of 20.31. Among them, L. sphaericus exhibited the highest transcription, accounting for 45.19% of the total transcription of urease, followed by Salinicoccus carnicancri, Sporosarcina newyorkensis, and Lysinibacillus boronitolerans, which had ratios of 24.82, 23.47, and 6.52%, respectively. Urea Metabolism during Lab-Scale Single and Coculture Fermentation of S. cerevisiae and L. sphaericus. Figure 4A shows the biomass of S. cerevisiae JZ109 and L. sphaericus MT33 during lab-scale fermentation. S. cerevisiae entered into the logarithmic phase at 12 h, and reached the stationary phase in the single fermentation at 36 h. In contrast, L. sphaericus grew slowly in the single fermentation in first 12 h, after which it gradually entered into the logarithmic phase. Figure 4B shows the urea metabolic activity of S. cerevisiae JZ109 and L. sphaericus MT33 in a lab-scale fermentation. S. cerevisiae degraded 10.62 mg/L urea within 12 h and quickly consumed almost all the urea by 36 h. L. sphaericus degraded 7.75 mg/L urea within 12 h, then continued to degrade urea, and consumed all the urea by 60 h. Figure 4C shows that the maximal specific urea degradation rate was 0.43 × 10−3 mg/ (mg DCW h) for S. cerevisiae and 0.23 × 10−3 mg/(mg DCW h) for L. sphaericus, indicating that S. cerevisiae had the higher urea degradation activity. Next, the interaction between S. cerevisiae and L. sphaericus with respect to urea metabolism was studied. The growth of S. cerevisiae significantly increased in the coculture compared with that in the single culture, the final biomass increased from 34.83 to 41.60 mg DCW. In contrast, the growth of L. sphaericus maintained nearly the same profile in the single and coculture (Figure 4A). The two strains degraded a total of 33.66 mg/L urea within 12 h, which was much more than the total value of their single cultures (Figure 4B). In the coculture, the two strains degraded all the urea within 24 h, with the maximal specific urea degradation rate reaching 0.47 × 10−3 mg/(mg DCW h) (Figure 4C). This indicated that the interaction between these two strains increased the overall urea degradation. Transcription of Genes Related to Urea Metabolism in a Coculture of S. cerevisiae and L. sphaericus. In Figure 5, the transcription of genes related to urea metabolism at 12 h in coculture were compared with those observed in single-culture,

■

DISCUSSION Ethyl carbamate is carcinogenic to humans and animals.22 It is primarily generated from urea during food fermentation.1−3 The study of urea metabolism is important in controlling ethyl carbamate formation during food fermentation. Urea has been reported to be primarily produced by S. cerevisiae during many single or inoculated food fermentation process.3−5 However, the process of urea metabolism during spontaneous food fermentation is still unknown. This work identified a number of species associated with urea metabolism during spontaneous liquor fermentation using a metatranscriptomic analysis. In addition to the dominant urea producer, S. cerevisiae, several other potential urea producers were identified including V. halodenitrif icans, B. megaterium, and O. parapolymorpha. This was the first study to show their potential for urea production during liquor fermentation. We also identified several species associated with urea degradation including L. sphaericus, Sal. carnicancri, Spo. newyorkensis, and L. boronitolerans. Among these species, members of the genus Lysinibacillus and Sporosarcina have been reported to possess the enzyme urease.23,24 Moreover, this is the first study to report urease activity in Salinicoccus. The identified microbes are important for urea degradation within the microbial ecosystem responsible for liquor fermentation. Saccharomyces cerevisiae was the dominant species with respect to gene transcription related to both urea biosynthesis and degradation, and L. sphaericus was dominant for urea degradation during liquor fermentation. During lab-scale singleculture fermentation, both strains degraded urea, confirming their urea degradation activity. In addition, their ability to degrade urea increased during coculture fermentation. The E

DOI: 10.1021/acs.jafc.7b04099 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry

■

transcription of CAR1, DAL2, and argA all significantly decreased, whereas the transcription of DUR1 and ureA increased during coculture fermentation. The results showed that the coculture tended to exhibit decreased urea production and increased urea degradation via the altered transcription of genes related to urea metabolism in both S. cerevisiae and L. sphaericus. Although the microbial metabolism might be different under liquid and solid-state fermentation conditions, this result could still validate the solid-state fermentation process. This coculture fermentation was consistent with that of the liquor fermentation, where the urea concentration decreased during the initial period of liquor fermentation when these two species coexisted. In addition, although the arginase gene was detected in L. sphaericus, it was not transcribed during liquor fermentation. This might be attributable to the lower transcription of the arginase gene when the two species coexisted. Urease and urea amidolyase catalyze the hydrolysis of urea into ammonia and CO2, with the released ammonia playing an important role in microbial survival by increasing the pH in acidic environments. It has been reported that S. cerevisiae produced more acids in the fermentation broth in the presence of Bacillus,25 and in the present study, the acidic environment might be the reason for the high urea degradation activity observed for both S. cerevisiae and L. sphaericus in the coculture fermentation. The mechanism for this activity should be studied further. Lysinibacillus sphaericus was previously regarded as Bacillus sphaericus, but the taxonomic status was changed to the species L. sphaericus in 2007.26 This species has been identified in various food fermentation processes including in fermented soybeans, 27 cocoa, 28 and other fermented foods and beverages.29 L. sphaericus can produce both pectinase28 and cellulase30 and is a functional species for both the safety and quality of fermented foods. However, Lysinibacillus was primarily observed at day 5, and it decreased to less than 0.5% during the middle and late period of liquor fermentation.31 This might have been due to the harsh environmental conditions, such as the increase of acids and ethanol, and the anaerobic conditions present during the middle and late periods of the liquor fermentation process.13,32 As a result, increasing the cell number and extending the survival period of L. sphaericus would help to decrease the concentration of urea and decrease ethyl carbamate formation during liquor fermentation. An effective way to achieve this would be the fortification of L. sphaericus and proper regulation of environmental conditions. It has also been reported that the inoculation of Bacillus could improve the flavor of Daqu starter in liquor making33 and Chinese liquor,34 which indicated the inoculation of Lysinibacillus might also take effect in liquor fermentation. This work identified S. cerevisiae and L. sphaericus as the dominant species with respect to gene transcription associated with urea metabolism during Chinese liquor fermentation via metatranscriptome analysis. It also demonstrated that their coexistence tended to result in increased degradation of urea via transcriptional regulation of genes related to urea metabolism. This study sheds new light on urea metabolism during spontaneous food fermentation and is important for the regulation of urea and ethyl carbamate production during food fermentation.

Article

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. Phone: +86-510-85864112. Fax: +86-510-85864112. *E-mail: [email protected]. ORCID

Qun Wu: 0000-0002-3266-7040 Yan Xu: 0000-0002-7919-4762 Funding

This work was supported by NSFC (31530055), the National Key Research and Development Program of China (2016YFD0400503), the National High Technology Research and Development Program of China (2013AA102108), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (111−2−06). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Weber, J. V.; Sharypov, V. I. Ethyl carbamate in foods and beverages: a review. Environ. Chem. Lett. 2009, 7, 233−247. (2) Chen, D.; Ren, Y.; Zhong, Q.; Shao, Y.; Zhao, Y.; Wu, Y. Ethyl carbamate in alcoholic beverages from China: Levels, dietary intake, and risk assessment. Food Control 2017, 72, 283−288. (3) Jiao, Z.; Dong, Y.; Chen, Q. Ethyl carbamate in fermented beverages: presence, analytical chemistry, formation mechanism, and mitigation proposals. Compr. Rev. Food Sci. Food Saf. 2014, 13, 611− 626. (4) Zhao, X.; Du, G.; Zou, H.; Fu, J.; Zhou, J.; Chen, J. Progress in preventing the accumulation of ethyl carbamate in alcoholic beverages. Trends Food Sci. Technol. 2013, 32, 97−107. (5) Kitagaki, H.; Kitamoto, K. Breeding research on sake yeasts in Japan: History, recent technological advances, and future perspectives. In Annual Review Food Science; Doyle, M. P., Klaenhammer, T. R., Eds., 2013; Vol. 4, pp 215−235. (6) Solomon, C. M.; Collier, J. L.; Berg, G. M.; Glibert, P. M. Role of urea in microbial metabolism in aquatic systems: a biochemical and molecular review. Aquat. Microb. Ecol. 2010, 59, 67−88. (7) Wu, D.; Li, X.; Shen, C.; Lu, J.; Chen, J.; Xie, G. Decreased ethyl carbamate generation during Chinese rice wine fermentation by disruption of CAR1 in an industrial yeast strain. Int. J. Food Microbiol. 2014, 180, 19−23. (8) Wu, D.; Li, X.; Lu, J.; Chen, J.; Zhang, L.; Xie, G. Constitutive expression of the DUR1,2 gene in an industrial yeast strain to minimize ethyl carbamate production during Chinese rice wine fermentation. Fems Microbiol. Lett. 2016, 363, fnv214. (9) Guo, X. W.; Li, Y. Z.; Guo, J.; Wang, Q.; Huang, S. Y.; Chen, Y. F.; Du, L. P.; Xiao, D. G. Reduced production of ethyl carbamate for wine fermentation by deleting CAR1 in Saccharomyces cerevisiae. J. Ind. Microbiol. Biotechnol. 2016, 43, 671−679. (10) Coulon, J.; Husnik, J. I.; Inglis, D. L.; van der Merwe, G. K.; Lonvaud, A.; Erasmus, D. J.; van Vuuren, H. J. J. Metabolic engineering of Saccharomyces cerevisiae to minimize the production of ethyl carbamate in wine. Am. J. Enol. Viticult. 2006, 57, 113−124. (11) Sattin, E.; Andreani, N. A.; Carraro, L.; Lucchini, R.; Fasolato, L.; Telatin, A.; Balzan, S.; Novelli, E.; Simionati, B.; Cardazzo, B. A multi-omics approach to evaluate the quality of milk whey used in Ricotta cheese production. Front. Microbiol. 2016, 7, 1272. (12) Jung, J. Y.; Lee, S. H.; Jin, H. M.; Hahn, Y.; Madsen, E. L.; Jeon, C. O. Metatranscriptomic analysis of lactic acid bacterial gene expression during kimchi fermentation. Int. J. Food Microbiol. 2013, 163, 171−179. (13) Wu, Q.; Chen, L.; Xu, Y. Yeast community associated with the solid state fermentation of traditional Chinese Maotai-flavor liquor. Int. J. Food Microbiol. 2013, 166, 323−330.

F

DOI: 10.1021/acs.jafc.7b04099 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry (14) Wu, S. G.; Ren, Y.; Peng, C.; Hao, Y. T.; Xiong, F.; Wang, G. T.; Li, W. X.; Zou, H.; Angert, E. R. Metatranscriptomic discovery of plant biomass-degrading capacity from grass carp intestinal microbiomes. Fems Microbiol. Ecol. 2015, 91, fiv107. (15) Kopylova, E.; Noe, L.; Touzet, H. SortMeRNA: fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics 2012, 28, 3211−3217. (16) Ismail, W. M.; Ye, Y. Z.; Tang, H. X. Gene finding in metatranscriptomic sequences. BMC Bioinf. 2014, 15, S8. (17) Lu, X.; Wu, Q.; Zhang, Y.; Xu, Y. Genomic and transcriptomic analyses of the Chinese Maotai-flavored liquor yeast MT1 revealed its unique multi-carbon co-utilization. BMC Genomics 2015, 16, 1064. (18) Stadie, J.; Gulitz, A.; Ehrmann, M. A.; Vogel, R. F. Metabolic activity and symbiotic interactions of lactic acid bacteria and yeasts isolated from water kefir. Food Microbiol. 2013, 35, 92−98. (19) Zhang, J.; Liu, G.; Zhang, Y.; Gao, Q.; Wang, D.; Liu, H. Simultaneous determination of ethyl carbamate and urea in alcoholic beverages by high-performance liquid chromatography coupled with fluorescence detection. J. Agric. Food Chem. 2014, 62, 2797−2802. (20) Hierro, N.; Esteve-Zarzoso, B.; Gonzalez, A.; Mas, A.; Guillamon, J. M. Real-time quantitative PCR (QPCR) and reverse transcription-QPCR for detection and enumeration of total yeasts in wine. Appl. Environ. Microb. 2006, 72, 7148−7155. (21) Muyzer, G.; de Waal, E. C.; Uitterlinden, A. G. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 1993, 59, 695−700. (22) Baan, R.; Straif, K.; Grosse, Y.; Secretan, B.; El Ghissassi, F.; Bouvard, V.; Altieri, A.; Cogliano, V. Carcinogenicity of alcoholic beverages. Lancet Oncol. 2007, 8, 292−293. (23) McCoy, D. D.; Cetin, A.; Hausinger, R. P. Characterization of urease from Sporosarcina ureae. Arch. Microbiol. 1992, 157, 411−416. (24) Kang, C.-H.; Kwon, Y.-J.; So, J.-S. Soil bioconsolidation through microbially induced calcite precipitation by Lysinibacillus sphaericus WJ-8. Geomicrobiol. J. 2016, 33, 473−478. (25) Meng, X.; Wu, Q.; Wang, L.; Wang, D.; Chen, L.; Xu, Y. Improving flavor metabolism of Saccharomyces cerevisiae by mixed culture with Bacillus licheniformis for Chinese Maotai-flavor liquor making. J. Ind. Microbiol. Biotechnol. 2015, 42, 1601−1608. (26) Ahmed, I.; Yokota, A.; Yamazoe, A.; Fujiwara, T. Proposal of Lysinibacillus boronitolerans gen. nov sp nov., and transfer of Bacillus f usiformis to Lysinibacillus f usiformis comb. nov and Bacillus sphaericus to Lysinibacillus sphaericus comb. nov. Int. J. Syst. Evol. Microbiol. 2007, 57, 1117−1125. (27) Chettri, R.; Tamang, J. P. Bacillus species isolated from tungrymbai and bekang, naturally fermented soybean foods of India. Int. J. Food Microbiol. 2015, 197, 72−76. (28) Ouattara, H. G.; Reverchon, S.; Niamke, S. L.; Nasser, W. Molecular identification and pectate lyase production by Bacillus strains involved in cocoa fermentation. Food Microbiol. 2011, 28, 1−8. (29) Chakrabarty, J.; Sharma, G. D.; Tamang, J. P. Traditional technology and product characterization of some lesser-known ethnic fermented foods and beverages of North Cachar Hills District of Assam. Indian J. Tradit. Know. 2014, 13, 706−715. (30) Gupta, P.; Parkhey, P. A two-step process for efficient enzymatic saccharification of rice straw. Bioresour. Technol. 2014, 173, 207−215. (31) Sun, W.; Xiao, H.; Peng, Q.; Zhang, Q.; Li, X.; Han, Y. Analysis of bacterial diversity of Chinese Luzhou-flavor liquor brewed in different seasons by Illumina Miseq sequencing. Ann. Microbiol. 2016, 66, 1293−1301. (32) Li, X. R.; Ma, E. B.; Yan, L. Z.; Meng, H.; Du, X. W.; Zhang, S. W.; Quan, Z. X. Bacterial and fungal diversity in the traditional Chinese liquor fermentation process. Int. J. Food Microbiol. 2011, 146, 31−37. (33) Wang, P.; Wu, Q.; Jiang, X.; Wang, Z.; Tang, J.; Xu, Y. Bacillus licheniformis affects the microbial community and metabolic profile in the spontaneous fermentation of Daqu starter for Chinese liquor making. Int. J. Food Microbiol. 2017, 250, 59−67.

(34) Zhang, R.; Wu, Q.; Xu, Y. Aroma characteristics of Moutaiflavour liquor produced with Bacillus licheniformis by solid-state fermentation. Lett. Appl. Microbiol. 2013, 57, 11−18.

G

DOI: 10.1021/acs.jafc.7b04099 J. Agric. Food Chem. XXXX, XXX, XXX−XXX