Effects of Muscle-Specific Oxidative Stress on Cytochrome c Release

Aug 10, 2017 - ACS Editors' Choice: Evaluating the Energetic Driving Force for Cocrystal Formation. This week: Evaluating the energetic driving force ...
43 downloads 15 Views 353KB Size
Download PDF
Article pubs.acs.org/JAFC

Effects of Muscle-Specific Oxidative Stress on Cytochrome c Release and Oxidation−Reduction Potential Properties Yiling Ke, Rachel M. Mitacek, Anupam Abraham, Gretchen G. Mafi, Deborah L. VanOverbeke, Udaya DeSilva, and Ranjith Ramanathan* Department of Animal Science, Oklahoma State University, Stillwater, Oklahoma 74078, United States ABSTRACT: Mitochondria play a significant role in beef color. However, the role of oxidative stress in cytochrome c release and mitochondrial degradation is not clear. The objective was to determine the effects of display time on cytochrome c content and oxidation−reduction potential (ORP) of beef longissimus lumborum (LL) and psoas major (PM) muscles. PM discolored by day 3 compared with LL. On day 0, mitochondrial content and mitochondrial oxygen consumption were greater in PM than LL. However, mitochondrial content and oxygen consumption were lower (P < 0.05) in PM than LL by day 7. Conversely, cytochrome c content in sarcoplasm was greater on days 3 and 7 for PM than LL. There were no significant differences in ORP for LL during display, but ORP increased for PM on day 3 when compared with day 0. The results suggest that muscle-specific oxidative stress can affect cytochrome c release and ORP changes. KEYWORDS: beef color, myoglobin, metmyoglobin reducing activity, mitochondria, oxidation−reduction potential

■

INTRODUCTION Consumers associate the bright-red color of beef with freshness and wholesomeness. Myoglobin is the primary sarcoplasmic protein responsible for beef color. Depending on the redox state of the heme and the ligand bound, myoglobin exists in three forms.1 Ferrous heme with no ligand attached results in purple color due to predominant deoxymyoglobin, while oxymyoglobin gives the characteristic bright-red color. The oxidation of both oxymyoglobin and deoxymyoglobin leads to metmyoglobin formation or discoloration. Approximately 15% of meat is discounted in price due to discoloration.2 Hence, characterizing the factors associated with myoglobin oxidation is important to minimize the losses due to discoloration. Metmyoglobin accumulation is muscle-specific and depends on the inherent muscle biochemistry. Longissimus lumborum (LL) is classified as a color-stable muscle while psoas major (PM) is a color-labile muscle.3−5 Among the various factors that affect color stability, the role of mitochondria has been investigated by numerous researchers.6−9 Mitochondrial activity can influence myoglobin redox state via oxygen consumption and metmyoglobin reduction.6,7,9 However, oxidative processes that affect mitochondrial function can impact beef color.10 Immediately after animal harvest, blood flow ceases, and the muscle metabolism changes from aerobic to anaerobic. This can significantly affect muscle homeostasis, increase oxidative stress,11 and cause degeneration of mitochondria.12 In healthy cells, cytochrome c is the major electron carrier between complex III and IV of the electron transport chain. The level of cytochrome c content in sarcoplasm is an indicator of mitochondrial damage or outer membrane breakdown.13 The concentration of mitochondria is greater in type I (predominant red fibers) muscles than in type II (white fibers). The proportion of red and white fibers varies between different muscles in a beef carcass. PM muscle has greater red fiber content than LL muscle. Thus, it is possible that the oxidative changes will be greater in PM than LL muscles. However, © 2017 American Chemical Society

limited studies have determined the effects of muscle type and display time on cytochrome c level in relation to beef color. The oxidation−reduction potential (ORP) measurements can predict oxidative stress in tissue.14 Hence, the quantification of ORP changes with display time will provide a better understanding of the muscle-specific differences in oxidative stress. Therefore, the objective of this study was to determine the effects of display time and muscle type (beef LL and PM) on changes in mitochondria, cytochrome c content, and ORP.

■

MATERIALS AND METHODS

Raw Materials and Processing. Eight USDA paired Select beef LL (IMPS #180)15 and PM from market age animals were collected within 48 h of harvest from a commercial packing plant. The muscles were transported on ice to the Food and Agricultural Products Center at Oklahoma State University. Following overnight storage, five 2.5cm-thick steaks were cut from the anterior end of each muscle and randomly assigned to days 0, 1, 3, 5, and 7. Steaks were placed (N = 16 steaks on each day; n = 8 from LL and n = 8 from PM) on foam trays with absorbent pads, overwrapped with a PVC film (oxygen-permeable polyvinyl chloride fresh meat film; 15 500−16 275 cm3 O2/m2/24 h at 23 °C, E-Z Wrap Crystal Clear Polyvinyl Chloride Wrapping Film, Koch Supplies, Kansas City, MO). After packaging, steaks were placed in a coffin-style open display case maintained at 2 °C ± 1 under continuous lighting (1612 to 2152 lx, Philips Deluxe Warm White Fluorescent lamps; Andover, MA; color rendering index = 86; color temperature = 3000 K). All packages were rotated daily to minimize the variances in light intensity or temperature caused by the location. Following surface color measurements, steaks designated to days 0, 3, and 7 were cut in half. The first half was used to measure metmyoglobin reducing activity (MRA) and muscle oxygen consumption, and the second half was used to quantify ORP, cytochrome c content, pH, lipid oxidation, and for mitochondrial Received: Revised: Accepted: Published: 7749

April 14, 2017 August 4, 2017 August 10, 2017 August 10, 2017 DOI: 10.1021/acs.jafc.7b01735 J. Agric. Food Chem. 2017, 65, 7749−7755

Article

Journal of Agricultural and Food Chemistry

Proximate and pH Analysis. Proximate analysis was conducted using an AOAC-approved (Official Method 2007.04) near-infrared spectrophotometer (FOSS Food Scan 78800; Dedicated Analytical Solutions, DK-3400 Hillerod, Denmark). Compositional values were reported on a percent (%) basis. pH was determined by inserting the pH probes at four different locations within a steak using a Mettler Toledo SevenGo pH meter. Surface Color. Surface color was measured on days 0, 1, 3, 5, and 7 at three locations using a HunterLab MiniScan XE Plus spectrophotometer (HunterLab Associates, Reston, VA, USA) with a 2.5 cm diameter aperture, Illuminant A, and 10° standard observer. Reflectance at isosbestic wavelengths from 400−700 nm was used to quantify myoglobin redox forms on the surface of steaks. Reflectance at 474, 525, 572, and 610 nm was converted to K/S values using K/S = (1 − R)2/2R. These values were then substituted into the following equations1 to calculate the percentage of oxy- and metmyoglobin.

studies. The steak half assigned to MRA and muscle oxygen consumption was then bisected parallel to the oxygenated surface to expose the interior of the steak (resulting in two interior pieces). The first piece was used to measure MRA, and the second piece was used to measure muscle oxygen consumption. Before taking samples from the second half, a pH probe was used to measure muscle pH. Following pH measurements from the second half, approximately 50 g of muscle samples visually devoid of fat and connective tissue were vacuum packaged and assigned for mitochondrial studies. Another 10 g of the sample that contained displayed surface and interior was used for lipid oxidation measurements. Two 5 g samples were collected for cytochrome c and ORP measurements, vacuum packaged, and kept at −80 °C until use. Mitochondrial studies, cytochrome c, pH, MRA, muscle oxygen consumption, and ORP measurements were conducted on days 0, 3, and 7. Fresh tissue samples were used for oxygen consumption, mitochondrial quantification using protein content, and lipid oxidation studies; however, frozen tissue was used for mitochondrial quantification using DNA-method.

% oxymyoglobin =

[K /S610 ÷ K /S525 for 100% metmyoglobin − K /S610 ÷ K /S525 for sample] [K /S610 ÷ K /S525 for 100% metmyoglobin − K /S610 ÷ K /S525 for 100% oxymyoglobin]

% metmyoglobin =

[K /S572 ÷ K /S525 for 100% oxymyoglobin − K /S572 ÷ K /S525 for sample] [K /S572 ÷ K /S525 for 100% oxymyoglobin − K /S572 ÷ K /S525 for 100% metmyoglobin]

K and S indicate the absorption and scattering coefficient, respectively.

Mitochondrial Content Quantification. Mitochondrial content in LL and PM muscles during storage were quantified as total yield and as mitochondrial DNA. Total Mitochondrial Content in Longissimus and Psoas Muscles. A differential centrifugation method was used to isolate mitochondria from LL and PM muscles.8 Mitochondrial protein content was determined using a bicinchoninic acid protein assay and reported as mg/g of tissue.18 Briefly, 10 g of minced tissue devoid of fat and connective tissue were washed twice with 250 mM sucrose and suspended in 20 mL of mitochondrial isolation buffer [250 mM sucrose, 10 mM HEPES, 1 mM EDTA, and 0.1% BSA, pH 7.2]. The suspension was stirred slowly and hydrolyzed with protease (protease/ tissue, 0.5 mg/g of tissue) for 20 min; the pH was maintained between 7.0 and 7.2. After proteolytic digestion, the suspension was diluted to 300 mL with mitochondrial isolation buffer and homogenized using a Kontes Duall grinder (Vineland, NJ) followed by a Wheaton PotterElvehjem grinder (Millville, NJ). The homogenate was centrifuged at 900g for 20 min with a Sorvall refrigerated RC-5B centrifuge (Thermo Fisher Scientific, Waltham, MA), and the resulting supernatant was again centrifuged at 14 000g for 15 min. Mitochondrial pellets were washed twice and suspended in mitochondrial suspension buffer (250 mM sucrose, 10 mM HEPES, pH 7.2). All steps were performed between 0 and 4 °C. Quantification of Mitochondrial DNA. A 274 bp amplicon of bovine mitochondrial cytochrome b gene (gb|JX472274.1|; forward primer −5′GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA3′, reverse primer −5′CTAGAAAAAGTGTAAGACCCGTATATAAG3′) was used to evaluate mitochondrial copy number19 and a 119 bp amplicon based on the 18S rRNA gene (forward primer -5′TTCGAACGTCTGCCCTATTAA3′, reverse primer −5′GATGTGGTAGCCGTTTCTCAGG3′) was used as the normalizer. Total DNA was isolated using a QIAamp DNA Mini Kit (Qiagen, Valencia, CA) and manufacturer’s instructions with the following modifications. Approximately, 0.3 g of the ground muscle in liquid nitrogen was used for further processing. The PCR assay was validated first by assessing the primer efficiencies via performing a standard curve analysis using 7-log dilutions of template DNA. The specificity of the assay was determined by ensuring a single amplicon and by sequence analyzing several amplicons to confirm that they represent

Myoglobin reference standards were prepared using the extra steaks not used in the study. Percentage myoglobin values were also used to calculate muscle oxygen consumption and MRA. Muscle Oxygen Consumption. Muscle oxygen consumption was determined indirectly as the changes in oxymyoglobin level. In the current study, a modified procedure of Madhavi et al.16 was used to determine muscle-specific oxygen consumption on days 0, 3, and 7. Following surface color measurements, the steak was bisected parallel to the oxygenated surface to expose the interior of steak, resulting in two interior pieces. The first interior (the section that was exposed to air) was used for oxygen consumption studies, and the second interior was used for MRA studies. Freshly cut LL or PM muscle samples were allowed to oxygenate for 60 min at 4 °C, vacuum packaged, and scanned twice on the bloomed surface to measure oxymyoglobin. Oxygen consumption (measured by conversion of oxymyoglobin to deoxymyoglobin) was induced by incubating samples at 30 °C for 30 min. The surface color was scanned using a Hunter Lab Miniscan XE Plus spectrophotometer for reflectance from 400 to 700 nm to determine the initial % oxymyoglobin. Samples were rescanned immediately to determine remaining surface oxymyoglobin.1 To calculate % muscle oxygen consumption, the following equation was used: (% preincubation surface oxymyoglobin − % postincubation surface oxymyoglobin). Metmyoglobin Reducing Activity. Metmyoglobin reducing activity was determined on days 0, 3, and 7 of display.17 Samples from the interior of steak halves were submerged in a 0.3% solution of sodium nitrite (Sigma, St. Louis, MO) for 20 min to facilitate metmyoglobin formation, and then removed, blotted dry, vacuum packaged (Prime Source Vacuum Pouches, 4 mil, Koch Supplies Inc., Kansas City, MO), and scanned with a HunterLab MiniScan XE Plus spectrophotometer to determine preincubation metmyoglobin values.1 Each sample was incubated at 30 °C for 2 h to induce metmyoglobin reduction. Upon removal from the incubator, samples were rescanned to determine the percentage of remaining surface metmyoglobin. The following equation was used to calculate % MRA: [(% surface metmyoglobin preincubation − % surface metmyoglobin postincubation). 7750

DOI: 10.1021/acs.jafc.7b01735 J. Agric. Food Chem. 2017, 65, 7749−7755

Article

Journal of Agricultural and Food Chemistry cytochrome b gene. Paired LL and PM muscles were assayed for mitochondrial cytochrome b gene and 18S rRNA using an SYBR green1 reporter assay (Roche Diagnostics, Indianapolis, IN). The reaction mixture contained forward and reverse primer, master mix (Roche Diagnostics, Indianapolis, IN), and template DNA. Cycling conditions were as follows: 95 °C for 10 min followed by 50 cycles of 94 °C for 15 s, 58 °C for 15 s, and 72 °C for 20 s. The relative mitochondrial copy number was calculated using the comparative Ct method as previously described.20 For the two muscle types, the mitochondrial cytochrome b Ct was normalized to the 18S gene. The validity of the 18S rRNA gene as a normalizer was ascertained by ensuring that the Ct values for each sample for the normalizer fell within a ±1 amplification cycle. Mitochondrial Oxygen Consumption. Mitochondrial oxygen uptake was measured using a Clark oxygen electrode6,7 (polarizing voltage of 0.6 V and an 8 mL incubation chamber). The reaction components were added to the incubation chamber, which was maintained at 25 °C by a water jacket and Lauda RE120 circulating water bath (Westbury, NY). The chamber was stirred with a 10 mm Teflon-covered bar at 600 rpm. The electrode was attached to a Rank Brothers digital model 20 oxygen controller (Cambridge, England) and connected to a computer and data logger. Oxygen consumption was recorded over time at pH 5.6 by suspending mitochondria in incubation buffer (250 mM sucrose, 5 mM KH2PO4, 5 mM MgCl2, 0.1 mM EDTA, 0.1% BSA, and 20 mM maleic acid) with the addition of succinate (10 mM) as a substrate. The oxygen consumption rate was calculated based on the method of Estabrook.21 Quantification of Cytochrome c. The cytochrome c content in sarcoplasm was quantified using a sandwich-ELISA assay per manufacturer’s instructions with the following modifications (Abcam, Cambridge, UK). To measure cytochrome c content in sarcoplasm, 100 mg of either LL or PM muscle were homogenized in 900 μL of buffer (10 mM HEPES, pH 7.2) using a Wheaton Potter-Elvehjem tissue grinder. The homogenates were centrifuged at 900g for 10 min. The supernatant was then centrifuged again at 14 000g for 10 min. Mitochondria sediment at 14 000g and the supernatant were used to determine cytochrome c content in the sarcoplasm. The protein concentration of the supernatant was determined using a BCA assay. The samples were transferred to a 96-well microplate and were incubated for 3 h. Following incubation, the plate was washed using TRIS washing buffer. Cytochrome c detector bovine specific antibody solution was added to each well before another 1 h incubation time. The liquid was discarded, and the plate was washed again. The horseradish peroxide solution was added, and the microplate was incubated for 1 h. The plate was washed five times before 200 μL development solution were added to each well. The absorbance of each well in the microplate was measured at 600 nm every 90 s for 30 min at room temperature using a kinetic program. A standard curve was plotted with known cytochrome c and expressed as μg cytochrome c in per gram tissue. Oxidation−Reduction Potential. A RedoxSys analyzer was used to measure the ORP status in muscles. This machine measures the balance of oxidants and reductants, providing a direct measurement of oxidative stress using electrochemical principles.22 Briefly, 100 mg meat sample from each muscle type on days 0, 3, and 7 after postmortem were homogenized in 50 mM phosphate buffer at pH 7.4 using a hand-held homogenizer. The homogenate was centrifuged at 12 000g for 5 min. 20 μL of the supernatant were applied on the sensor attached to a RedoxSys analyzer reader (Aytu BioScience, Inc., Englewood, CO), and the ORP status was recorded in millivolt (mV). A lower number represents a higher antioxidant status. This technique has been used to measure the oxidative stress status in serum and plasma.22,23 Lipid Oxidation. Thiobarbituric acid reactive substances values were utilized to indicate lipid oxidation.24 From each steak, 5 g of the sample that contained both interior and displayed surface were blended with 25 mL of trichloroacetic acid (TCA) solution (20%) and 20 mL of distilled water. Samples were homogenized using a Sorvell Omni tabletop mixer (Newton, CT) for 1 min and filtered through a Whatman (#1) filter paper. 1 mL of filtrate was mixed with 1 mL of

thiobarbituric acid (TBA) solution (20 mM) and incubated in a boiling water bath for 10 min. The samples were cooled, and the absorbance at 532 nm was measured using a Shimadzu UV-2600 PC spectrophotometer (Shimadzu Inc., Columbia, MD, USA). Blank samples for the spectrophotometer consisted of 2 mL of TCA/distilled water (1:1 v/v) and 2 mL of TBA solution. Statistical Analysis. The experimental design was a split plot, where muscles (LL and PM) from each animal served as a block in the whole plot (n = 8). In the subplot, a steak was assigned to a day of the display (0, 1, 3, 5, or 7 for surface color measurements and 0, 3, and 7 for biochemical studies). For surface color, mitochondrial, and biochemical studies, the fixed term included muscle type, display time, and their interaction. The random terms included animal (Error A) and unspecified residual error (Error B). Type-3 tests of fixed effects were performed using the Mixed Procedure of SAS (version 9.3, SAS Institute Inc.; Cary, NC). Least square means for protected Ftests (P < 0.05) were separated by using the pdiff option (least significant differences) and were considered significant at the P < 0.05 level.

■

RESULTS AND DISCUSSION Effects of Muscle Type on Surface Color and Biochemical Properties. The relationship between oxidative stress, mitochondria, and cell death have been investigated extensively in medical research.25,26 However, limited information is currently available on muscle-specific oxidative stress on mitochondrial degeneration. There were no significant differences in proximate compositions between two muscles (Table 1). In the current study, PM had greater % metmyoglobin and Table 1. Proximate Composition and pH of LL and PM Musclesa

a

trait

LL

PM

SE

P-value

moisture (%) protein (%) fat (%) pH

70.5 21.7 5.9 5.57

70.4 20.9 7.3 5.61

0.97 0.4 1.3 0.02

0.94 0.28 0.51 0.13

LL = longissimus lumborum; PM = psoas major; SE = standard error.

lower redness (P < 0.05) compared with LL on day 3 (Table 2). LL had a stable red color compared to PM during display (changes in % metmyoglobin level in LL and PM between day 0 and 7 were 28.4 and 78.3, respectively). Lower color stability in PM was characterized by lesser (P < 0.05) MRA than LL on days 0, 3, and 7 (Table 3). However, PM had greater (P < 0.05) muscle oxygen consumption on day 0, while LL had greater oxygen consumption on days 3 and 7 than PM (Table 3). There were no differences (P > 0.05) between muscle types for lipid oxidation on day 0 of the display; however, PM had greater lipid oxidation (P < 0.05) on days 3 and 7. Various studies have reported the color labile nature of PM during display compared to LL.3−5 The authors speculated that differences in fiber type and greater oxygen consumption attributed to the rapid discoloration. In the present research, we focused on how oxidative changes can affect mitochondrial degradation and cytochrome c level in sarcoplasm to understand the lower color stability of PM. Mitochondrial Oxygen Consumption. Mitochondrial oxygen consumption was greater for PM on day 0 than LL (Table 4). This suggests that there are inherent differences in oxygen consumption capabilities per mg mitochondria between muscle types. Previous research also reported a greater oxygen consumption in isolated bovine PM mitochondria27 and in steaks28 compared with LL. The greater oxygen consumption 7751

DOI: 10.1021/acs.jafc.7b01735 J. Agric. Food Chem. 2017, 65, 7749−7755

Article

Journal of Agricultural and Food Chemistry Table 2. Least Square Means for the Effects of Muscle Type and Display Time on Surface Colora display time (day) trait

muscle

b

0 c

1

3

5

7

(a) a* values (redness)

LL PM

30.6 a,x 29.5 a,y

33.4 b,x 32.4 b,y

30.1 a,x 20.3 c,y

28.4 c,x 15.4 d,y

26.4 d,x 13.1 e,y

(b) % metmyoglobinb

LL PM

7.2 a,x 5.6 a,x

7.2 a,x 10.5 b,x

12.5 b,x 65.2 c,y

21.4 c,x 77.5 d,y

35.6 d,x 83.9 e,y

a LL = longissimus lumborum; PM = psoas major. bFor both a* value and % metmyoglobin: display time, P < 0.0001; muscle effect, P < 0.0001; display time x muscle, P < 0.0001. cMeans in each column with different letters (x−y) differ (P < 0.05). Means in each row with different letters (a−e) differ (P < 0.05).

Table 3. Least Square Means for the Effects of Muscle Type and Display Time on MRA, Oxygen Consumption, and Lipid Oxidationa Display time (day) 0

3

7

(a) MRAb (%)

LL PM

65.4 x,ad 55.4 y,a

60.4 x,b 30.4 y,b

54.4 x,c 26.4 y,b

3.2

SE

(b) oxygen consumptionb (%)

LL PM

57.4 x,a 68.5 y,a

50.4 x,b 45.6 y,b

42.4 x,c 34.5 y,c

3.1

(c) lipid oxidationc

LL PM

0.031 x,a 0.038 x,a

0.052 x,b 0.072 y,b

0.077 x,c 0.124 y,c

0.009

a

LL = longissimus lumborum; PM = psoas major; MRA = metmyoglobin reducing activity; SE = standard error. bFor both MRA and oxygen consumption: display time, P < 0.0001; muscle effect, P < 0.001; display time x muscle, P < 0.001. cLipid oxidation is indicated as thiobarbituric acid reactive substances and measured as absorbance at 532 nm. dMeans in each column with different letters (x−y) differ (P < 0.05). Means in each row with different letters (a−c) differ (P < 0.05).

Table 4. Comparison of Mitochondrial Content and Oxygen Consumption in Beef Longissimus and Psoas Muscles during Displaya parameters mitochondrial content

LL

b

c

mitochondrial oxygen consumptionb (nanomoles of oxygen consumed/min per mg of mitochondria)

d

PM

SE

P-value

mitochondrial protein yield, d 0 mitochondrial protein yield, d 3 mitochondrial protein yield, d 7

0.21 x,a 0.19 x,ab 0.15 x,b

0.38 y,a 0.24 x,b 0.12 x,c

0.03

0.002

relative mitochondrial DNA content, d 0

1.00

2.55

0.28

0.01

d0 d3 d7

30.2 x,a 26.5 x,ab 22.4 x,b

42.5 y,a 32.4 x,b 15.2 y,c

3.2

0.001

a

SE = standard error; LL = longissimus lumborum; PM = psoas major. bFor both mitochondrial content and mitochondrial oxygen consumption: display time, P < 0.0001; muscle effect, P < 0.001. cMitochondrial protein yield represents total mitochondria mg of protein per gram of tissue isolated from paired LL and PM muscles by differential centrifugation; mitochondrial DNA content was reported as a relative fold change in comparison to paired PM and LL muscles. dMeans in each row with different letters (x−y) differ (P < 0.05). Means in each column with different letters (a−c) differ (P < 0.05).

tricarboxylic acid cycle and can be used for mitochondrial oxygen consumption. Post-mortem bovine muscle can use succinate, pyruvate, and malate for oxygen consumption.6,7 With a less efficient antioxidant system, mitochondrial utilization of substrates for oxygen consumption can lead to greater ROS and increased oxidative changes which can trigger lipid oxidation. Both complexes I and III are the potential sites of ROS.30,31 Preincubation of HNE (a secondary lipid oxidation product) with bovine heart mitochondria decreased mitochondrial oxygen consumption.10 The reaction between mitochondrial protein and lipid oxidaiton products can be partially accounted for by the lower oxygen consumption in PM than LL mitochondria on day 7. Although mitochondrial oxygen

ability of PM mitochondria and greater mitochondrial content may be responsible for increased oxygen consumption in PM steaks. However, the overall change in mitochondrial oxygen consumption from day 0 to day 7 for LL was less (P < 0.05) than PM (changes in mitochondrial oxygen consumption in LL and PM between day 0 and 7 were 7.8 and 27.3, respectively). Immediately after animal harvest, cells try to maintain homeostasis for energy production; however, the lack of blood flow leads to failure of adaptive mechanisms. These changes can affect the pro- and antioxidant balance, leading to accumulation of reactive oxygen species (ROS). Tricarboxylic substrates such as citrate and malic acid are utilized faster in PM than that in LL.29 Both citrate and malate are intermediates in the 7752

DOI: 10.1021/acs.jafc.7b01735 J. Agric. Food Chem. 2017, 65, 7749−7755

Article

Journal of Agricultural and Food Chemistry

was lower than LL on days 3 and 7. This demonstrates that the mitochondrial degradation was greater in PM than LL. Mitochondria are the first organelle subjected to oxidative damage from free radicals, which can trigger mitochondrial degradation.11 Although the mechanism of muscle-specific differences in mitochondrial degradation in post-mortem muscle is not clear, we speculate the effects of oxidative stress on mitochondria from various disease conditions such as Alzheimer’s or Parkinson’s diseases from the medical research. Both inner and outer mitochondrial membranes are composed of phospholipids. Further, oxidative phosphorylation occurs within the mitochondrial inner membrane which can be a source of ROS formation. Hence, mitochondrial membranes are very prone to lipid peroxidation. Previous research demonstrated that incubation of a secondary lipid oxidation product such as HNE with bovine heart mitochondria increased vacuolation and fragmentation.10 In normal mitochondria, the outer membrane is more permeable due to porin proteins than the inner membrane; however, the oxidative condition can increase the permeability and fluidity of the inner membrane.35,36 This can lead to release of cytochrome c from the inner membrane to the outside. There were no significant differences in cytochrome c content in sarcoplasm of LL muscle with increased storage time, but the cytochrome c content increased for PM (Figure 2). In healthy cells, cytochrome c is

consumption was greater on day 0, increased oxidative stress combined with mitochondrial degeneration may be responsible for greater changes in oxygen consumption between day 0 and 7 for PM than LL. Oxidation−Reduction Potential. There was a significant muscle type and display time interaction for ORP (P < 0.001). PM had a greater ORP on day 0 (indicative of electron donating proteins or compounds) than LL (Figure 1). The

Figure 1. Effects of muscle type and display time on oxidation− reduction potential properties. A lower value represents greater antioxidant capacity. Least square means with different letters (a−c) differ (P < 0.05); standard error bars are indicated at each time point. LL = longissimus lumborum; PM = psoas major.

ORP measurements using the RedoxSys implies the net balance of oxidants and reductants, providing a direct measure of oxidative stress.22 Mitochondria contain several antioxidant proteins and electron-accepting compounds. Hence initial ORP values were higher in PM than LL (a lower number indicates a greater antioxidant potential). Interestingly, ORP values for LL did not change significantly during display. Although the mechanism for stable ORP in LL is not clear, we speculate that a greater MRA and a lower muscle oxygen consumption may have limited oxidative changes. ORP changes between days 0 and 3 were greater for PM than LL. This suggests that the antioxidant defense mechanisms lose efficacy more rapidly in PM than in LL. In support, Joseph et al.4 reported that PM has a lower amount of antioxidant proteins than LL in sarcoplasm, which makes it more susceptible to oxidative stress and buildup of free radicals and secondary lipid oxidation products, leading to faster discoloration. Lipid oxidation products can bind with lactic acid dehydrogenase and myoglobin to make muscles more prone to discoloration.25,26 Hence, discoloration and % metmyoglobin and % metmyoglobin accumulation were greater in PM than LL between days 1 and 3. Mitochondrial and Cytochrome c Content Changes. On day 0, PM muscle had a 2.55-fold greater mitochondrial DNA content than LL (Table 4). On day 0 of display, the average mitochondrial protein content in LL and PM were 0.21 and 0.38 mg/g of muscle, respectively (P = 0.02). This represents approximately a 1.80-fold difference in mitochondrial content between two muscles. PM has predominant red fibers32 compared to LL. Mohan et al.3 reported approximately a 1.21-fold higher mitochondrial concentration in beef PM compared with LL muscle in 10-day aged samples using cytochrome c oxidase activity. Previous research also demonstrated that mitochondrial enzyme levels were lower in rabbit and guinea pig white muscles than in red muscles.33,34 However, in the present study mitochondrial content in PM

Figure 2. Effects of muscle type and display time on cytochrome c content in sarcoplasm. Least squares means with different letters (a− d) differ (P < 0.05); standard error bars are indicated at each time point. LL = longissimus lumborum; PM = psoas major.

located within the mitochondrial inner membrane and also interacts with cardiolipin (a diphosphatidylglycerol lipid present in the mitochondrial membrane).37 Physiologically, greater levels of free cytochrome c in the intermembrane of mitochondria indicate mitochondrial damage by ROS.12 Several proapoptotic stimuli can trigger permeabilization of the outer mitochondrial membrane and promote mobilization of cytochrome c from the inner membrane and cardiolipin38,39 to sarcoplasm. Currently, limited knowledge is available on the factors that trigger the release of cytochrome c to sarcoplasm in post-mortem muscles. Since there were significant differences between muscle types, a systemic analysis of changes in mitochondrial and cytochrome c content can be used as a potential tool to predict color stability. As the results suggest, mitochondrial degradation caused by oxidative stress can influence meat color stability. Various 7753

DOI: 10.1021/acs.jafc.7b01735 J. Agric. Food Chem. 2017, 65, 7749−7755

Article

Journal of Agricultural and Food Chemistry

(7) Ramanathan, R.; Mancini, R. A. Effects of pyruvate on bovine heart mitochondria-mediated metmyoglobin reduction. Meat Sci. 2010, 86, 738−741. (8) Lanari, M. C.; Cassens, R. G. Mitochondrial activity and beef muscle color stability. J. Food Sci. 1991, 56, 1476−1479. (9) Mancini, R. A.; Ramanathan, R. Effects of postmortem storage time on color and mitochondria in beef. Meat Sci. 2014, 98, 65−70. (10) Ramanathan, R.; Mancini, R. A.; Suman, S. P.; Cantino, M. E. Effects of 4-hydroxy-2-nonenal on beef heart mitochondrial ultrastructure, oxygen consumption, and metmyoglobin reduction. Meat Sci. 2012, 90, 564−571. (11) Ouali, A.; Gagaoua, M.; Boudida, Y.; Becila, S.; Boudjellal, A.; Herrera-Mendez, C. H.; Sentandreu, M. A. Biomarkers of meat tenderness: Present knowledge and perspectives in regards to our current understanding of the mechanisms involved. Meat Sci. 2013, 95, 854−870. (12) Ott, M.; Gogvadze, V.; Orrenius, S.; Zhivotovsky, B. Mitochondria, oxidative stress, and cell death. Apoptosis 2007, 12, 913−922. (13) Ding, W. X.; Shen, H. M.; Ong, C. N. Calpain activation after mitochondrial permeability transition in microcystin-induced cell death in rat hepatocytes. Biochem. Biophys. Res. Commun. 2002, 291 (2), 321−331. (14) Bjugstad, K. B.; Fanale, C.; Wagner, J.; Jensen, J.; Salottolo, K.; Rael, L. T.; Bar-Or, D. A. 24h delay in the redox response distinguishes the most severe stroke patients from less severe stroke patients. J. Neurol. Neurophysiol. 2016, 7 (5), 100395. (15) The North American Meat Processors Association. (NAMP). The meat buyers guide. North American Meat Processors Association, Reston, VA. 2002. (16) Madhavi, D. L.; Carpenter, C. L. Aging and processing affect color, metmyoglobin reductase and oxygen consumption of beef muscles. J. Food Sci. 1993, 58, 939−947. (17) Sammel, L. M.; Hunt, M. C.; Kropf, D. H.; Hachmeister, K. A.; Johnson, D. E. Comparison of assays for metmyoglobin reducing ability in beef inside and outside semimembranosus muscle. J. Food Sci. 2002, 67, 978−984. (18) Grubbs, J. K.; Fritchen, A. N.; Huff-Lonergan, E.; Dekkers, J. C. M.; Gabler, N. K.; Lonergan, S. M. Divergent genetic selection for residual feed intake impacts mitochondria reactive oxygen species production in pigs. J. Anim. Sci. 2013, 91, 2133−2140. (19) Matsunaga, T.; Chikuni, K.; Tanabe, R.; Muroya, S.; Shibata, K.; Yamada, J.; Shinmura, Y. A quick and simple method for the identification of meat species and meat products by PCR assay. Meat Sci. 1999, 51, 143−148. (20) Schmittgen, T. D.; Livak, K. J. Analyzing real-time PCR data by the comparative C-T method. Nat. Protoc. 2008, 3, 1101−1108. (21) Estabrook, R. W. Mitochondrial respiratory control and the polarographic measurement of ADP: O ratios. Methods Enzymol. 1967, 10, 41−47. (22) Rael, L. T.; Bar-Or, R.; Kelly, M. T.; Carrick, M. M.; Bar-Or, D. Assessment of oxidative stress in patients with an isolated traumatic brain injury using disposable electrochemical test strips. Electroanalysis 2015, 27, 2567. (23) Spanidis, Y.; Goutzourelas, N.; Stagos, D.; Kolyva, A. S.; Gogos, C. A.; Bar-Or, D.; Kouretas, D. Assessment of oxidative stress in septic and obese patients using markers of oxidation-reduction potential. In vivo 2015, 29, 595−600. (24) Witte, V. C.; Krause, G. F.; Bailey, M. E. A new extraction method for determining 2-thiobarbituric acid values of pork and beef during storage. J. Food Sci. 1970, 35, 582−585. (25) Esterbauer, H.; Schaur, R. J.; Zollner, H. Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde and related aldehydes. Free Radical Biol. Med. 1991, 11, 81−128. (26) Chen, J. J.; Yu, B. P. Alterations in mitochondrial membrane fluidity by lipid peroxidation products. Free Radical Biol. Med. 1994, 17, 411−418. (27) Belskie, K. M.; Ramanathan, R.; Suman, S. P.; Mancini, R. A. Effects of muscle type and display time on beef mitochondria. In The

studies have demonstrated the role of mitochondria in color stability6,7,9 and in bloom development.40−43 Greater oxygen consumption may be detrimental to color stability and also for the formation of a bright-red color. Hence, controlling mitochondrial oxygen consumption via postharvest techniques such as packaging or storage temperature can minimize discoloration. Moderate mitochondrial activity might be beneficial for a brighter-red steak that lasts for a longer time. In summary, PM had shorter color stability than LL. In addition to the role of oxygen consumption and MRA, oxidative stress has muscle-specific effects on mitochondrial degradation and cytochrome c release. PM had greater mitochondrial degradation and less antioxidant capacity than LL with increased display time. Greater oxidative stress in PM may be responsible for cytochrome c release and lower mitochondrial content in PM than LL. Therefore, characterizing the factors responsible for mitochondrial degradation postmortem may help in understanding the muscle-specific differences in color stability.

■

AUTHOR INFORMATION

Corresponding Author

*Tel: +1 405-744-9260. Fax: +1 405-744-4716. E-mail: ranjith. [email protected]. ORCID

Ranjith Ramanathan: 0000-0001-7849-4432 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS Appreciation is expressed to the RedoxSys/Aytu Biosciences for providing the oxidation−reduction potential meter.

■

ABBREVIATIONS USED LL, longissimus lumborum; PM, psoas major; ORP, oxidation− reduction potential; MRA, metmyoglobin reducing activity; AOAC, Association of Official Analytical Chemists; IMPS, Institutional Meat Purchase Specifications; USDA, United States Department of Agriculture; PVC, polyvinyl chloride; HNE, 4-hydroxy-2-nonenal

■

REFERENCES

(1) AMSA. Meat color measurement guidelines. American Meat Science Association, Champaign, IL, 2012. (2) Smith, G. C.; Belk, K. E.; Sofos, J. N.; Tatum, J. D.; Williams, S. N. Economic implications of improved color stability in beef. Antioxidants in muscle foods: Nutritional strategies to improve quality; Wiley-Interscience: New York, 2000; pp 397−426. (3) Mohan, A.; Hunt, M. C.; Muthukrishnan, S.; Barstow, T. J.; Houser, T. A. Myoglobin redox form stabilization by compartmentalized lactate and malate dehydrogenases. J. Agric. Food Chem. 2010, 58, 7021−7029. (4) Joseph, P.; Suman, S. P.; Rentfrow, G.; Li, S.; Beach, C. M. Proteomics of Muscle-Specific Beef Color Stability. J. Agric. Food Chem. 2012, 60, 3196−3203. (5) McKenna, D.; Mies, P.; Baird, B.; Pfeiffer, K.; Ellebracht, J.; Savell, J. Biochemical and physical factors affecting discoloration characteristics of 19 bovine muscles. Meat Sci. 2005, 70, 665−682. (6) Tang, J.; Faustman, C.; Hoagland, T. A.; Mancini, R. A.; Seyfert, M.; Hunt, M. C. Postmortem oxygen consumption by mitochondria and its effects on myoglobin form and stability. J. Agric. Food Chem. 2005, 53, 1223−1230. 7754

DOI: 10.1021/acs.jafc.7b01735 J. Agric. Food Chem. 2017, 65, 7749−7755

Article

Journal of Agricultural and Food Chemistry Proceedings of American Meat Science Association, Reciprocal Meat Conference. 2014; abstract 117. (28) Seyfert, M.; Mancini, R. A.; Hunt, M. C.; Tang, J.; Faustman, C.; Garcia, M. Color stability, reducing activity, and cytochrome c oxidase activity of five bovine muscles. J. Agric. Food Chem. 2006, 54, 8919− 8925. (29) Abraham, A.; Dillwith, J. W.; Mafi, G. G.; VanOverbeke, D. L.; Ramanathan, R. Metabolite profile differences between beef longissimus and psoas muscles during display. Meat Mus. Bio. 2017, 1, 18− 27. (30) Raha, S.; Robinson. B.H. Mitochondria, oxygen free radicals, disease and ageing. Trends Biochem. Sci. 2000, 25, 502−508. (31) Turrens, J. F. Mitochondrial formation of reactive oxygen species. J. Physiol. 2003, 552, 335−344. (32) Hunt, M. C.; Hedrick, H. B. Profile of fiber types and related properties of five bovine muscles. J. Food Sci. 1977, 42, 513−517. (33) Glancy, B.; Balaban, R. S. Protein composition and function of red and white skeletal muscle mitochondria. Am. J. Physiol Cell Physiol 2011, 300, C1280−C1290. (34) Peter, J. B.; Barnard, R. J.; Edgerton, V. R.; Gillespie, C. A.; Stempel, K. E. Metabolic profiles of three fiber types of skeletal muscle in guinea pig and rabbit. Biochemistry 1972, 11, 2627−2633. (35) Guo, C.; Sun, L.; Chen, X.; Zhang, D. Oxidative stress, mitochondrial damage and neurodegenerative diseases. Neural Regener. Res. 2013, 8, 2003. (36) Chen, J.; Schenker, S.; Frosto, T. A.; Henderson, G. I. Inhibition of cytochrome c oxidase activity by 4-hydroxynonenal (HNE). Role of HNE adduct formation with the enzyme subunits. Biochim. Biophys. Acta, Gen. Subj. 1998, 1380, 336−344. (37) Garrido, C.; Galluzzi, L.; Brunet, M.; Puig, P. E.; DidelotMirjolet, C.; Kroemer, G. Mechanisms of cytochrome c release from mitochondria. Cell Death Differ. 2006, 13, 1423−1433. (38) Kagan, V. E.; Tyurin, V. A.; Jiang, J.; Tyurina, Y. Y.; Ritov, V. B.; Amoscato, A. A.; sipov, A. N.; Belikova, N. A.; Kapralov, A. A.; Kini, V.; Vlasova, I. I. Cytochrome c acts as a cardiolipin oxygenase required for release of proapoptotic factors. Nat. Chem. Biol. 2005, 1, 223−232. (39) Sinha, K.; Das, J.; Pal, P. B.; Sil, P. C. Oxidative stress: the mitochondria-dependent and mitochondria-independent pathways of apoptosis. Arch. Toxicol. 2013, 87, 1157−1180. (40) Ashmore, C. R.; Doerr, L.; Parker, W. Respiration of mitochondria isolated from dark-cutting beef- postmortem changes. J. Anim. Sci. 1972, 34, 46−48. (41) Cornforth, D. P.; Egbert, W. R. Effect of rotenone and pH on the color of pre-rigor muscle. J. Food Sci. 1985, 50, 34−35. (42) English, A. R.; Mafi, G. G.; VanOverbeke, D. L.; Ramanathan, R. Effects of extended aging on biochemical properties of dark cutting beef. J. Anim. Sci. 2016, 94, 4040−4048. (43) English, A. R.; Mafi, G. G.; VanOverbeke, D. L.; Ramanathan, R. Effects of extended aging and modified atmospheric packaging on beef top loin steak color. J. Anim. Sci. 2016, 94, 1727−1737.

7755

DOI: 10.1021/acs.jafc.7b01735 J. Agric. Food Chem. 2017, 65, 7749−7755