Bioconjugate Chem. 1991, 2, 422-426
422
Effect of Structural Variations in Cholesteryl-Conjugated Oligonucleotides on Inhibitory Activity toward HIV-1 Firdous Farooqui,+Prem
S.Sarin,$ Daisy Sun,g and Robert L. Letsinger'.'
Department of Chemistry and Department of Biochemistry, Molecular and Cell Biology, Northwestern University, Evanston, Illinois 60208-3113, Department of Biochemistry and Molecular Biology, George Washington University Medical Center, 2300 I Street, NW, Washington, D.C. 20037, and Laboratory of Tumor Cell Biology, National Cancer Institute, Bethesda, Maryland 20892. Received August 5 , 1991
A number of oligonucleotide analogues containing internucleoside phosphorothioate linkages and a covalently attached cholesteryl residue was synthesized and tested for activity against HIV-1 in cultures of Molt3 cells. Structural features important for high antiviral activity are the presence of a cholesteryl moiety, a run of terminal phosphorothioate groups, and the presence of nucleoside residues. An increase in length of the tether between cholesteryl and phosphorus from six to 14 atoms has no significant effect on antiviral activity, and up to one-half of the internucleoside links in a cholesteryl-conjugated phosphorothioate oligomer and one-third of the internucleoside links in a nonconjugated phosphorothioate can be replaced with phosphodiester links without much change in antiviral activity. However, replacement of nucleoside units in the oligomers by a simple analogue (-OCH2CH2CH20-) yields inactive or very weakly active compounds, even in the presence of a cholesteryl group. Dose-response patterns for assays in which cholesteryl-conjugated oligomers are added to test cells either simultaneously or subsequently to viral infection are similar for homooligomer derivatives and for oligomers containing "antisense" sequences, suggesting a similarity in mode of action for the two classes of oligomers in this system.
INTRODUCTION Phosphorothioate oligonucleotide analogues are effective inhibitors of replication of HIV-1 in cell culture (1-3). Considerable evidence indicates that they may function in either a sequence independent mode (1)or a sequence specific mode (4,5),depending on the sequence and stage of infection when the oligomer is applied. The anti-HIV activity of both the phosphorothioate analogues and normal phosphodiester oligonucleotides is enhanced when cholesterol is conjugated near the 3' (6) or 5' (7)terminus. This enhancement is particularly pronounced for short oligomers. To gain further information on the relation of structure to the antiviral activity of cholesteryl-conjugated oligonucleotides we have prepared and examined compounds with changes in the phosphodiester/phosphorothioate ratio, the nucleotide sequence, the length of the oligomer, the length of the tether to cholesteryl, the nucleoside/ phosphorothioate ratio, and the number of cholesteryl groups. The structures are shown in Table I. In conjunction with assays involving successive as well as simultaneous addition of virus and phosphorothioate oligomer to the test cells, this study serves to define more clearly the structural requirements for anti-HIV activity in this system. EXPERIMENTAL PROCEDURES General Procedures. High-performance liquid chromatography (HPLC)was carried out with a C-18reversedphase column (5 pm Hypersil ODs; 100 X 2.1 mm) on a Hewlett-Packard 1090chromatograph using aqueous 0.03 M triethylammonium acetate (pH 7.3) and an acetonitrile gradient (1W /min increase in acetonitrile; 0.5 mL/min flow rate). Thin-layer chromatography (TLC) was carried out with Brinkman silica gel plates using n-propyl alcohol/ ~
~~
Northwestern University. * George Washington University Medical Center. National Cancer Institute. t
ammonium hydroxide/water (55110135 v/v/v). Polyacrylamide gel electrophoresis (PAGE) was carried out with denaturing cross-linked 20 95 gels (bisacrylamide/ acrylamide 1/28.4, w/w; 1 X 140 X 170 mm) at 400 V. Nucleotide bands were visualized by UV shadowing and by staining with methylene blue (0.02%). Migration distances are reported relative to bromophenol blue. For the enzyme digests a sample of the oligonucleotide (1A2w unit in doubly distilled water) was warmed at 37 OC for 5 h with 15 pL of snake venom phosphodiesterase I (Sigma, 2 mg/mL), 8pL of calf liver alkaline phosphatase (Boehringer Mannheim, 102 pL/510 pg), and 150 pL of buffer (32mM Tris-HC1and 12mM in magnesium chloride, pH 7.5). The solution was heated at 70-75 "C for 5 min, cooled, diluted with 100 pL of water, and subjected to HPLC. Oligomer Synthesis. Phosphorothioate and cholesteryl-conjugated phosphorothioate oligonucleotide analogues (compounds 1,2,4,6-15, Table I) were prepared using hydrogen phosphonate chemistry (8), with oxidation with sulfur to form internucleoside phosphorothioate links (2)and oxidation with carbon tetrachloride in the presence of the appropriate [ [(cholesteryloxy)carbonyl]amino]alkylamine to form the phosphoramidate links (6). Typically, the first coupling and attachment of a tethered cholesteryl group was carried out manually in a syringe, starting with 1rmol of the designated 3'-terminal nucleoside anchored to a controlled pore glass (CPG) support. The derivatized support was then transferred to a DNA synthesizer (Milligen Biosearch 8600) for automated synthesis. Following oxidation with sulfur, the solid support was removed and treated with concentrated ammonium hydroxide at 55 OC for 5 h; then the solution was concentrated and the oligomer was isolated by reversed-phase HPLC. The anucleosidic oligomers (X compounds, Table I) were prepared in the same manner as the oligonucleotide derivatives by using DMT-OCH&H2CH20PH(O) (0-) in place of nucleoside hydrogen phosphonate reagents. They were isolated in yields of 30-3574, 0 1991 American Chemical Society
Bioconjugate Chem., Vol. 2, No. 6, 1991
Cholesteryl-Conjugated OllgonucleotMes
423
Table I. Phosphorothioate Oligodeoxyribonucleotide Derivatives. 1 2 3 4 5 6
7 8 9 10 11 12 13 14 15 16 17 18
GTGTCTCCCCTTCTT T*GTGTCTC CCC'M'CT*T ACACCCAATTCTGAAAATGG ACACCCAATTCTGAAAATG G AEECCAATTCTG~*G CTCGCACCCATCTCTCTC C*T W C CCCCCCCCCCCCCCCCCCCSC GTGTCTCCCCTTCTTCCTGCC A*T
AGTCATTGGTC'M'AAAGGTACCTGA G*G
ccccc c*c cccccc c * c c * c #T xxxxxxxx x * c CCCCCCCC C#C
XXXXXXXX X*T XXXXXXXXXXXXX X*T
HPLC tR,b min 17.2 44.6 43.5 16.8 14.9 40.2 42.7 18.4 42.3 41.1 36.5 46.2 56.3 62.5 55.2 46.3 44.6 34.8
TLC Rf 1.10 1.14 1.14 1.10 1.07 1.13 1.29 1.11 1.15 1.23 0.80 1.14 1.50 1.45 2.05 1.34 1.65 1.06
PAGE R,d 0.76 0.68 0.70 0.67 0.66 0.64 0.60 0.76 0.67 0.62 0.49 0.94 0.92 I
0.73 1.0 1.08 1.45
IDm(ds novo): 1.4 0.2 0.3 1 0.7 0.1 0.02 >3 0.03 0.01 0.05 -3 -3 -3 -4 inactiveh inactiveh inactive'
PM
a Abbreviations: underlined nucleotide units have 3'-phosphorothioate links; An asterisk indicates a O=PNH(CHz)zNHCOO-cholesteryl link; A pound sign indicates a O=PNH(CHZ)loNHCOO-cholesteryllink; X represents that -O(CHz)30- has replaced a nucleoside unit. Elution time (see the experimental section for conditions). R( relative to dpT. d R, relative to bromophenol blue. e Concentration of oligomer that leads to 50% inhibition, averaged for inhibition of syncytia and cells testing positive for P17 and P24 viral proteins. f Did not migrate in the gel. 8 Lethal to the cells at concentrations of 4 fiM or higher. Inactive at concentrations up to at least 50 fiM. Inactive at 25 pM and below; at 50 pM, inactive in P17 and P24 tests, but active in inhibiting syncytia.
ACACCC AATTCTGAAAATGG (Oligomer 5). DMmimethoxytrity1)-ibdG-CPG (30 mg, 1pmol nucleoside) in a glass tight syringe was extended six nucleoside units in accord with the formula, using hydrogen phosphonate chemistry (8); then the support-bound intermediate was oxidized with sulfur (1mL of 0.2 M sulfur in carbon disulfideltriethylamine 911, v/v; 2 h), washed twice with methylene chloride, and treated with 3 % DCA in methylene chloride to remove the DMT group. The next nucleoside hydrogen phosphonate block (seven nucleoside units) was constructed using the hydrogen phosphonate protocol (8),but oxidation of the block was effected with carbon tetrachloride/methanol/triethylamine (8/1/ 1,v/v/v; 30 min) to generate internucleoside methyl phosphotriesters. Following washing (methylene chloride) and detritylation (3% DCA), the remaining nucleosidephosphorothioate block was built by the procedure used for the first phosphorothioate block. At the end, following oxidation with sulfur, the support-bound oligomer was treated with 1mL of a solution of thiophenol/ dioxaneltriethylamine (11211, v/v/v; 1h) to convert the triesters to phosphodiesters; when the oligomer was cleaved from the support with concentrated ammonium hydroxide (6 h, 55 "C). Evaporation and HPLC afforded the DMToligomer, which was detritylated (80% aqueous acetic acid) and rechromatographed (HPLC). See Table I and Results for properties. 34(p,p'-Dimethoxytrity1)oxyl-1-propanol.A mixture of p,p'-dimethoxytrityl chloride (5.06 g) and 1,3-propanediol(5.7 g) in pyridine (25 mL) was stirred overnight at room temperature. Concentration, dilution with water, extraction with chloroform, concentration of the chloroform layer, and chromatography of the residue on a silica gel column (hexane; elution with 30% ethyl acetate in hexane) yielded 3.1 g (56%) of the title compound as a viscous oil: IR (Nujol) 3588-3224 (s) cm-'; 'H NMR (CDClB) 1.85 (p, 2 H, -CHz-), 2.21 (t, 1 H, OH), 3.28 (t, 2 H, -CHzO-), 3.76 (t, 2 H, -CHzO-), 3.79 (s,6 H, OCH3), 6.82-7.43 (m, 13H, aromatic H)ppm; FAB mass spectrum, m / e 441 (M+). 3-[(p,p'-Dimethoxytrityl)oxy]propyl Hydrogen Phosphonate Triethylammonium Salt. To a solution of imidazole (6.7 g, 98 mmol) in acetonitrile (100 mL) a t ice-bath temperature was added dropwise with stirring
first phosphorus trichloride (3.0 mL, 30 mmol), then triethylamine (14.6 mL, 104 mmol), and, after 15 min, 3-[(p,p'-dimethoxytrityl)oxy]-l-propanol(2.6 g, 6.9 mmol) in dry acetonitrile (100 mL). The ice bath was removed and the solution stirred for 2 h, at which time TLC indicated complete conversion of the starting alcohol to a new product with lower mobility. Water was added and stirring continued for another 30 min; then the solution was evaporated under reduced pressure and extracted with chloroform. Purification by silica gel chromatography afforded 2.0 g (62%) of the title compound; mp 132-135 "C after recrystallization from ethyl acetatelhexane; 'H NMR (CDCl3) 1.22 (t, 9 H, Et,N), 1.91 (p, 2 H, -CHz-), 2.93 (9,6 H, Et3N), 3.13 (t, 2 H, -CHzO-), 3.72 (8, 6 H, OCH3), 3.97 (t, 2 H, -OCHz-), 6.7-7.4 (m, 13 H, aromatic H), 6.05 and 7.57 (d of H-P, J = 612 Hz) ppm; 31PNMR (CDC13, with 85% H3P04as reference) 4.56 (J = 620 Hz) PPm. Assay for Inhibition by HIV-1. Assays for inhibition of HIV-1 in both de novo and postinfection experiments were carried out by the procedure described previously (5). RESULTS AND DISCUSSION
Oligomers. Phosphorothioate oligonucleotides were prepared using conventional chemistry. Cholesteryl was linked via a phosphoramidate bond with either a six-atom tether (formula 1, *) or a 14-atom tether (formula 1, #), H
