Effects of Nonalcoholic Fatty Liver Disease on Hepatic CYP2B1 and in

Jun 19, 2016 - Nonalcoholic fatty liver disease (NAFLD) refers to hepatic pathologies, including simple fatty liver (SFL), nonalcoholic steatohepatiti...
0 downloads 0 Views 5MB Size
Download PDF
Article pubs.acs.org/JAFC

Effects of Nonalcoholic Fatty Liver Disease on Hepatic CYP2B1 and in Vivo Bupropion Disposition in Rats Fed a High-Fat or Methionine/ Choline-Deficient Diet Sung-Joon Cho,† Sang-Bum Kim,† Hyun-Jong Cho,‡ Saeho Chong,† Suk-Jae Chung,† Il-Mo Kang,# Jangik Ike Lee,† In-Soo Yoon,*,§ and Dae-Duk Kim*,† †

College of Pharmacy and Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 08826, Republic of Korea College of Pharmacy, Kangwon National University, Gangwon 24341, Republic of Korea # Advanced Geo-materials R&D Department, Korea Institute of Geoscience and Mineral Resources, Pohang Branch, Gyeongbuk 37559, Republic of Korea § College of Pharmacy and Natural Medicine Research Institute, Mokpo National University, Jeonnam 58554, Republic of Korea ‡

ABSTRACT: Nonalcoholic fatty liver disease (NAFLD) refers to hepatic pathologies, including simple fatty liver (SFL), nonalcoholic steatohepatitis (NASH), fibrosis, and cirrhosis, that may progress to hepatocellular carcinoma. These liver disease states may affect the activity and expression levels of drug-metabolizing enzymes, potentially resulting in an alteration in the pharmacokinetics, therapeutic efficacy, and safety of drugs. This study investigated the hepatic cytochrome P450 (CYP) 2B1modulating effect of a specific NAFLD state in dietary rat models. Sprague−Dawley rats were given a methionine/cholinedeficient (MCD) or high-fat (HF) diet to induce NASH and SFL, respectively. The induction of these disease states was confirmed by plasma chemistry and liver histological analysis. Both the protein and mRNA levels of hepatic CYP2B1 were considerably reduced in MCD diet-fed rats; however, they were similar between the HF diet-fed and control rats. Consistently, the enzyme-kinetic and pharmacokinetic parameters for CYP2B1-mediated bupropion metabolism were considerably reduced in MCD diet-fed rats; however, they were also similar between the HF diet-fed and control rats. These results may promote a better understanding of the influence of NAFLD on CYP2B1-mediated metabolism, which could have important implications for the safety and pharmacokinetics of drug substrates for the CYP2B subfamily in patients with NAFLD. KEYWORDS: nonalcoholic fatty liver disease, high-fat diet, methionine/choline-deficient diet, CYP2B1, bupropion

■

INTRODUCTION Nonalcoholic fatty liver disease (NAFLD) is defined as a condition where excessive fat is accumulated in hepatocytes without substantial alcohol intake1 and refers to hepatic pathologies, including simple fatty liver (SFL) and nonalcoholic steatohepatitis (NASH).2 SFL (steatosis) is defined as a condition where hepatic triglyceride is accumulated (exceeding 5% of total liver weight) together with macro- and/or microvesicular steatosis.3 Although SFL itself does not necessarily cause liver injury, it may progress to NASH through several mechanisms, including oxidative stress and cytokine production.4,5 The symptoms of NASH are reported to be steatosis, ballooning degeneration, lobular inflammation, and/ or progressive fibrosis.6 Currently, NAFLD is the most common chronic hepatic disorder in the US and number of other countries7 with recent estimates indicating that the worldwide prevalence of NAFLD is 20−30% in adults and 90% in obese populations.8,9 Cytochrome P450 (CYP) monooxygenases can catalyze the metabolic process of various endo/xeno-biotics, including prostaglandins, pollutants, steroids, and pharmaceuticals.10 Although CYPs are ubiquitously expressed in several organs, the majority of CYP isoforms responsible for drug metabolism are expressed at the highest level in the liver.11 Previously, approximately 67% of the 200 most commonly prescribed drugs were reported to be metabolized via CYPs.12 The © 2016 American Chemical Society

expression level and function of hepatic CYPs are known to be influenced by numerous factors such as genetics, age, disease, concurrent drugs, and food.4 Occurrence of these factors could alter hepatic CYP-mediated drug metabolism, potentially leading to undesirable consequences related to drug efficacy and safety. Chronic hepatic disorders such as cholestasis, hepatitis, and alcoholic liver disease have been reported to influence hepatic CYP-mediated drug metabolism.13,14 Thus, several studies have focused on NAFLD, the most prevalent chronic liver disease, as another factor that can modulate the activity and expression levels of CYPs in the livers of rodent models and human.2,15 However, the results of most studies are not sufficient to fully characterize the CYP-modulating effect of a specific NAFLD state in terms of mRNA/protein expression and in vitro and in vivo activity. Moreover, several different studies on the same NAFLD state and CYP isoform have reported very conflicting results. In particular, information regarding the impact of NASH and SFL on the activity and expression levels of the Received: Revised: Accepted: Published: 5598

April 22, 2016 June 18, 2016 June 18, 2016 June 19, 2016 DOI: 10.1021/acs.jafc.6b01663 J. Agric. Food Chem. 2016, 64, 5598−5606

Article

Journal of Agricultural and Food Chemistry Table 1. Specific Primer Pairs and Real-Time PCR Conditions Condition

CYP2B1

GAPDH

Primer sequences (5′ → 3′)

CTCCAAAAACCTCCAGGAAATCCTC GTGGATAACTGCATCAGTGTATGGC 95 °C for 10 s 60 °C for 10 s 72 °C for 10 s 118 bp 45

CAGTCAAGGCTGAGAATG GAGATGATGACCCTTTTGG 95 °C for 10 s 60 °C for 10 s 72 °C for 10 s 190 bp 45

Denaturation Annealing Elongation PCR product Cycle number

injection), an approximate 3 mL blood sample was obtained from the abdominal artery of a rat. After centrifugation of the blood sample, a 1000 μL of plasma was stored at −80 °C in a deep freezer (Model DF8517, Ilshin Laboratory, Seoul, Republic of Korea) until plasma chemistry analysis (Laboratory Animal Center of Seoul National University). For liver histological analysis, a segment of liver was removed from the rats, washed with PBS, and fixed with 4% polyoxymethylene over 1 day. The liver segment was vertically cut into thin slices and then stained with hematoxylin−eosin (H&E) (Maxdiagnostics, Seoul, Republic of Korea). The stained samples were observed under a light microscope (200×) (Olympus JP/IX70, Olympus Optical, Tokyo, Japan). Real-Time PCR Analysis. TRIzol reagent was used to prepare a total intact RNA sample from the 100 mg liver samples (Invitrogen, CA, United States). The purity and content of the total RNA were measured by a spectrophotometer with a wavelength of 260−280 nm. The first strand cDNA kit (Takara Shuzo, Shiga, Japan) was used for cDNA synthesis from about 1 μg of the total RNA. The conditions of cDNA synthesis were as follows: incubation at 42 °C for 1 h, heating to 95 °C for 5 min, and cooling to 4 °C. To determine the mRNA expression of rat CYP2B1, real-time PCR analysis was conducted using a LightCycler 1.5 system (Roche, Mannheim, Germany). Rat GAPDH was employed to normalize gene expression in all samples. Quantitative PCR analysis was conducted using the LightCycler FastStart DNA Master SYBR Green1 kit (Roche). The specific primer pairs and real-time PCR conditions are listed in Table 1. The temperature transition velocity was set at 20 °C/s. In order to identify the presence of nonspecific amplification, we constructed a melting curve from the reaction of amplification of keeping the temperature at 65 °C for 15 s and subsequently increasing the temperature up to 95 °C with a temperature transition velocity of 0.1 °C/s. The mode of signal acquisition was set at “Continuous”. The relative quantification of mRNA expression was conducted using the delta−delta method.18 Western Blotting Analysis. A 100-mg liver segment was homogenized in RIPA buffer (Biosesang, Seongnam, Republic of Korea) supplemented with protease inhibitors (Roche) using a glass homogenizer. Following centrifugation at 16000g for 10 min, the supernatant was obtained and stored at −80 °C until Western blotting analysis. A BCA kit (Thermo Fisher Scientific, IL, United States) was used to measure protein contents. An aliquot containing 50 μg of protein was mixed with loading buffer composed of glycerol, 0.5 M Tris-HCl (pH 6.8), 2-β-mercaptoethanol, 10% sodium dodecyl sulfate, and bromophenol blue. The mixture was loaded on a 10% polyacrylamide gel containing 0.1% sodium dodecyl sulfate and electrophoretically separated. The resultant gel was then transferred into a nitrocellulose membrane and blocked with 5% skimmed milk (BD Biosciences, MD, United States) followed by a 12 h incubation with primary antibodies against β-actin and CYP2B1 (Santa Cruz Biotechnology, CA, United States). After being washed 4 times with PBS-Tween buffer, antimouse immunoglobulin G conjugated with peroxidase (Santa Cruz Biotechnology) was applied as a secondary antibody. The bound antibodies were detected by a chemiluminescence detection system (GE Healthcare, Uppsala, Sweden). Preparation of Rat Liver Microsomes. We prepared rat liver microsome as described previously.19 Briefly, the overnight-fasted rat livers of HF diet-fed, MCD diet-fed, and control rats were homogenized with buffer consisting of 0.154 M potassium chloride and 50 mM Tris hydrochloride in 1 mM EDTA (pH 7.4). The

CYP2B subfamily is limited, which necessitates a more systematic study in rodent models or humans. In our present study, the effects of NAFLD on the activity and expression levels of rat hepatic CYP2B1 were investigated. Rat models of SFL and NASH were established by feeding male Sprague−Dawley rats a methionine/choline-deficient (MCD) or high-fat (HF) diet, respectively, for eight weeks ad libitum.4,16 Subsequently, the protein and mRNA expression levels of hepatic CYP2B1 were assessed by Western blotting and real-time polymerase chain reaction (PCR) analyses. The in vivo and in vitro functions of hepatic CYP2B1 in the two different rat models were further evaluated by microsomal metabolism and intravenous pharmacokinetic studies of bupropion (BUP, probe substrate of CYP2B1) and hydroxybupropion (HBUP, CYP2B1-specific metabolite of BUP).17 As far as we know, this is the first report to show the expression and activity of hepatic CYP2B1 in HF and MCD diet-fed rat models of SFL and NASH, respectively. Therefore, this research provides a good basis for the improved understanding of NAFLD and CYP2B-mediated drug metabolism.

■

MATERIALS AND METHODS

Chemicals and Reagents. BUP, HBUP, and diltiazem were obtained from Sigma-Aldrich (St. Louis, MO, United States). Dihydronicotinamide adenine dinucleotide phosphate (NADPH) was obtained from Wako (Tokyo, Japan). Normal rodent food (D12450B) and HF food (D12492) were obtained from Research Diets, Inc. (NJ, United States). MCD food (#518810) was purchased from Dyets (PA, United States). Zoletil was purchased from Virbac (TX, United States). Chemicals of analytical-reagent grade were used in this study. Animals. Male Sprague−Dawley rats (7−9 weeks, 230−270 g) were obtained from Orient Bio (Seongnam, Republic of Korea). Rats were maintained at 20−23 °C with a 12/12 h light (07:00−19:00)/ dark (19:00−07:00) cycle and a 50 ± 5% humidity (Animal Center for Pharmaceutical Research, Seoul National University). Rats were kept in metabolic cages (Tecniplast, Varese, Italy) with filtered air without pathogens and with ad libitum feeding of food (Agribrands Purina Korea, Pyeongtaek, Republic of Korea) and water. Following a 1-week acclimation, a total of 27 rats were divided into 3 experimental groups, i.e., plasma chemistry/liver histology/PCR/Western blotting, in vitro microsomal metabolism, and in vivo pharmacokinetic experiments. In each experimental group, nine rats were divided into three diet groups, i.e. HF diet-fed, MCD diet-fed, and control rats (n = 3 for each diet group). Rats of the “control” group were given a normal diet (containing 10 kcal% of fat) to induce a healthy liver. Rats of the “HF” group were given an HF diet (containing 60 kcal% of fat) to induce SFL, while rats of the “MCD” group were given an MCD diet (without methionine and choline) to induce NASH. Rats freely took in their own diet for the 8 weeks.4,16 The animal experiments conducted in this study were approved by the Institutional Animal Care and Use Committee of Seoul National University (Seoul, Republic of Korea). Plasma Chemistry and Liver Histological Analysis in Rats. After 8 weeks, blood was collected from each rat for plasma chemistry analysis. After Zoletil anesthetization (20 mg/kg, intramuscular 5599

DOI: 10.1021/acs.jafc.6b01663 J. Agric. Food Chem. 2016, 64, 5598−5606

Article

Journal of Agricultural and Food Chemistry

Figure 1. Plasma levels of AST (A), ALT (B), GGT (C), total bilirubin (D), glucose (E), and triglyceride (F) in control, HF diet-fed, and MCD diet-fed rats. The rectangular bars and their error bars represent the means and standard deviations, respectively (n = 3). The asterisks label values significantly different from those of the other groups (p < 0.05). to a 100 μL aliquot of ice-cold methanol containing diltiazem (100 ng/ mL) as an internal standard. The samples were centrifuged at 16000g for 5 min at 4 °C, and 5 μL of supernatant was injected into an LCMS/MS system. The kinetic parameters (Vmax and Km) for the formation of HBUP were estimated by nonlinear regression analysis.21 The microsomal metabolism data were fitted to a single-site Michaelis−Menten equation as follows (with no weighting):

resultant homogenate was processed by centrifugation at 10000g for 30 min, and its supernatant was further centrifuged at 100000g for 90 min. The resultant pellet was suspended with buffer consisting of 0.154 M KCl and 50 mM Tris-HCl in 1 mM EDTA (pH 7.4). The resultant microsomal preparation was stored at −80 °C until the microsomal metabolism study. The concentration of protein in the prepared hepatic microsomes was determined using a BCA kit (Thermo Fisher Scientific). In Vitro Metabolism Study in Rat Liver Microsomes. Km (apparent Michaelis−Menten constant) and Vmax (the maximum velocity) for the formation of HBUP in rat liver microsomes were estimated as described previously.20 The prepared rat liver microsomes (0.5 mg/mL protein content) were spiked with a 2.5 μL methanol solution containing BUP and a 25 μL 0.1 M phosphate buffer (pH 7.4) containing 1.2 mM NADPH (total volume: 250 μL) and incubated in a thermomixer set at 500 oscillations/min at 37 °C. The final concentrations of BUP in the incubation mixture were 10, 20, 50, 100, 200, 500, and 1000 μM. Following a 30 min incubation, the reaction was terminated by adding a 100 μL aliquot of the incubation mixture

V=

Vmax × [S] K m + [S]

Where [S] is the concentration of a substrate. The intrinsic clearance (CLint) for the formation of HBUP in hepatic microsomes was estimated from the ratio of Vmax to Km. In Vivo Pharmacokinetic Study in Rats. The femoral vein and artery were cannulated with PE-50 polyethylene tubing (Clay Adams, Parsippany, NJ, United States) under Zoletil anesthetization (20 mg/ kg, intramuscular injection). BUP (dissolved in saline) was administered intravenously at 10 mg/kg. About a 250 μL blood 5600

DOI: 10.1021/acs.jafc.6b01663 J. Agric. Food Chem. 2016, 64, 5598−5606

Article

Journal of Agricultural and Food Chemistry sample was obtained from the femoral artery at 0, 1, 5, 15, 30, 60, 120, 240, 360, 480, 720, and 1440 min after drug administration. Following centrifugation of the blood sample at 16000g for 5 min (4 °C), 100 μL of plasma was stored at −80 °C until LC-MS/MS analysis. Urine samples were collected using a 15 mL round-bottomed tube throughout the in vivo pharmacokinetic study. After the urine volume was measured, a 50 μL aliquot was stored at −80 °C until LC-MS/MS analysis. A 100 μL aliquot of the plasma or urine sample was transferred into 1.5 mL microtube, and 20 μL of 1N NaOH was added. The resultant mixture was extracted with 1000 μL of ethyl acetate containing diltiazem (internal standard; 100 ng/mL) and centrifuged at 16000g for 5 min. The resultant upper organic phase was transferred into a new 1.5 mL tube and evaporated with nitrogen gas at room temperature. The residue was resuspended with 100 μL of methanol, and a 50 μL aliquot was injected directly into the LC-MS/MS system. Drug Analysis Using LC-MS/MS System. The BUP and HBUP contents in microsomes, plasma, and urine were determined using a tandem mass spectrometer (Agilent Triple Quad LC/MS 6430; Agilent Technologies, CA, United States) with an electrospray ionization interface used for generation of positive ion modes. Chromatographic separation was conducted using an Agilent 1260 series HPLC system (Agilent Technologies) with a reversed-phase column (Agilent C18, 4.6 × 50 mm, 2.7 μm particle size; Agilent Technologies). The mobile phase for the HPLC system was comprised of acetonitrile (solvent A) and 0.1% formic acid in water (solvent B) which was eluted at 0.2 mL/min. The gradient elution protocol was as follows: (1) solvent A was set to 40% at 0 min, (2) a linear gradient was run to 80% in 3 min and maintained 80% until 5 min, and (3) a linear gradient was run back to 40% in 6 min and maintained until 15 min. Mass transitions for quantification of BUP, HBUP, and diltiazem were m/z 240.3 → 184.2, 256.2 → 238.2, and 415.2 → 178.1, respectively. The lower limits of quantification of BUP and HBUP were 1 ng/mL. The inter/intraday coefficient of variation values were 13.4% or lower. Pharmacokinetic Analysis. Area under plasma concentration versus the time curve from time zero to infinity (AUC) was determined by the trapezoidal rule-extrapolation method.22 Area from the last sampling time point to time infinity was determined by dividing the concentration at the last sampling time point by the rate constant for the terminal phase. The following pharmacokinetic parameters were calculated using a noncompartmental analysis (WinNonlin; Certara United States, Inc., NJ, United States): total body, renal, and nonrenal clearances (CL, CLR, and CLNR, respectively), apparent volume of distribution at steady-state (Vss), and terminal half-life (t1/2). Statistical Analysis. We conducted statistical analysis using oneway analysis of variance (ANOVA) with Duncan’s posthoc test (SAS version 9.4 statistical software, SAS Institute Inc., Cary, NC, United States). A p-value of less than 0.05 with a statistical power of more than 0.8 (G*Power version 3.1 statistical software)23 was considered statistically significant. All data are expressed as the mean ± standard deviation.

Liver Histology in Rat NAFLD Models. Figure 2 shows the H&E stained cross sections of the livers of HF diet-fed,

RESULTS Plasma Chemistry in Rat NAFLD Models. Figure 1 shows the plasma levels of AST, ALT, GGT, total bilirubin, glucose, and triglycerides in HF diet-fed, MCD diet-fed, and control rats. In MCD diet-fed rats, the AST, ALT, GGT, and total bilirubin levels were significantly elevated by 118, 461, 125, and 133%, respectively, and the glucose and triglyceride levels were slightly (not significantly) reduced by 17.2 and 43.1%, respectively, in comparison with those of the control rats. In HF diet-fed rats, the glucose and triglyceride levels were significantly elevated by 32.1 and 168%, respectively, in comparison with those of the control rats. However, there were no significant differences in the AST, ALT, GGT, or total bilirubin levels between the HF diet-fed and control rats.

Figure 2. H&E staining of liver tissues in control (A), HF diet-fed (B), and MCD diet-fed (C) rats. The scale bars represent 50 μm. The circles and arrow indicate the lipid vesicles and lobular inflammation, respectively.

■

MCD diet-fed, and control rats. In the liver of control rats, there was no evidence of disease states such as steatosis, lobular inflammation, ballooning degeneration, or fibrosis (Figure 2A). However, a number of different-sized lipid vesicles were observed in the HF diet-fed and MCD diet-fed rat livers, indicating micro- and/or macrovesicular steatosis (Figures 2B and 2C). The sizes of the lipid vesicles in the MCD diet-fed rat livers seemed to be larger than those in the HF diet-fed rat 5601

DOI: 10.1021/acs.jafc.6b01663 J. Agric. Food Chem. 2016, 64, 5598−5606

Article

Journal of Agricultural and Food Chemistry

expression levels of the hepatic CYP2B1 protein in MCD dietfed rats were significantly reduced by 76.8% in comparison those of the control rats, while there were no significant differences in hepatic CYP2B1 protein expression between the HF diet-fed and control rats (Figure 4). In Vitro Metabolism Kinetics of BUP in Hepatic Microsomes of Rat NAFLD Models. Figure 5 shows the mean velocities for HBUP formation from several BUP concentrations in hepatic microsomes of HF diet-fed, MCD diet-fed, and control rats. The Km, Vmax, and CLint values for HBUP formation in hepatic microsomes of HF diet-fed, MCD diet-fed, and control rats are summarized in Table 2. The kinetics of saturation and concentration-dependency were welldescribed by assuming one saturable component. In MCD dietfed rats, the Vmax value was considerably lower (by 20.9%, p < 0.05, power = 0.176), while the Km value was significantly higher than that in the control rats by 188%. Consequently, the CLint value decreased significantly in MCD diet-fed rats by 72.0%. However, there were no significant differences in the Km and CLint values between the HF diet-fed and control rats. In Vivo Intravenous Pharmacokinetics of BUP in Rat NAFLD Models. Figure 6 shows the plasma level versus time profiles of BUP and HBUP following intravenous injection of BUP at 10 mg/kg, and Table 3 lists relevant pharmacokinetic parameters. The body weights of HF diet-fed and MCD dietfed rats were significantly higher (by 27.5%) and lower (by 44.3%), respectively, than those of the control rats. HF diet-fed and MCD diet-fed rats showed changes in a few pharmacokinetic parameters of BUP in comparison with those of the control rats as follows: considerably higher AUC (by 83.0 and 90.5%, p < 0.05, power = 0.718), and significantly lower CL (by 46.3 and 46.0%) and CLNR (by 46.3 and 46.9%) values. However, there were no significant differences in the CLR

livers. Moreover, lobular inflammation was found in the MCD diet-fed rat livers (Figure 2C). mRNA and Protein Levels of CYP2B1 in the Livers of Rat NAFLD Models. Figures 3 and 4 show the mRNA and

Figure 3. mRNA expression levels of hepatic CYP2B1 in control, HF diet-fed, and MCD diet-fed rats. The rectangular bars and their error bars represent the means and standard deviations, respectively (n = 3). The pound sign represents a value considerably different from that of the control group (p < 0.05, power < 0.8).

protein expressions of hepatic CYP2B1 in HF diet-fed, MCD diet-fed, and control rats. As shown in Figure 3, the hepatic CYP2B1 mRNA expression level in MCD diet-fed rats was considerably lower than that in the control rats (by 63.5%, p < 0.05, power = 0.684), while it was similar between the HF dietfed and control rats (p = 0.704, power = 0.684). Similarly, the

Figure 4. Protein expression levels of hepatic CYP2B1 in control, HF diet-fed, and MCD diet-fed rats. The rectangular bars and their error bars represent the means and standard deviations, respectively (n = 3). The asterisk represents a value significantly different from that of the other groups (p < 0.05). 5602

DOI: 10.1021/acs.jafc.6b01663 J. Agric. Food Chem. 2016, 64, 5598−5606

Article

Journal of Agricultural and Food Chemistry

Figure 6. Plasma concentration versus time profiles of BUP (A) and HBUP (B) after intravenous administration of BUP at a dose of 10 mg/kg to the control, HF diet-fed, and MCD diet-fed rats. The bullet symbols and their error bars represent the means and standard deviations, respectively (n = 3).

Figure 5. Mean velocities for the formation of HBUP from various concentrations of BUP in hepatic microsomes of control, HF diet-fed, and MCD diet-fed rats. The bullet symbols and their error bars represent the means and standard deviations, respectively (n = 3). The solid lines represent the fitted nonlinear regression curves.

and NASH rat models, respectively. HF diets with 40−75 kcal% fat are known to induce the common symptoms of SFL, including obesity, hyperglycemia, and hepatic steatosis in rats.24 In the HF diet-fed model, the induction of steatosis is a consequence of enhanced net influx of lipids into the liver,16 and this model closely resembles the pathophysiology of human NAFLD in that white adipose tissue is the main organ associated with metabolic and proinflammatory abnormalities.25 Nutrient-deficient models, including the MCD diet-fed model, are the most commonly used dietary NAFLD models.24 In general, an MCD diet induces more severe hepatic steatosis and injury compared to that induced by HF diet-fed models;26 however, the MCD diet-fed model lacks the risk factors that can contribute to NAFLD progression, i.e., obesity and diabetes.24 The nutritional deficiency caused by an MCD diet results in the loss of body weight and white adipose tissue in mice.27 Unlike an HF diet, an MCD diet induces NASH via impaired synthesis of very low-density lipoprotein and/or lipid peroxidation, which leads to an enhanced uptake of fatty acid into the liver.16 Although the induction of initial steatosis in the MCD diet-fed model is not closely related to the peripheral insulin resistance that tends to be often observed in human NASH, pathophysiological consequences, including zone-3 fibrosis, hepatocellular injury, and inflammatory recruitment, do resemble those observed in human NASH.28

values of BUP among the three groups of rats, and the Ae0−24h value of BUP also was similar among the three groups of rats (p = 0.137, power = 0.259). The Vss values of BUP in HF or MCD diet-fed rats were lower than that in the control rats (by 46.8 and 63.5%; p = 0.058, power = 0.397). The AUC value of HBUP was lower in MCD diet-fed rats than in the HF diet-fed or control rats (by 41.0 and 46.8%; p = 0.106, power = 0.286). Consequently, the ratio of the AUC of HBUP to the AUC of BUP (AUC HBUP /AUC BUP ) in MCD diet-fed rats was considerably lower (by 69.1%) than that in the control rats (p < 0.05, power = 0.670). However, the AUC value of HBUP and the AUCHBUP/AUCBUP value were similar between the HF diet-fed and control rats (p = 0.106, power = 0.286 for the AUCHBUP; p = 0.083, power = 0.670 for the AUCHBUP/ AUCBUP). The Cmax and Tmax values of HBUP were similar among the three groups of rats (p = 0.063, power = 0.539).

■

DISCUSSION The current study provided novel data on the hepatic CYP2B1modulating effects of a specific NAFLD state in rats. The dietary animal model of NAFLD could have potential relevance to its corresponding human disease because the majority of NAFLD patients have no genetic defects.24 In the present study, 8-week HF or MCD diets were used to establish the SFL

Table 2. In Vitro Vmax, Km, and CLint Values for the Formation of HBUP in Hepatic Microsomes of Control, HF, and MCD Rats (n = 3)

a

parameter

control

HF

MCD

Vmax (pmol/min/mg protein) Km (μM) CLint (μL/min/mg protein)

60.7 ± 0.6 102 ± 11 0.599 ± 0.068

49.7 ± 18.5 103 ± 46 0.502 ± 0.060

48.0 ± 4.7b 294 ± 47a 0.168 ± 0.047a

Significantly different from the other groups (p < 0.05). bConsiderably different from the control group (p < 0.05, power < 0.8). 5603

DOI: 10.1021/acs.jafc.6b01663 J. Agric. Food Chem. 2016, 64, 5598−5606

Article

Journal of Agricultural and Food Chemistry

Table 3. Pharmacokinetic Parameters of BUP and HBUP after Intravenous Administration of BUP at a Dose of 10 mg/kg to the Control, HF, and MCD Rats (n = 3) control

HF

body weight (g)

parameter

400 ± 18a

510 ± 13a

223 ± 12a

MCD

AUC (μg·min/mL) CL (mL/min/kg) CLR (mL/min/kg) CLNR (mL/min/kg) Vss (mL/kg) Ae0−24h (% of dose)

147 ± 26 69.5 ± 11.8a 3.21 ± 0.31 66.3 ± 11.5a 8940 ± 4850 4.67 ± 0.56

269 ± 19b 37.3 ± 2.5 1.70 ± 0.58 35.6 ± 2.0 4760 ± 1090 4.50 ± 1.33

280 ± 78b 37.5 ± 9.3 2.29 ± 0.16 35.2 ± 9.3 3260 ± 394 6.41 ± 1.77

AUC (μg·min/mL) Cmax (ng/mL) Tmax (min) AUCHBUP/AUCBUP ratio

40.7 ± 13.5 0.122 ± 0.012 30 (15−60) 0.282 ± 0.140

45.1 ± 17.3 0.0749 ± 0.0319 15 (15−60) 0.166 ± 0.056

24.0 ± 5.6 0.0853 ± 0.0064 60 (60−120) 0.0872 ± 0.0165b

BUP

HBUP

a

Significantly different from the other groups (p < 0.05). bConsiderably different from the control group (p < 0.05, power < 0.8).

downregulation mechanisms may be responsible for the differential effects of MCD and HF diets on hepatic CYP2B1 expression, though the exact mechanism merits further investigation. To date, there have been few reports on the activity or expression of hepatic CYP2B1 in rat NAFLD models. Moreover, the effect of NAFLD on human CYP2B6, the human orthologue of rat CYP2B1,37 has not yet been established. Two separate studies have reported reduced CYP2B6 mRNA expression in human NASH, which coincides with the observations from our present rat study.38,39 However, another study has reported that NAFLD progression increased the mRNA expression of CYP2B6 in humans.4 Thus, further investigation is required to properly address the species differences in mRNA expression of CYP2B between humans and rats. The activity of hepatic CYP2B1 was evaluated by measuring the in vitro metabolism of BUP to HBUP in hepatic microsomes isolated from control, MCD diet-fed, and HF diet-fed rats. BUP is a probe substrate of human CYP2B6 and rat CYP2B1, and BUP hydroxylation is a selective marker for CYP2B1-mediated metabolism in rats.17 The Vmax and CLint values for HBUP formation in MCD diet-fed rat liver microsomes were considerably reduced, while they were comparable between the control and HF diet-fed rat liver microsomes (Table 2). These results are consistent with the protein and mRNA expression data of hepatic CYP2B1 in MCD diet-fed and HF diet-fed rats (Figures 3 and 4). To study the influence of NAFLD on the in vivo CYP2B1mediated metabolism in the livers of rats, intravenous BUP pharmacokinetics was evaluated in the HF diet-fed, MCD dietfed, and control rats. Although dose-dependencies of BUP pharmacokinetics have not been reported in rats, 10 mg/kg BUP was used for the current rat pharmacokinetic study because intraperitoneal and oral administration at doses of 15− 50 mg/kg have been commonly used in previous rat pharmacokinetic studies.40−42 BUP is eliminated mainly via hepatic metabolism in humans and rats,41,43 which is consistent with the negligible Ae0−24h and CLR values of BUP in this study (Table 3). Thus, CLNR of BUP may be able to represent its hepatic metabolic clearance. No study has reported the hepatic extraction ratio (HER) of BUP in rats. However, when comparing the CLNR values of BUP (53.8−76.5 mL/min/kg in control rats, Table 3) with the rate of blood flow to perfuse the rat liver (ranging from 50 to 80 mL/min/kg),44 it is

In the present study, the control and HF diets contain the same ingredients with different ratios, resulting in a higher fat content in the HF diet (fat: 60 kcal%) than in the control diet (fat: 10 kcal%). HF diet-fed rats showed unaltered plasma levels of liver function markers (Figure 1) and mild hepatic steatosis (Figure 2B). Moreover, the body weights and glucose levels increased significantly in HF diet-fed rats (Figure 1 and Table 3). These results are consistent with observations in the previously reported 8-week HF diet-fed rat model with SFL.16,29 MCD diet-fed rats exhibited increased plasma concentrations of liver function markers, indicating liver injury (Figure 1). Moreover, extensive steatosis and lobular inflammation were observed in MCD diet-fed rat livers (Figure 2C); however, the body weights were significantly reduced (Table 3). This finding is consistent with observations in the previously reported 8-week MCD dietary rat model with early stage NASH.29 Thus, these results, as shown in Figures 1 and 2, demonstrate that the rat models of NASH and SFL were successfully established by the 8-week MCD and HF diets, respectively. The expression levels of hepatic CYP2B1 mRNA and protein in MCD diet-fed rats were considerably lower than those in control rats, while they were similar between the HF diet-fed and control rats (Figures 3 and 4). Information regarding the mechanisms responsible for the alteration of CYP2B1 expression in the NAFLD states is currently limited. The few potential mechanisms that have been proposed include nuclear receptor activation, inhibition by fatty acids, and involvement of inflammatory mediators.2 Constitutive androstane receptor (CAR) and pregnane X receptor (PXR) were reported to be activated in the NAFLD mouse model,2,30 and consequently, the expression of CYP2B1 may be upregulated via the activation of PXR and CAR.31 Meanwhile, in the progression of NAFLD, an increased synthesis/influx and reduced βoxidation of fatty acids lead to an excessive accumulation of fatty acids and neutral fat in the liver tissue, including hepatocytes.32 Notably, a few studies reported that some fatty acids downregulated the expression of CYP2B1 and 2B6 in rat and human hepatocytes.33−35 In addition, several cytokines and inflammatory mediators such as interleukin 1 (IL-1), tumor necrosis factor-α, IL-6, and IL-8 are involved in the progression of NAFLD, and the downregulation of CYP2B1 expression in the inflammation states has been well-described.36 Taken together, it is speculated that the interplay among these up- and 5604

DOI: 10.1021/acs.jafc.6b01663 J. Agric. Food Chem. 2016, 64, 5598−5606

Article

Journal of Agricultural and Food Chemistry

(2) Merrell, M. D.; Cherrington, N. J. Drug metabolism alterations in nonalcoholic fatty liver disease. Drug Metab. Rev. 2011, 43, 317−334. (3) Neuschwander-Tetri, B. A.; Caldwell, S. H. Nonalcoholic steatohepatitis: summary of an AASLD Single Topic Conference. Hepatology 2003, 37, 1202−1219. (4) Fisher, C. D.; Lickteig, A. J.; Augustine, L. M.; Ranger-Moore, J.; Jackson, J. P.; Ferguson, S. S.; Cherrington, N. J. Hepatic cytochrome P450 enzyme alterations in humans with progressive stages of nonalcoholic fatty liver disease. Drug Metab. Dispos. 2009, 37, 2087−2094. (5) Day, C. P.; James, O. F. Steatohepatitis: a tale of two ″hits″? Gastroenterology 1998, 114, 842−845. (6) Younossi, Z. M. Review article: current management of nonalcoholic fatty liver disease and non-alcoholic steatohepatitis. Aliment. Pharmacol. Ther. 2008, 28, 2−12. (7) Hardwick, R. N.; Fisher, C. D.; Street, S. M.; Canet, M. J.; Cherrington, N. J. Molecular mechanism of altered ezetimibe disposition in nonalcoholic steatohepatitis. Drug Metab. Dispos. 2012, 40, 450−460. (8) Wieckowska, A.; Feldstein, A. E. Diagnosis of nonalcoholic fatty liver disease: invasive versus noninvasive. Semin. Liver Dis. 2008, 28, 386−395. (9) Machado, M.; Marques-Vidal, P.; Cortez-Pinto, H. Hepatic histology in obese patients undergoing bariatric surgery. J. Hepatol. 2006, 45, 600−606. (10) Nelson, D. R.; Zeldin, D. C.; Hoffman, S. M.; Maltais, L. J.; Wain, H. M.; Nebert, D. W. Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including nomenclature recommendations for genes, pseudogenes and alternative-splice variants. Pharmacogenetics 2004, 14, 1−18. (11) Pelkonen, O.; Turpeinen, M.; Hakkola, J.; Honkakoski, P.; Hukkanen, J.; Raunio, H. Inhibition and induction of human cytochrome P450 enzymes: current stat. United Statesrch. Toxicol. 2008, 82, 667−715. (12) Williams, J. A.; Hyland, R.; Jones, B. C.; Smith, D. A.; Hurst, S.; Goosen, T. C.; Peterkin, V.; Koup, J. R.; Ball, S. E. Drug-drug interactions for UDP-glucuronosyltransferase substrates: a pharmacokinetic explanation for typically observed low exposure (AUCi/AUC) ratios. Drug Metab. Dispos. 2004, 32, 1201−1208. (13) Frye, R. F.; Zgheib, N. K.; Matzke, G. R.; Chaves-Gnecco, D.; Rabinovitz, M.; Shaikh, O. S.; Branch, R. A. Liver disease selectively modulates cytochrome P450-mediated metabolism. Clin. Pharmacol. Ther. 2006, 80, 235−245. (14) Yang, L. Q.; Li, S. J.; Cao, Y. F.; Man, X. B.; Yu, W. F.; Wang, H. Y.; Wu, M. C. Different alterations of cytochrome P450 3A4 isoform and its gene expression in livers of patients with chronic liver diseases. World J. Gastroenterol. 2003, 9, 359−363. (15) Buechler, C.; Weiss, T. S. Does hepatic steatosis affect drug metabolizing enzymes in the liver? Curr. Drug Metab. 2011, 12, 24−34. (16) Lickteig, A. J.; Fisher, C. D.; Augustine, L. M.; Aleksunes, L. M.; Besselsen, D. G.; Slitt, A. L.; Manautou, J. E.; Cherrington, N. J. Efflux transporter expression and acetaminophen metabolite excretion are altered in rodent models of nonalcoholic fatty liver disease. Drug Metab. Dispos. 2007, 35, 1970−1978. (17) Pekthong, D.; Desbans, C.; Martin, H.; Richert, L. Bupropion hydroxylation as a selective marker of rat CYP2B1 catalytic activity. Drug Metab. Dispos. 2012, 40, 32−38. (18) Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, 45e. (19) Yoon, I. S.; Choi, M. K.; Kim, J. S.; Shim, C. K.; Chung, S. J.; Kim, D. D. Pharmacokinetics and first-pass elimination of metoprolol in rats: contribution of intestinal first-pass extraction to low bioavailability of metoprolol. Xenobiotica 2011, 41, 243−251. (20) Yoon, I.; Han, S.; Choi, Y. H.; Kang, H. E.; Cho, H. J.; Kim, J. S.; Shim, C. K.; Chung, S. J.; Chong, S.; Kim, D. D. Saturable sinusoidal uptake is rate-determining process in hepatic elimination of docetaxel in rats. Xenobiotica 2012, 42, 1110−1119. (21) Duggleby, R. G. Analysis of enzyme progress curves by nonlinear regression. Methods Enzymol. 1995, 249, 61−90.

plausible that BUP may be a drug with an intermediate to high HER in rats. Thus, the CLNR of BUP may depend on the protein binding, hepatic intrinsic clearance (CLint), and hepatic blood flow rate. In comparison with control rats, the CLNR and CL values were significantly reduced in both MCD diet-fed and HF dietfed rats (Table 3). It was previously reported that hepatic blood flow rate is reduced in obese Zucker rats with hepatic steatosis and hypertriglyceridemia.45 Thus, the reduced CL and CLNR in HF diet-fed rats could be attributed partly to a decrease in hepatic blood flow rate. Moreover, the reduced levels of activity and expression of hepatic CYP2B1 in MCD diet-fed rats could be responsible for the reduction in CL and CLNR in MCD dietfed rats. However, further investigation into hepatic blood flow and protein binding is required to clarify the mechanisms of the changes in BUP pharmacokinetics in HF diet-fed and MCD diet-fed rats. In comparison with HF diet-fed and control rats, the AUCHBUP/AUCBUP value was considerably reduced in MCD diet-fed rats (Table 3), suggesting that the in vivo hepatic CYP2B1-mediated metabolism of BUP may be reduced in MCD diet-fed rats, which coincides well with the decreased expression and activity of hepatic CYP2B1 in MCD diet-fed rats (Figures 3 and 4 and Table 2). Taken together, the current BUP pharmacokinetic study provides a good basis for designing dosing regimens and formulations of drug substrates for the CYP2B subfamily in NAFLD patients. In conclusion, we investigated herein the influences of NAFLD on the activity and expression of rat hepatic CYP2B1. The rat models of SFL and NASH were successfully established by 8-week HF and MCD diets, respectively. The induction of these disease states was confirmed by plasma chemistry and liver histological analysis. The mRNA and protein expression of hepatic CYP2B1 were considerably reduced in MCD diet-fed rats but were similar between the HF diet-fed and control rats. The results obtained from in vitro hepatic microsomal metabolism and in vivo rat pharmacokinetic studies for BUP suggest that the activity of hepatic CYP2B1 was considerably reduced in MCD diet-fed rats but was similar between the HF diet-fed and control rats. These results promote a better understanding of the influence of NAFLD on CYP2B1mediated metabolism, which may have implications for the pharmacokinetics and safety of drug substrates for the CYP2B subfamily in patients with NAFLD.

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected], Tel.: +82 61 450 2688, Fax: +82 61 450 2689. *E-mail: [email protected], Tel.: +82 2 880 7870, Fax: +82 2 873 9177. Funding

This work was supported by the National Research Foundation of Korea (NRF) (Grant 2009-0083533) and the Basic Research Project (Grant 16-3220) of the Korea Institute of Geoscience and Mineral Resources (KIGAM) funded by the Ministry of Science, ICT, and Future Planning of Korea. Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Gomez-Lechon, M. J.; Jover, R.; Donato, M. T. Cytochrome p450 and steatosis. Curr. Drug Metab. 2009, 10, 692−699. 5605

DOI: 10.1021/acs.jafc.6b01663 J. Agric. Food Chem. 2016, 64, 5598−5606

Article

Journal of Agricultural and Food Chemistry

LC-MS and its application to pharmacokinetics. Pharmazie 2011, 66, 924−928. (41) Suckow, R. F.; Smith, T. M.; Perumal, A. S.; Cooper, T. B. Pharmacokinetics of bupropion and metabolites in plasma and brain of rats, mice, and guinea pigs. Drug Metab. Dispos. 1986, 14, 692−697. (42) Kaka, J. S.; Al-Khamis, K. I.; Tanira, M. O. Effect of hepatic and renal dysfunction on disposition of bupropion in rats. Eur. J. Drug Metab. Pharmacokinet. 1988, 13, 149−153. (43) Preskorn, S. H.; Othmer, S. C. Evaluation of bupropion hydrochloride: the first of a new class of atypical antidepressants. Pharmacotherapy 1984, 4, 20−34. (44) Watanabe, T.; Kusuhara, H.; Maeda, K.; Kanamaru, H.; Saito, Y.; Hu, Z.; Sugiyama, Y. Investigation of the rate-determining process in the hepatic elimination of HMG-CoA reductase inhibitors in rats and humans. Drug Metab. Dispos. 2010, 38, 215−222. (45) Sun, C. K.; Zhang, X. Y.; Wheatley, A. M. Increased NAD(P)H fluorescence with decreased blood flow in the steatotic liver of the obese Zucker rat. Microvasc. Res. 2003, 66, 15−21.

(22) Chiou, W. L. Critical evaluation of the potential error in pharmacokinetic studies of using the linear trapezoidal rule method for the calculation of the area under the plasma level-time curve. J. Pharmacokinet. Biopharm. 1978, 6, 539−546. (23) Faul, F.; Erdfelder, E.; Buchner, A.; Lang, A. G. Statistical power analyses using G*Power 3.1: tests for correlation and regression analyses. Behav Res. Methods 2009, 41, 1149−1160. (24) Schattenberg, J. M.; Galle, P. R. Animal models of non-alcoholic steatohepatitis: of mice and man. Dig. Dis. 2010, 28, 247−254. (25) Hotamisligil, G. S. Inflammation and metabolic disorders. Nature 2006, 444, 860−867. (26) Gao, D.; Wei, C.; Chen, L.; Huang, J.; Yang, S.; Diehl, A. M. Oxidative DNA damage and DNA repair enzyme expression are inversely related in murine models of fatty liver disease. Am. J. Physiol. Gastrointest. Liver Physiol. 2004, 287, G1070−1077. (27) Rinella, M. E.; Elias, M. S.; Smolak, R. R.; Fu, T.; Borensztajn, J.; Green, R. M. Mechanisms of hepatic steatosis in mice fed a lipogenic methionine choline-deficient diet. J. Lipid Res. 2008, 49, 1068−1076. (28) George, J.; Pera, N.; Phung, N.; Leclercq, I.; Yun Hou, J.; Farrell, G. Lipid peroxidation, stellate cell activation and hepatic fibrogenesis in a rat model of chronic steatohepatitis. J. Hepatol. 2003, 39, 756− 764. (29) Fisher, C. D.; Lickteig, A. J.; Augustine, L. M.; Oude Elferink, R. P.; Besselsen, D. G.; Erickson, R. P.; Cherrington, N. J. Experimental non-alcoholic fatty liver disease results in decreased hepatic uptake transporter expression and function in rats. Eur. J. Pharmacol. 2009, 613, 119−127. (30) Finn, R. D.; Henderson, C. J.; Scott, C. L.; Wolf, C. R. Unsaturated fatty acid regulation of cytochrome P450 expression via a CAR-dependent pathway. Biochem. J. 2009, 417, 43−54. (31) Kakizaki, S.; Yamazaki, Y.; Takizawa, D.; Negishi, M. New insights on the xenobiotic-sensing nuclear receptors in liver diseases– CAR and PXR. Curr. Drug Metab. 2008, 9, 614−621. (32) Pak, W.; Takayama, F.; Mine, M.; Nakamoto, K.; Kodo, Y.; Mankura, M.; Egashira, T.; Kawasaki, H.; Mori, A. Anti-oxidative and anti-inflammatory effects of spirulina on rat model of non-alcoholic steatohepatitis. J. Clin. Biochem. Nutr. 2012, 51, 227−234. (33) Li, C. C.; Lii, C. K.; Liu, K. L.; Yang, J. J.; Chen, H. W. n-6 and n-3 polyunsaturated fatty acids down-regulate cytochrome P-450 2B1 gene expression induced by phenobarbital in primary rat hepatocytes. J. Nutr. Biochem. 2006, 17, 707−715. (34) Donato, M. T.; Lahoz, A.; Jimenez, N.; Perez, G.; Serralta, A.; Mir, J.; Castell, J. V.; Gomez-Lechon, M. J. Potential impact of steatosis on cytochrome P450 enzymes of human hepatocytes isolated from fatty liver grafts. Drug Metab. Dispos. 2006, 34, 1556−1562. (35) Li, C. C.; Lii, C. K.; Liu, K. L.; Yang, J. J.; Chen, H. W. DHA down-regulates phenobarbital-induced cytochrome P450 2B1 gene expression in rat primary hepatocytes by attenuating CAR translocation. Toxicol. Appl. Pharmacol. 2007, 225, 329−336. (36) Aitken, A. E.; Richardson, T. A.; Morgan, E. T. Regulation of drug-metabolizing enzymes and transporters in inflammation. Annu. Rev. Pharmacol. Toxicol. 2006, 46, 123−149. (37) Soucek, P.; Gut, I. Cytochromes P-450 in rats: structures, functions, properties and relevant human forms. Xenobiotica 1992, 22, 83−103. (38) Stepanova, M.; Hossain, N.; Afendy, A.; Perry, K.; Goodman, Z. D.; Baranova, A.; Younossi, Z. Hepatic gene expression of Caucasian and African-American patients with obesity-related non-alcoholic fatty liver disease. Obes. Surg. 2010, 20, 640−650. (39) Yoneda, M.; Endo, H.; Mawatari, H.; Nozaki, Y.; Fujita, K.; Akiyama, T.; Higurashi, T.; Uchiyama, T.; Yoneda, K.; Takahashi, H.; Kirikoshi, H.; Inamori, M.; Abe, Y.; Kubota, K.; Saito, S.; Kobayashi, N.; Yamaguchi, N.; Maeyama, S.; Yamamoto, S.; Tsutsumi, S.; Aburatani, H.; Wada, K.; Hotta, K.; Nakajima, A. Gene expression profiling of non-alcoholic steatohepatitis using gene set enrichment analysis. Hepatol. Res. 2008, 38, 1204−1212. (40) Hu, L.; Wang, Z.; Xu, R.; Ma, J.; Wang, X.; Zhang, X. Determination of bupropion and its main metabolite in rat plasma by 5606

DOI: 10.1021/acs.jafc.6b01663 J. Agric. Food Chem. 2016, 64, 5598−5606