Effects of Resistant Starch and Arabinoxylan on Parameters

Article pubs.acs.org/JAFC

Effects of Resistant Starch and Arabinoxylan on Parameters Related to Large Intestinal and Metabolic Health in Pigs Fed Fat-Rich Diets Tina Skau Nielsen,* Peter Kappel Theil, Stig Purup, Natalja P. Nørskov, and Knud Erik Bach Knudsen Department of Animal Science, Aarhus University, Tjele, Denmark ABSTRACT: This study compared the effects of a resistant starch (RS)-rich, arabinoxylan (AX)-rich, or low-DF Western-style control diet (all high-fat) on large intestinal gene expression, adiposity, and glycemic response parameters in pigs. Animals were slaughtered after 3 weeks of treatment. Plasma butyrate concentration was higher following the high-DF diets, whereas plasma glucose, insulin, and insulin resistance increased after 3 weeks irrespective of diet. The mRNA abundance in the large intestine of genes involved in nutrient transport, immune response, and intestinal permeability was affected by segment (cecum, proximal, mid or distal colon) and some genes also by diet. In contrast, there was no diet-induced effect on adipose mRNA abundance or adipocyte size. Overall, a high level of RS or AX did not demonstrate strong beneficial effects on large intestinal gene expression as indicators of colonic health or glycemic response parameters when included in a high-fat diet for pigs as a model of healthy humans. KEYWORDS: blood metabolites, colon, dietary fiber, insulin, short-chain fatty acids, transcription

■

INTRODUCTION Maintaining colonic and metabolic health is a challenge in affluent Westernized societies where diets are typically high in refined carbohydrates and fats and low in nondigestible carbohydrates (dietary fiber, DF) in combination with a physically inactive lifestyle. Epidemiological and clinical studies have demonstrated that intake of DF and whole grain is inversely related to obesity,1 type 1 and 2 diabetes,2 and intestinal cancers.3,4 Butyrate, one of the short-chain fatty acids (SCFA) produced in the large intestine by microbial fermentation of DF, can modulate the intestinal barrier function and immunity,5,6 and insufficient intestinal butyrate production due to low levels of DF available for microbial fermentation may consequently play a role in the pathogenesis of inflammatory bowel conditions such as distal ulcerative colitis.7 DF includes a broad range of constituents,8 and research effort is put into elucidating health effects and underlying mechanisms of individual subtypes of DF. Arabinoxylan (AX) is the main DF in common food cereals, rye and wheat, where they represent 50−55% of total DF.9,10 Diets high in AX have been associated with increased intestinal expression of gut barrier function and anti-inflammatory genes in diet-induced obese mice11 and in genes involved in differentiation, fatty acid metabolism, and inflammation in adipose tissue.12 Wheat AX also showed protective effects against dietary protein-induced colonocyte DNA damage in pigs.13 High AX diets may furthermore improve glycemic control in healthy14 and type II diabetic15 human subjects and in people with impaired glucose tolerance16 as well as in diabetic rats,17 and AX has demonstrated obesity-preventing effects in diet-induced obese mice.11,12 Resistant starch (RS) is a type of DF that includes all starches and starch degradation products that are not absorbed in the small intestine of healthy humans, and its fermentation generally favors butyrate production in the large intestine.18,19 © XXXX American Chemical Society

Many studies report positive effects of diets enriched in RS on metabolic health,20 mainly the RS type 2 (RS2), which is RS that occurs in its natural granular form such as in raw potato starch and high-amylose maize (HAM-RS2).21 Resistant starch has been shown to modulate the expression of genes related to SCFA transport, metabolism, immune response pathways, and genomic integrity in the intestines of pigs and rats22−24 and to ameliorate disease activity in mice with inflammatory bowel disease.25 In human studies it has been found that RS decreases postprandial blood glucose and insulin levels,20 but results from pig studies are conflicting.26,27 Resistant starch type 2 also improved insulin resistance (IR) and reduced adipose tissue weight in fat rats.28 The mechanisms behind the effects of DF on colonic and metabolic health are not completely established, but enhanced production of SCFA, especially butyrate, may provide one of the important links between DF consumption and health benefits.6,29−32 In studies with intact33 and catheterized pigs,27 we have shown that including high levels of AX or RS in the diet increased large intestinal SCFA (butyrate) pool size (i.e., increased production) and SCFA absorption to portal blood compared to a low-DF Western-style diet, AX more efficiently than RS. In the present study, the aim was to study the effects of the altered SCFA production induced by RS or AX from mixed DF sources on colonic health (intestinal gene expression) and metabolic health (plasma metabolites, glycemic response, and adipocyte cell size) in an intact pig model of healthy humans. All traits within colonic health and within metabolic health were subsequently studied using multivariate data analysis. The diets were all high in particularly satuated fats, whereas the effect of dietary protein was not in focus in Received: July 9, 2015 Revised: November 13, 2015 Accepted: November 13, 2015

A

DOI: 10.1021/acs.jafc.5b03372 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry this study. We hypothesized that the high-DF diets would beneficially affect the expression of genes in the large intestinal mucosa, glycemic control as well as gene expression and size of adipocytes in the pigs. We used a pig model as it is considered a suitable model for human metabolism in food research34 and the anatomy and physiology of the gastrointestinal tract in pigs are regarded comparable to those of humans.35

■

Table 1. Ingredients and Chemical Compositions of the Western-Style Diet (WSD), the Resistant Starch Diet (RSD), and the Arabinoxylan Diet (AXD) diet WSD

RSD

Ingredients (g/kg, As-Fed Basis) standard white wheat flour 568 455 rye flakes enzyme-treated wheat bran raw potato starch 56 HI-MAIZE260a 168 lard 96 89 soybean oil 32 30 sugar 100 Lacprodan 87 (83% whey protein)b 131 129 Vitacel WF600 (73% cellulose)c 40 40 vitamin−mineral mixtured 30 30 chromic oxide 3 3 Chemical Composition (g/kg DM) DM (g/kg, as-fed basis) 915 903 protein (N × 6.25) 207 191 fat 152 150 ash 37 34 digestible carbohydrates available sugars 113 3 fructose 0.1 0 glucose 0.1 0 sucrose 112 3.1 starch 422 470 nondigestible carbohydrates total NSP (soluble NSP) 58 (11) 55 (8) cellulose 29 34 AX (soluble AX) 18 (6) 15 (4) RSe 6 113f fructans 0 3 AXOS 2 2 Klason lignin 6 13 total nondigestible CHOg 64 173 total dietary fiberh 72 186 gross energy (MJ/kg DM) 19.7 20.3 metabolizable energy (MJ/kg DM)i 18.3 17.7

MATERIALS AND METHODS

Experimental Diets. The three dietary treatments were a Western-style diet (WSD), an arabinoxylan diet (AXD), and a resistant starch diet (RSD). The WSD was designed to mimic the diet of many people in affluent societies characterized by being high in sugar, refined grains, and saturated fat and low in DF (6%). The AXD and RSD were formulated to contain high DF (17%) mainly in the form of AX derived from rye flakes and enzyme-treated wheat bran or RS from high-amylose maize (HAM-RS2) and raw potato starch. The three diets provided the same amount of energy from fat (30%) and protein (17%), whereas the proportion of energy originating from DF was 3.5% in the WSD and 9% in the RSD and AXD (see Table 1 for ingredients and chemical composition). Commercially available rye flakes were provided by Lantmännen Cerealia (Vejle, Denmark), raw potato starch was from KMC (Brande, Denmark), and HAM-RS2 (HI-MAIZE260) was purchased from Ingredion Inc. (Bridgewater, NJ, USA). The production of enzymatically treated wheat bran to be incorporated in the AXD was described in detail in Nielsen et al.33 The AXD containing whole rye flakes was ground through a hammer mill fitted with a 3.5 mm screen to ensure comparable particle sizes across diets, and all diets were finely ground. Samples of the diets were collected after production at Aarhus University’s own feed production unit and stored at −20 °C until analyzed. Details concerning the chemical composition of the experimental diets and influence on SCFA pool size and absorption can be found in the papers of Nielsen et al.33 and Ingerslev et al.27 Chemical Analysis. All chemical analyses on diets were performed in duplicate on freeze-dried material. The dry matter (DM) content was determined by drying the samples at 103 °C to constant weight, and ash was analyzed according to the AOAC method.36 Nitrogen was measured by DUMAS37 and protein calculated as N × 6.25. Gross energy was analyzed on a 6300 automatic isoperibol calorimeter system (Parr Instruments). Fat was determined using the Stoldt procedure.38 Dietary contents of sugars (glucose, fructose, and sucrose) and fructans were analyzed as described by Larsson and Bengtsson.39 Starch and NSP was analyzed essentially as described by Bach Knudsen,40 except that acid hydrolysis was performed in 2 M H2SO4 for 1 h instead of 1 M H2SO4 for 2 h. Arabinoxylan was calculated as the sum of the arabinose and xylose residues of the NSP procedure mentioned above. Arabinoxylan oligosaccharides (AXOS) were calculated from the arabinose and xylose residues not precipitating in 80% ethanol when the samples were analyzed by direct acid-hydrolysis of the NSP fraction without prior starch removal and alcohol precipitation and subtracting the values for arabinoxylan after starch removal and alcohol precipitation.41 Klason lignin was measured as the sulfuric acid-insoluble residue as described by Theander and Åman.42 Resistant starch was analyzed with a commercially available kit (Megazyme International Ireland, Wicklow, Ireland). Chromic oxide was determined colorimetrically using a Lambda 900 spectrophotometer (PerkinElmer GmbH, Bodenseewerk, Germany) after oxidation to chromate with sodium peroxide following the procedure of Schürch et al.43 Animals and Housing. The care and housing of animals used in this study were in compliance with Danish laws and regulations for the humane care and use of animals in research (The Danish Ministry of Justice, Animal Testing Act, Consolidation Act no. 1306 of November 23, 2007) and performed under the license obtained from the Danish Animal Experimentation Inspectorate, Ministry of Food, Agriculture and Fisheries. The health of the animals was monitored, and no serious illness was observed.

AXD

655 80

80 27 85 40 30 3 891 154 135 51 22 1.8 3.1 17.5 420 144 (33) 37 72 (22) 8 22 7 15 181 196 19.3 17.1

a Registrated trademark of Ingredion Inc., Bridgewater, NJ, USA. bArla Foods Ingredients amba, Viby J, Denmark. cJ. Rettenmaier and Söhne GmbH, Rosenberg, Germany. dSupplying per kg of diet: 18.9 mg of retinol (vitamin A), 0.15 mg of cholecalciferol (vitamin D3), 1038 mg of α-tocopherol (vitamin E), 31.5 mg of vitamin K, 31.5 mg of vitamin B1, 31.5 mg of vitamin B2, 157.5 mg of D-pantothenic acid (vitamin B5), 315 mg of niacin (vitamin B3), 0.79 mg of biotin (vitamin B7), 0.315 mg of vitamin B12, 47.3 mg of vitamin B6, 1260 mg of Fe, 225 mg of Csu, and 630 mg of Mn (VA Vit SL/US Anti, Vilomix, Mørke, Denmark). eResistant starch (RS) determined by the Megazyme assay (Megazyme International, Wicklow, Ireland). f76% of the total RS originated from HAMS-R2 and 24% from raw potato starch calculated using data on RS content from the ingredient suppliers. gCalculated as total nonstarch polysaccharide (NSP) + fructans + RS. hCalculated as total NSP + fructans + RS + lignin + arabinoxylan oligosaccharides (AXOS). iCalculated by the FAO method available at http://www.fao. org/uploads/media/FAO_2003_Food_Energy_02.pdf.

Thirty female pigs (BW 63.1 ± 4.4 kg) were fed one of three diets (WSD, AXD, or RSD) for an experimental period of 3 weeks. The experiment was conducted in two blocks with five animals per treatment in each block. Pigs were housed individually in pens (1.5 × 2.4 m) without manipulative material (straw) with access to water ad B


Article

Journal of Agricultural and Food Chemistry Table 2. Oligonucleotide Sequences of Forward Primer, Probe (If Used), and Reverse Primer for the Studied Genes

a

assay ID, TaqMan, Life Technologies

gene symbol

method

MCT1/SLC16A1

SYBR Green

5′-accacttttaggtcgtctcaatgac

forward primer

MCP1/CCL2 GPR41 GPR43 β-actin

SYBR Green SYBR Green SYBR Green TaqMan

5′-ggctgatgagctacagaagagtca 5′-cgcgtgctggagtaaaacg 5′-atcagcatcgagcgttacct 5′-acccagatcatgttcgagacctt

GAPDH LPL AMPK SREBP1a SREBP2 TNFα NFκB

TaqMan SYBR Green TaqMan SYBR Green SYBR Green TaqMan TaqMan

5′-gtcggagtgaacggatttgg 5′-cccagcagcattatccaatatct

PPAR-γ MUC2 ZO1 OCLN

SYBR Green TaqMan TaqMan

probe, FAM/MGB

5′ctgtatgcctctggccgcacca 5′-cgcctggtcaccagggctgct

reverse primer 5′tggagattctgctacatcagtaacttc 5′-cgcgatggtcttgaagatcac 5′-accctgcacactgctctcaa 5′-caaagcgcgagtagcagaaga 5′-tcaccggagtccatcacgat 5′-caatgtccactttgccagagttaa 5′-ccgccatccagtcgataaac

Ss03375939_u1 5′-cggacggctcacaatgc 5′-gatgcaaaggtcaaagacga 5′-aaccctctggcccaagga 5′ctagtgaaccgaaaccttttctctactat 5′-ggactaccaaagtgccatcaaagt 5′-accccaagcccttctacgag

5′-tcagatcatcgtctcaaac 5′-ctgaaatcaaagataaagagg

5′-gacggcggatttattcagctt 5′-aaggtgaggacacacagcag 5′-ggcgacgggcttatctga 5′-gcttctgccgtttcctttgt 5′-tgaggtttgttgtacagctgagtct 5′-gagtggatgccgttgatggt

Ss03373514_m1 Ss03377507_u1

Design does not distinguish between SREBP1A and SREBP1C. RNAlater at 5 °C for 24 h before storage at −80 °C until further analysis. Subcutaneous adipose tissue was obtained between the second and third right teats, and 100 mg was placed in fluid nitrogen before storage at −80 °C until analysis. Adipose tissue (400−600 mg) was temporarily placed in phosphate-buffered saline (PBS) without Ca and Mg for a maximum of 3 h before further processing to determine adipocyte cell size. Quantitative Reverse Transcription PCR. Total RNA was extracted from fat tissue using TRIzol (Tri reagent, LifeTechnologies, Taastrup, Denmark), according to the manufacturer’s instructions and from intestinal mucosa using the NucleoSpin II kit (Macherey-Nagel GmbH & Co. KG., Düren, Germany) as described by Duran-Montgé et al.46 RNA purity and concentration were examined by measuring absorbance at 260−280 nm (NanoDrop ND-8000 UV−vis spectrophotometer, NanoDrop Technologies, Wilmington, DE, USA). Purified RNA was reverse-transcribed with oligo-dT and random primers and Superscript III RNase H reverse transcriptase kit (Invitrogen, Taastrup, Denmark) according to the manufacturer’s protocol. The absence of amplification of genomic DNA was tested using porcine DNA for the quantitative reverse transcription PCR analyses. Reverse-transcribed material was amplified and quantified with TaqMan Universal PCR Master Mix or Power SYBR Green PCR Master Mix (Applied Biosystems, Stockholm, Sweden) depending on the analyzed gene on an ViiA7 (LifeTechnologies) using 384-well plates with a 10 μL reaction volume. Intestinal mucosa and adipose tissue were analyzed for expression of 13 and 7 selected gene transcripts, respectively, using pig-specific primers and either genespecific probes or SYBR Green (Table 2). Two housekeeping genes were found suitable as endogenous control, β-actin and glyceraldehyde 3-phosphate dehydrogenase (GADPH). The raw gene expression data were obtained as Ct values (cycle number at which logarithmic plots cross a calculated threshold) according to the manufacturer’s guidelines and used to determine ΔCt values (ΔCt = Ct of the target gene − mean Ct of the housekeeping genes), which were used for the statistical analyses. Then, ΔΔCt (=ΔCt for, e.g., distal colon − ΔCt for cecum) was calculated and the relative gene expression was derived using the (1 + efficiencies)−ΔΔCT method, and the fold change (FC) was reported. Determination of Fat Cell Size. The method was modified from those of Bambace et al.47 and Tchoukalova et al.48 Tissue was digested in 1 mg/mL collagenase type XI (Sigma-Aldrich, C-9407) in HEPES buffer [0.1 M HEPES, 0.12 M NaCl, 0.05 M KCl, 0.005 M glucose,

libitum and allowed to adapt to the pen for 5 days prior to the experimental period. Daily feed allowance for animals on the RSD and AXD diets was 2.7% of average BW (75 kg), whereas animals on the WSD treatment were fed 2.44% of BW to ensure similar daily amounts of net energy among the three dietary treatments. Pigs were fed manually three times daily, 10 a.m. and 3 and 8 p.m. (33.3% of total ration at each meal), to mimic the human meal pattern. Very few feed leftovers were observed, but if any, feed leftovers were registered before the morning feeding and weighed to correct feed intake. The amount of feed supplied to pigs at the last meal 1.5 h before slaughter was adjusted slightly to provide equal amounts (300 g) of digestible carbohydrates regardless of diet in order to obtain as much consistency with the study design by Ingerslev et al.27 using the same diets in a catheterized pig model. Fasting venous jugular blood was obtained 4 days prior to the experimental start (week 0) and after 1 and 3 weeks and stored at −20 °C until analyzed. Body weight was recorded weekly. Further details concerning animal feeding and housing can be found in the paper of Nielsen et al.33 Plasma Analysis. Glucose, L-lactate, NEFA, fructosamine, and triglycerides were analyzed using an autoanalyzer (Advia 1650 Chemistry System, Siemens Medical Solution). Plasma glucose (PG), L-lactate, and triglycerides were analyzed by standard procedures (Siemens Diagnostics, Clinical Methods for Advia 1650), NEFA was determined using NEFA C ACS-ACOD assay (Wako Chemicals GmbH), and fructosamine was determined by a colorimetric assay (reduction of nitrotetrazolium-blue; Roche Diagnostics GmbH) adapted to the ADVIA analytical system. Plasma insulin was determined by time-resolved fluoro-immunometric assay as described by Lovendahl and Purup.44 Plasma SCFA was measured by GC as described by Brighenti45 with the modification that 2-ethyl butyrate (Fluka no. 03190; SigmaAldrich) was used as an internal standard instead of isovalerate. The intestinal microflora does not produce 2-ethyl butyrate, and it is therefore not present in biological samples. Sample Collection at Slaughter. Pigs were stunned using a captive bolt pistol and subsequently bled from the jugular vein. The abdominal cavity was opened, and the gastrointestinal tract was ligated at the esophagus and rectum, removed from the carcass, and emptied. The large intestine was identified and isolated. The positions at 25, 50, and 75% of the length of the colon (proximal to distal) were termed Co1, Co2, and Co3, respectively. Scraps of the intestinal mucosa were obtained with a glass cover slide from the clean midsection of the cecum (Ce), Co1, Co2, and Co3. Mucosal scraps were placed in C


Article

Journal of Agricultural and Food Chemistry

Figure 1. Relative mRNA abundance in mucosal scrapings of the cecum and proximal (Co1), mid (Co2), and distal colon (Co3) of pigs fed the WSD, RSD, or AXD (n = 10/group): (A) MCT1; (B) GPR41; (C) GPR43; (D) MCP1; (E) TNFα; (F) NFκβ; (G) PPARγ; (H) MUC2; (I) ZO1; (J) OCLN. Data are presented as the means ± 95% confidence intervals relative to the abundance in the cecum of WSD-fed pigs (=1.00). Note that the scale on the Y-axis is logarithmic and that the units are arbitrary. (NS) p > 0.05; (∗) p ≤ 0.05; (∗∗) p < 0.01; (∗∗∗) p < 0.001. Statistically significant (p ≤ 0.05) effects of diet within segment are indicated with different letters (a, b, c). 1.5% w/v BSA, 100 mg/L CaCl2 (pH 7.4)] in 6-well plates placed in a 37 °C rotating incubator for 45 min and mixed with a pipet twice during this period. The cell suspension thus formed was centrifuged for 5 min at 400g at room temperature. A 100 μL aliquot from the top layer was added to 400 μL of 0.2% methylene blue/HEPES solution for nucleic staining and incubated for 15 min at 37 °C. Fifteen microliters of the suspension was placed at two separate sites on a glass slide and coverslipped, and three to five representative pictures (Leica DFC 320, Meyer Instruments, Inc.) of the cells from each animal were captured. The digital images of cells were analyzed using the line tool

of the Leica IM50 Image Manager (Meyer Instruments, Inc.), and the diameters of 300 adipocytes per animal were measured. Cells were categorized in three size groups: ≤10, 11−50, and >51 μm. Calculations. A Homeostasis Model Assessment of steady state βcell function (%) (HOMA-β) and insulin resistance (HOMA-IR) developed for humans was calculated using the following equations; HOMA-β = [(20 × PI (μU/mL))/(PG (mmol/L) − 3.5)] and (HOMA-IR) = [(PG (mmol/L) × PI (μU/mL))/22.5].49 The daily intake of metabolizable energy (ME) was calculated on the basis of the analyzed composition of the diets and measured D


Article


Figure 2. PCA score plot (A) and corresponding loading plot (B) of the mRNA abundance of genes MCT1, GPR41, GPR43, MCP1, TNFα, NFκβ, PPARγ, MUC2, ZO1, and OCLN in the cecum (Cae), proximal colon (Co1), mid colon (Co2), and distal colon (Co3). Multivariate data analysis was performed in LatentiX. nutrient digestibilities using chromic oxide as marker33 and by assuming that 4% of energy was lost in gases and urine,50 corresponding to 96% metabolizability of digested energy. Statistical Analysis. The first type of statistical analysis applied was performed in the Mixed procedure of SAS (SAS institute, Inc., Cary, NC, USA) followed by adjustment for multiple comparisons by the Tukey−Kramer post hoc test. The effects of diet and week on plasma metabolites and the effects of diet and intestinal segment on gene expression were analyzed using the following normal Mixed model:

and residuals were assumed to be normally distributed and independent, and their expectations were assumed to be zero. Data on gene expression in fat tissue were analyzed by the same statistical model as the other end points and under the same assumptions, except that β(j), αβ(ij), and ν(ijkl) were omitted. Data on adipocyte size was analyzed by a simple ANOVA based on the model

X(ij) = μ + α(i) + β(j) + αβ(ij) + ν(k) + ε(ijk) where α(i) is the diet (i = WSD, RSD, or AXD); β(j) is the effect of size group (j = 1, 2 or 3); αβ(ij) is the interaction between diet and size group, ν(k) is the random effect of block (k = 1 or 2), and ε(ijk) denotes the residual error under the same assumptions as in the first statistical model. Multivariate data analysis was used to give an overview and easy visualization of any clustering in the data. The first model included data on expression of the 10 genes in the four large intestinal segment (Ce, Co1, Co2, and Co3). The second model included data on digesta concentration and pool size of SCFAs in the large intestinal segments (see Nielsen et al.33 for SCFA measurements and pool size calculations), blood metabolites during week 3, HOMA-β and HOMA-IR, and gene expression data from the large intestinal

X(ijkl) = μ + α(i) + β(j) + αβ(ij) + κ(k) + ν(ijkl) + ε(ijkl) α(i) is the diet (i = WSD, RSD, or AXD); β(j) is the week (j = 0, 1, 2, 3) or intestinal segment (j = Ce, Co1, Co2 or Co3); αβ (ij) is the interaction between diet and week or diet and intestinal segment; and κ(k) is the random effect of block (k = 1 or 2); ν(ijkl) is the random component related to the pig (l = 1, 2, ..., 30). Pig was included as a random component to account for repeated measurements within pigs. The covariance structure for repeated measures across gut segment or weeks was modeled using variance component option, and the residual error component is defined as ε(ijkl). Levels of significance were reported as being significant when p ≤ 0.05. The random effects E


Article


Figure 3. Total short-chain fatty acids (total SCFA) (A), acetate (B), propionate (C), butyrate (D), branched-chain fatty acids (BCFA) (E), triglycerides (F), and nonesterified fatty acids (NEFA) (G) in fasting venous blood from pigs fed the WSD, RSD, or AXD (n = 10/group). Blood sampled week 0 was obtained before the dietary treatment was initiated. Data are presented as LS means ± SEM (or 95% confidence intervals for total SCFA, butyrate, and NEFA due to logarithmic transformation of data). Effects of diet, week, and the interaction between diet and week are indicated for each parameter. (∗∗∗) p < 0.001; (∗∗) p < 0.01; (∗) p ≤ 0.05; (NS) p > 0.05. Different letters (a, b) indicate statistically significantly difference between diets in a given week.

nutrients, please see Nielsen et al.33 The calculated daily intakes of ME were 31.2 ± 0.04, 32.2 ± 0.4, and 30.9 ± 0.03 MJ for pigs fed the WSD, RSD, and AXD, respectively. Expression of Genes Related to Butyrate Transport and Fatty Acid Response in the Large Intestine. The relative mRNA abundances of monocarboxylate transporter isoform 1 (MCT1; butyrate transport) and G-protein coupled receptors 41 and 43 (GPR41, GPR43; SCFA response) in mucosa from the cecum and proximal, mid, and distal colon (Co1, Co2, and Co3, respectively) are shown in Figure 1A−C. The mRNA abundance is expressed relative to that found in the cecum of WSD-fed pigs (=1.00). The MCT1 abundance was unaffected by diet (p = 0.08), but orthogonal contrast between

segments and adipose tissue. An unsupervised method for pattern recognition, principal component analysis (PCA), was applied. Multivariate modeling was performed in LatentiX version 2.1.51 The data were autoscaled prior to PCA.

■

RESULTS Diets and Intake of Nutrients. The three diets were formulated to provide equal amounts of fat, protein, and energy, whereas the RSD and AXD provided equal amounts but different types of DF. Table 1 shows the ingredients and chemical composition of the three diets as well as calculations of gross and metabolizable energy (ME) contents. For further details on the diets, intake of nutrients, and digestibility of F


Article


Figure 4. Fasting venous blood glucose (A), insulin (B), homeostasis model assessment of insulin resistance (HOMA-IR) (C), β-cell function (HOMA-β) (D), lactate (E), and fructosamin (F) in pigs fed the WSD, RSD or AXD. LS means ± SEM (or 95% confidence intervals for lactate due to logarithmic transformation of data), n = 10/group. Effects of diet, week, and the interaction between diet and week are indicated for each parameter. (∗∗∗) p < 0.001; (∗∗) p < 0.01; (∗) p ≤ 0.05; (NS) p > 0.05.

abundance was 1.8-fold higher in the cecum of AXD compared with RSD-fed pigs. In the distal colon, the AXD resulted in a 2.4-fold higher TNFα abundance compared with the WSD. The interaction between diet and intestinal segment (p = 0.01) on NFκB expression revealed a 1.9-fold lower NFκB abundance in the distal colon of WSD compared with AXD-fed pigs, the RSD being intermediate, whereas there were no diet-induced effects in the other intestinal segments. The abundance of PPARγ was gradually lowered from the cecum throughout the large intestine (p < 0.001) irrespective of diet. Expression of Genes Related to Large Intestinal Permeability. Mucin 2 (MUC2), zonula occludens 1 (ZO1), and occludin (OCLN) mRNA abundances are shown in Figure 1H−J. MUC2 abundance gradually increased from the cecum throughout the large intestine (p < 0.001) but only in the proximal and distal colon was there an effect of diet; the abundance was 2.2-fold lower (p = 0.03) in the proximal colon compared with the WSD (RSD intermediate), and in the distal colon the RSD resulted in a 2.1-fold higher abundance compared with the WSD (AXD intermediate). The ZO1 abundance was 1.5-fold higher (p = 0.01) in the mid colon compared with the cecum, with the proximal and distal colon being intermediate irrespective of diet. As for ZO1, intestinal segment but not diet influenced OCLN abundance; the OCLN

the two high-DF diets and the WSD showed a 1.2-fold higher (p = 0.03) MCT1 abundance for the high-DF diets compared with the WSD. The MCT1 abundance was 3.8-fold lower (p < 0.001) in the distal colon compared with the other large intestinal segments. The GPR41 abundance was 1.7-fold lower (p = 0.001) in AXD-fed pigs compared with the WSD and RSD treatments and 5.2-fold lower (p < 0.001) in the proximal, mid, and distal colon compared with the cecum irrespective of diet. There was an interaction between diet and intestinal segment (p = 0.006) for GPR43 abundance; a 2.7-fold lower abundance was observed in the cecum of AXD-fed compared with WSDfed pigs; the abundance was similar across diets in the proximal and mid colon and 3.5-fold lower for the WSD versus the RSD in the distal colon, the AXD being intermediate. Expression of Genes Related to Immunity in the Large Intestine. Monocyte chemoattractant protein 1 (MCP1), tumor necrosis factor-alpha (TNFα), nuclear transcription factor kappa-beta (NFκB), and peroxisome proliferator activated receptor gamma (PPARγ) mRNA abundances are shown in Figure 1D−G. For MCP1 expression, the WSD resulted in a substantially lower abundance (11-fold; p < 0.001) in the distal colon compared to the other two diets; all other combinations of diet and segment resulted in a similar abundance. Also for TNFα abundance there was an interaction between diet and intestinal segment (p = 0.005). The TNFα G


Article


Adipose mRNA Expression and Fat Cell Size. There were no diet-induced differences in the mRNA expression of MCT1 (butyrate transport), lipoprotein lipase (LPL), AMPactivated protein kinase (AMPK), or sterol regulatory elementbinding transcription factors 1 and 2 (SREBP1 and SREBP2) involved in nutrient metabolism in abdominal subcutaneous fat cells (data not shown). The mean fat cell sizes were 55.7, 57.9, and 47.1 μm for pigs fed the WSD, RSD, and AXD, respectively (p = 0.15). Diet did not (p = 0.65) influence the number of fat cells in each of the three size categories (50 μm, 12% of cells were 20−50 μm, and 31% of cells were 2-fold in the proximal colon compared with a control diet.55 The RSD and AXD compared with the WSD did not significantly down-regulate the expression of genes coding for mediators of inflammatory response (MCP1, TNFα) or the pro-inflammatory nuclear transcription factor NFκβ. Rather, MCP1 was lower following the WSD in the distal colon. In rats, colonic TNFα expression was found to be down-regulated following a diet containing 5% P. ovata seeds compared with control animals fed a low-DF diet,56 and a diet with 8% oligofructose-enriched inulin fed for 28 weeks down-regulated the expression of TNFα and NFκβ in the colon evaluated by immunohistochemistry.57 In both of these studies the fiberenriched diets were associated with a higher colonic in situ production56 and fecal concentration57 of total SCFA and butyrate. SCFAs and butyrate have been reported to bind and activate the nuclear transcription factor PPARγ,58 which antagonizes NFκβ signal transduction, and the net result is an anti-inflammatory effect in the gut. Expression of the PPARγ is implicated in the pathology of numerous diseases including inflammatory bowel disease in mice,59 pigs,60 and humans.61 In contrast to results from mice fed diets with 5% DF from different sources25 and pigs fed 17% RS,24 that demonstrated up-regulated expression or activation of PPARγ, we did not observe any diet-induced changes in intestinal PPARγ gene expression. The diet-induced alterations in SCFA production and concentrations had only little influence on parameters related to intestinal barrier function, as it was only the mRNA abundance of MUC2, a marker for mucus secretion from the goblet cells, that was influenced by the dietary composition. The relationship, however, was not directly related to luminal butyrate concentration. In rats the transcription of the MUC2 gene was negatively correlated with the butyrate pool in the cecum, and no correlations between the MUC2 transcription and SCFA were found in the colon. In contrast, studies with isolated perfused rat colon62,63 showed that MUC2 production and thereby indirectly MUC2 gene expression were increased at butyrate concentrations corresponding to the concentrations (11−16 mmol/kg digesta) measured in the cecum and proximal colon of AXD-fed pigs.33 However, in vitro studies are ambiguous in these conclusions.64 The global PCA revealed that the expression of genes in the large intestine could be divided in three clusters representing the cecum, the proximal to mid colon, and the distal colon and with different parameters related to the different clusters. This emphasizes that the response to diet-induced alterations in SCFA production and composition is not straightforward and that it is important to carefully consider the segment when the DF effects on intestinal gene expression are evaluated. On the basis of the previous discussion we anticipated a clearer beneficial effect on the expression of intestinal barrier and antiinflammatory genes in the gut following the two high-fiber diets and the consequently increased SCFA and butyrate production, and it can be speculated that the high fat level of our diets (approximately 30% energy) may have overshadowed some of these effects. A similar conclusion followed from a rat study J


Article


isome proliferator activated receptor gamma; RS, resistant starch; RSD, resistant starch diet; SCFA, short-chain fatty acid; SREBP1 and SREBP2, sterol regulatory element-binding transcription factors 1 and 2; TNFα, tumor necrosis factoralpha; WSD, Western-style diet; ZO1, zonula occludens

suggested that subcutaneous adipose tissue morphology (mean adipocyte size) was positively associated with plasma insulin, plasma glucose, and insulin resistance.73,74 A 4-week lowcalorie, low-fat diet compensated by proteins and carbohydrates of low glycemic index and soluble fiber, mainly inulin, resulted in a greater reduction in mean subcutaneous fat cell size than a conventional low-calorie diet in humans.74 Another study providing obese rats a diet containing 55% RS instead of 55% corn starch for 4 weeks increased the number of small adipocytes (≤100 μm in diameter) significantly.28 The most likely cause for the difference between the human studies and the current experiment is that we used genetically lean pigs exposed to the energy dense diets for a relatively short period of only 3 weeks in a phase of growth, when the pigs are only starting to deposit fat. In conclusion, diets rich in either AX or RS affected the expression of a number of genes in the large intestine depending on the segment, but the direction of the gene expression changes was not unambiguously intestinal healthpromoting and could not directly be related to the previously reported alterations in luminal SCFA and butyrate production. Although the two high-DF diets raised the peripheral plasma SCFA and butyrate concentration compared with the WSD, glycemic control and metabolic health were unaffected by diet, and there were no effects on fat cell size and adipocyte gene expression. The high fat level in the diets fed to genetically lean pigs as a model of healthy humans seems to dominate the colonic and metabolic health parameters regardless of dietary fiber.

■

■

REFERENCES

(1) Tucker, L. A.; Thomas, K. S. Increasing total fiber intake reduces risk of weight and fat gains in women. J. Nutr. 2009, 139, 576−581. (2) Meyer, K. A.; Kushi, L. H.; Jacobs, D. R., Jr.; Slavin, J.; Sellers, T. A.; Folsom, A. R. Carbohydrates, dietary fiber, and incident type 2 diabetes in older women. Am. J. Clin. Nutr. 2000, 71, 921−930. (3) Nomura, A. M.; Hankin, J. H.; Henderson, B. E.; Wilkens, L. R.; Murphy, S. P.; Pike, M. C.; Le Marchand, L.; Stram, D. O.; Monroe, K. R.; Kolonel, L. N. Dietary fiber and colorectal cancer risk: the multiethnic cohort study. Cancer Causes Control 2007, 18, 753−764. (4) Schatzkin, A.; Park, Y.; Leitzmann, M. F.; Hollenbeck, A. R.; Cross, A. J. Prospective study of dietary fiber, whole grain foods, and small intestinal cancer. Gastroenterology 2008, 135, 1163−116. (5) Fung, K. Y.; Cosgrove, L.; Lockett, T.; Head, R.; Topping, D. L. A review of the potential mechanisms for the lowering of colorectal oncogenesis by butyrate. Br. J. Nutr. 2012, 108, 820−831. (6) Brahe, L. K.; Astrup, A.; Larsen, L. H. Is butyrate the link between diet, intestinal microbiota and obesity-related metabolic diseases? Obes. Rev. 2013, 14, 950−959. (7) Scheppach, W.; Sommer, H.; Kirchner, T.; Paganelli, G. M.; Bartram, P.; Christl, S.; Richter, F.; Dusel, G.; Kasper, H. Effect of butyrate enemas on the colonic mucosa in distal ulcerative colitis. Gastroenterology 1992, 103, 51−56. (8) AACC (American Association of Cereal Chemists). The Definition of Dietary Fiber; St. Paul, MN, USA, 2001; p 15. (9) Bach Knudsen, K. E.; Lærke, H. N. Rye arabinoxylans: molecular structure, physiochemical properties and physiological effects in the gastrointestinal tract. Cereal Chem. 2010, 87, 353−362. (10) Neyrinck, A. M.; Delzenne, N. M. Potential interest of gut microbial changes induced by non-digestible carbohydrates of wheat in the management of obesity and related disorders. Curr. Opin. Clin. Nutr. Metab. Care 2010, 13, 722−728. (11) Neyrinck, A. M.; Van Hee, V. F.; Piront, N.; De Backer, F.; Toussaint, O.; Cani, P. D.; Delzenne, N. M. Wheat-derived arabinoxylan oligosaccharides with prebiotic effect increase satietogenic gut peptides and reduce metabolic endotoxemia in diet-induced obese mice. Nutr. Diabetes 2012, 2, e28. (12) Neyrinck, A. M.; Possemiers, S.; Druart, C.; Van De Wiele, T.; De, B. F.; Cani, P. D.; Larondelle, Y.; Delzenne, N. M. Prebiotic effects of wheat arabinoxylan related to the increase in bifidobacteria, roseburia and bacteroides/prevotella in diet-induced obese mice. PLoS One 2011, 6, e2094410.1371/journal.pone.0020944 (13) Belobrajdic, D. P.; Bird, A. R.; Conlon, M. A.; Williams, B. A.; Kang, S.; McSweeney, C. S.; Zhang, D.; Bryden, W. L.; Gidley, M. J.; Topping, D. L. An arabinoxylan-rich fraction from wheat enhances caecal fermentation and protects colonocyte DNA against diet-induced damage in pigs. Br. J. Nutr. 2012, 107, 1274−1282. (14) Lu, Z. X.; Walker, K. Z.; Muir, J. G.; Mascara, T.; O’Dea, K. Arabinoxylan fiber, a byproduct of wheat flour processing, reduces the postprandial glucose response in normoglycemic subjects. Am. J. Clin. Nutr. 2000, 71, 1123−1128. (15) Lu, Z. X.; Walker, K. Z.; Muir, J. G.; O’Dea, K. Arabinoxylan fibre improves metabolic control in people with type II diabetes. Eur. J. Clin. Nutr. 2004, 58, 621−628. (16) Garcia, A. L.; Otto, B.; Reich, S. C.; Weickert, M. O.; Steiniger, J.; Machowetz, A.; Rudovich, N. N.; Mohlig, M.; Katz, N.; Speth, M.; Meuser, F.; Doerfer, J.; Zunft, H. J.; Pfeiffer, A. H.; Koebnick, C. Arabinoxylan consumption decreases postprandial serum glucose, serum insulin and plasma total ghrelin response in subjects with impaired glucose tolerance. Eur. J. Clin. Nutr. 2007, 61, 334−341. (17) Hartvigsen, M. L.; Jeppesen, P. B.; Laerke, H. N.; Njabe, E. N.; Knudsen, K. E.; Hermansen, K. Concentrated arabinoxylan in wheat

AUTHOR INFORMATION

Corresponding Author

*(T.S.N.) Phone: +45 87156279. Fax: +45 87156000. E-mail: [email protected]. Funding

Supported by the Danish Council for Strategic Research (DSF 10-093526). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank Winnie Østergaard, Lisbeth Märcher, Kasper Bøgild Poulsen, and Annette Kamgaard Nielsen for excellent technical assistance. We thank Lantmännen Cerealia A/S, DuPont Nutrition & Health, and KMC Amba for delivery of fiber ingredients to be incorporated into the diets.

■

ABBREVIATIONS USED AMPK, AMP-activated protein kinase; AX, arabinoxylan; AXD, arabinoxylan diet; AXOS, arabinoxylan oligosaccharide; BW, body weight; BCFA, branched-chain fatty acid; Ce, cecum; Co1, proximal colon; Co2, mid colon; Co3, distal colon; DF, dietary fiber; DM, dry matter; GAPDH, glyceraldehyde 3 phosphate dehydrogenase; GPR41, GPR43, G-protein coupled receptor 41 and 43; HAM-RS2, high-amylose maize starch; HOMA-β, homeostasis model assessment of β-cell function; HOMA-IR, homeostasis model assessment of insulin resistance; IR, insulin resistance; LPL, lipoprotein lipase; MCP1, monocyte chemoattractant protein 1; MCT1, monocarboxylate transporter isoform 1; MUC2, mucin 2; NEFA, nonesterified fatty acid; NFκB, nuclear transcription factor kappa-beta; NSP, nonstarch polysaccharide; OCLN, occluding; PPARγ, peroxK


Article


of dietary fibers: a metabolomics study. Am. J. Clin. Nutr. 2014, 99, 941−949. (35) Miller, E. R.; Ullrey, D. E. The pig as a model for human nutrition. Annu. Rev. Nutr. 1987, 7, 361−382. (36) Helrich, K. Official Methods of Analysis of the Association of Official Analytical Chemists. 2. Food Composition Additives, Natural Contaminants; AOAC: Washington, DC, USA, 1990; pp 685−1298 s., ill. (37) Hansen, B. Determination of nitrogen as elementary N, and alternative to Kjeldahl. Acta Agric. Scand. 1989, 39, 113−118. (38) Stoldt, W. Worslag zur verinheitlichung der fettbestimmung in lebensmitteln (Suggestion to standardise the determination of fat in foodstuffs). Fette Seifen 1952, 54, 206−207. (39) Larsson, K.; Bengtsson, S. Bestämning av lätttilgängeliga kolhydrater i växtmaterial (Determination of readily available carbohydrates in plant material); National Laboratory of Agricultural Chemistry Methods Report 22; National Laboratory of Agricultural Chemistry: Uppsala, Sweden, 1983. (40) Bach-Knudsen, K. E. Carbohydrate and lignin contents of plant materials used in animal feeding. Anim. Feed Sci. Technol. 1997, 67, 319−338. (41) Kasprzak, M. M.; Laerke, H. N.; Larsen, F. H.; Knudsen, K. E.; Pedersen, S.; Jorgensen, A. S. Effect of enzymatic treatment of different starch sources on the in vitro rate and extent of starch digestion. Int. J. Mol. Sci. 2012, 13, 17292−17293. (42) Theander, O.; Åman, P. Studies on dietary-fibers. 1. Analysis and chemical characterization of water-soluble and water-insoluble dietary-fibers. Swed. J. Agric. Res. 1979, 9, 97−106. (43) Schürch, A. F.; Lloyd, L. E.; Crampton, E. W. The use of chromic oxide as an index for determining digestibility of a diet. J. Nutr. 1950, 41, 629−636. (44) Lovendahl, P.; Purup, H. M. Technical note: time-resolved fluoro-immunometric assay for intact insulin in livestock species. J. Anim. Sci. 2002, 80, 191−195. (45) Brighenti, F. Summary of the conclusion of the working group on profibre interlaboratory study on determination of short chain fatty acids in blood. In Functional Properties of Non-digestible Carbohydrates; Gullion, F., Amaral-Collaco, M. T., Andersson, H., Asp, N. G., Bach Knudsen, K. E., Rowland, I., Van Loo, J., Eds.; European Commission, DG XII, Science Research and Development: Brussels, Belgium, 1998; pp 150−153. (46) Duran-Montge, P.; Theil, P. K.; Lauridsen, C.; Esteve-Garcia, E. Dietary fat source affects metabolism of fatty acids in pigs as evaluated by altered expression of lipogenic genes in liver and adipose tissues. Animal 2009, 3, 535−542. (47) Bambace, C.; Telesca, M.; Zoico, E.; Sepe, A.; Olioso, D.; Rossi, A.; Corzato, F.; Di Francesco, V.; Mazzucco, A.; Santini, F.; Zamboni, M. Adiponectin gene expression and adipocyte diameter: a comparison between epicardial and subcutaneous adipose tissue in men. Cardiovasc. Pathol. 2011, 20, e153−e156. (48) Tchoukalova, Y. D.; Harteneck, D. A.; Karwoski, R. A.; Tarara, J.; Jensen, M. D. A quick, reliable, and automated method for fat cell sizing. J. Lipid Res. 2003, 44, 1795−1801. (49) Matthews, D. R.; Hosker, J. P.; Rudenski, A. S.; Naylor, B. A.; Treacher, D. F.; Turner, R. C. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 1985, 28, 412−419. (50) Theil, P. K.; Jorgensen, H.; Jakobsen, K. Energy and protein metabolism in pregnant sows fed two levels of dietary protein. J. Anim. Physiol. Anim. Nutr. 2002, 86, 399−413. (51) Iler, B. G. L.; Munck, L. Near infrared reflectance spectroscopy and computer graphics visualises unique genotype specific physicalchemical patterns from barley endosperms. Options Mediterr.. Ser. A, Semin. Mediterr. 2008, 81, 6. (52) Cuff, M. A.; Lambert, D. W.; Shirazi-Beechey, S. P. Substrateinduced regulation of the human colonic monocarboxylate transporter, MCT1. J. Physiol. 2002, 539, 361−371. (53) Brown, A. J.; Goldsworthy, S. M.; Barnes, A. A.; Eilert, M. M.; Tcheang, L.; Daniels, D.; Muir, A. I.; Wigglesworth, M. J.; Kinghorn, I.;

bread has beneficial effects as rye breads on glucose and changes in gene expressions in insulin-sensitive tissues of Zucker diabetic fatty (ZDF) rats. J. Agric. Food Chem. 2013, 61, 5054−5063. (18) Bird, A. R.; Conlon, M. A.; Christophersen, C. T.; Topping, D. L. Resistant starch, large bowel fermentation and a broader perspective of prebiotics and probiotics. Benefic. Microbes 2010, 1, 423−431. (19) Annison, G.; Topping, D. L. Nutritional role of resistant starch: chemical structure vs physiological function. Annu. Rev. Nutr. 1994, 14, 297−320. (20) Lattimer, J. M.; Haub, M. D. Effects of dietary fiber and its components on metabolic health. Nutrients 2010, 2, 1266−1289. (21) Higgins, J. A.; Brown, I. L. Resistant starch: a promising dietary agent for the prevention/treatment of inflammatory bowel disease and bowel cancer. Curr. Opin. Gastroenterol. 2013, 29, 190−194. (22) Conlon, M. A.; Kerr, C. A.; McSweeney, C. S.; Dunne, R. A.; Shaw, J. M.; Kang, S.; Bird, A. R.; Morell, M. K.; Lockett, T. J.; Molloy, P. L.; Regina, A.; Toden, S.; Clarke, J. M.; Topping, D. L. Resistant starches protect against colonic DNA damage and alter microbiota and gene expression in rats fed a Western diet. J. Nutr. 2012, 142, 832− 840. (23) Haenen, D.; Zhang, J.; Souza da, S. C.; Bosch, G.; van der Meer, I. M.; van, A. J.; van den Borne, J. J.; Perez, G. O.; Smidt, H.; Kemp, B.; Muller, M.; Hooiveld, G. J. A diet high in resistant starch modulates microbiota composition, SCFA concentrations, and gene expression in pig intestine. J. Nutr. 2013, 143, 274−283. (24) Haenen, D.; Souza da Silva, C.; Zhang, J.; Koopmans, S. J.; Bosch, G.; Vervoort, J.; Gerrits, W. J.; Kemp, B.; Smidt, H.; Muller, M.; Hooiveld, G. J. Resistant starch induces catabolic but suppresses immune and cell division pathways and changes the microbiome in proximal colon of male pigs. J. Nutr. 2013, 143, 1889−1898. (25) Bassaganya-Riera, J.; DiGuardo, M.; Viladomiu, M.; de Horna, A.; Sanchez, S.; Einerhand, A. W.; Sanders, L.; Hontecillas, R. Soluble fibers and resistant starch ameliorate disease activity in interleukin-10deficient mice with inflammatory bowel disease. J. Nutr. 2011, 141, 1318−1325. (26) Souza da Silva, C.; Haenen, D.; Koopmans, S. J.; Hooiveld, G. J.; Bosch, G.; Bolhuis, J. E.; Kemp, B.; Muller, M.; Gerrits, W. J. Effects of resistant starch on behaviour, satiety-related hormones and metabolites in growing pigs. Animal 2014, 8, 1402−1411. (27) Ingerslev, A. K.; Theil, P. K.; Hedemann, M. S.; Laerke, H. N.; Bach Knudsen, K. E. Resistant starch and arabinoxylan augment SCFA absorption, but affect postprandial glucose and insulin responses differently. Br. J. Nutr. 2014, 111, 1564−1576. (28) Harazaki, T.; Inoue, S.; Imai, C.; Mochizuki, K.; Goda, T. Resistant starch improves insulin resistance and reduces adipose tissue weight and CD11c expression in rat OLETF adipose tissue. Nutrition 2014, 30, 590−595. (29) Guilloteau, P.; Martin, L.; Eeckhaut, V.; Ducatelle, R.; Zabielski, R.; Van Immerseel, F. From the gut to the peripheral tissues: the multiple effects of butyrate. Nutr. Res. Rev. 2010, 23, 366−384. (30) Viladomiu, M.; Hontecillas, R.; Yuan, L.; Lu, P.; BassaganyaRiera, J. Nutritional protective mechanisms against gut inflammation. J. Nutr. Biochem. 2013, 24, 929−939. (31) Russo, I.; Luciani, A.; De Cicco, P.; Troncone, E.; Ciacci, C. Butyrate attenuates lipopolysaccharide-induced inflammation in intestinal cells and Crohn’s mucosa through modulation of antioxidant defense machinery. PLoS One 2012, 7, e32841. (32) Gao, Z.; Yin, J.; Zhang, J.; Ward, R. E.; Martin, R. J.; Lefevre, M.; Cefalu, W. T.; Ye, J. Butyrate improves insulin sensitivity and increases energy expenditure in mice. Diabetes 2009, 58, 1509−1517. (33) Nielsen, T. S.; Laerke, H. N.; Theil, P. K.; Sorensen, J. F.; Saarinen, M.; Forssten, S.; Bach Knudsen, K. E. Diets high in resistant starch and arabinoxylan modulate digestion processes and SCFA pool size in the large intestine and faecal microbial composition in pigs. Br. J. Nutr. 2014, 112, 1837−1849. (34) Nielsen, K. L.; Hartvigsen, M. L.; Hedemann, M. S.; Laerke, H. N.; Hermansen, K.; Bach Knudsen, K. E. Similar metabolic responses in pigs and humans to breads with different contents and compositions L


Article


and Levels of Dietary Fibres; Aarhus University: Foulum, Denmark, 2015. (69) Parker, D. R.; Weiss, S. T.; Troisi, R.; Cassano, P. A.; Vokonas, P. S.; Landsberg, L. Relationship of dietary saturated fatty acids and body habitus to serum insulin concentrations: the Normative Aging Study. Am. J. Clin. Nutr. 1993, 58, 129−136. (70) Mayer, E. J.; Newman, B.; Quesenberry, C. P., Jr.; Selby, J. V. Usual dietary fat intake and insulin concentrations in healthy women twins. Diabetes Care 1993, 16, 1459−1469. (71) Dobbins, R. L.; Szczepaniak, L. S.; Myhill, J.; Tamura, Y.; Uchino, H.; Giacca, A.; McGarry, J. D. The composition of dietary fat directly influences glucose-stimulated insulin secretion in rats. Diabetes 2002, 51, 1825−1833. (72) Gayoso-Diz, P.; Otero-Gonzalez, A.; Rodriguez-Alvarez, M. X.; Gude, F.; Garcia, F.; De Francisco, A.; Quintela, A. G. Insulin resistance (HOMA-IR) cut-off values and the metabolic syndrome in a general adult population: effect of gender and age: EPIRCE crosssectional study. BMC Endocr. Disord. 2013, 13, 47. (73) Hoffstedt, J.; Arner, E.; Wahrenberg, H.; Andersson, D. P.; Qvisth, V.; Löfgren, P.; Rydén, M.; Thörne, A.; Wirén, M.; Palmér, M.; Thorell, A.; Toft, E.; Arner, P. Regional impact of adipose tissue morphology on the metabolic profile in morbid obesity. Diabetologia 2010, 53, 2496−2503. (74) Rizkalla, S. W.; Prifti, E.; Cotillard, A.; Pelloux, V.; Rouault, C.; Allouche, R.; Laromiguiere, M.; Kong, L.; Darakhshan, F.; Massiera, F.; Clement, K. Differential effects of macronutrient content in 2 energyrestricted diets on cardiovascular risk factors and adipose tissue cell size in moderately obese individuals: a randomized controlled trial. Am. J. Clin. Nutr. 2012, 95, 49−63.

Fraser, N. J.; Pike, N. B.; Strum, J. C.; Steplewski, K. M.; Murdock, P. R.; Holder, J. C.; Marshall, F. H.; Szekeres, P. G.; Wilson, S.; Ignar, D. M.; Foord, S. M.; Wise, A.; Dowell, S. J. The Orphan G proteincoupled receptors GPR41 and GPR43 are activated by propionate and other short chain carboxylic acids. J. Biol. Chem. 2003, 278, 11312− 11319. (54) Bindels, L. B.; Dewulf, E. M.; Delzenne, N. M. GPR43/FFA2: physiopathological relevance and therapeutic prospects. Trends Pharmacol. Sci. 2013, 34, 226−232. (55) Kaji, I.; Karaki, S.; Tanaka, R.; Kuwahara, A. Density distribution of free fatty acid receptor 2 (FFA2)-expressing and GLP-1-producing enteroendocrine L cells in human and rat lower intestine, and increased cell numbers after ingestion of fructo-oligosaccharide. J. Mol. Histol. 2011, 42, 27−38. (56) Rodriguez-Cabezas, M. E.; Galvez, J.; Lorente, M. D.; Concha, A.; Camuesco, D.; Azzouz, S.; Osuna, A.; Redondo, L.; Zarzuelo, A. Dietary fiber down-regulates colonic tumor necrosis factor alpha and nitric oxide production in trinitrobenzenesulfonic acid-induced colitic rats. J. Nutr. 2002, 132, 3263−3271. (57) Hijova, E.; Szabadosova, V.; Stofilova, J.; Hrckova, G. Chemopreventive and metabolic effects of inulin on colon cancer development. J. Vet. Sci. 2013, 14, 387−393. (58) Alex, S.; Lange, K.; Amolo, T.; Grinstead, J. S.; Haakonsson, A. K.; Szalowska, E.; Koppen, A.; Mudde, K.; Haenen, D.; Al-Lahham, S.; Roelofsen, H.; Houtman, R.; van der Burg, B.; Mandrup, S.; Bonvin, A. M.; Kalkhoven, E.; Muller, M.; Hooiveld, G. J.; Kersten, S. Short-chain fatty acids stimulate angiopoietin-like 4 synthesis in human colon adenocarcinoma cells by activating peroxisome proliferator-activated receptor gamma. Mol. Cell. Biol. 2013, 33, 1303−1316. (59) Hontecillas, R.; Bassaganya-Riera, J. Peroxisome proliferatoractivated receptor gamma is required for regulatory CD4+ T cellmediated protection against colitis. J. Immunol. 2007, 178, 2940−2949. (60) Bassaganya-Riera, J.; Hontecillas, R. CLA and n-3 PUFA differentially modulate clinical activity and colonic PPAR-responsive gene expression in a pig model of experimental IBD. Clin. Nutr. 2006, 25, 454−465. (61) Lewis, J. D.; Lichtenstein, G. R.; Deren, J. J.; Sands, B. E.; Hanauer, S. B.; Katz, J. A.; Lashner, B.; Present, D. H.; Chuai, S.; Ellenberg, J. H.; Nessel, L.; Wu, G. D. Rosiglitazone for active ulcerative colitis: a randomized placebo-controlled trial. Gastroenterology 2008, 134, 688−695. (62) Barcelo, A.; Claustre, J.; Moro, F.; Chayvialle, J. A.; Cuber, J. C.; Plaisancie, P. Mucin secretion is modulated by luminal factors in the isolated vascularly perfused rat colon. Gut 2000, 46, 218−224. (63) Shimotoyodome, A.; Meguro, S.; Hase, T.; Tokimitsu, I.; Sakata, T. Short chain fatty acids but not lactate or succinate stimulate mucus release in the rat colon. Comp. Biochem. Physiol., Part A: Mol. Integr. Physiol. 2000, 125, 525−531. (64) Burger-van Paassen, N.; Vincent, A.; Puiman, P. J.; van der Sluis, M.; Bouma, J.; Boehm, G.; van Goudoever, J. B.; van Seuningen, I.; Renes, I. B. The regulation of intestinal mucin MUC2 expression by short-chain fatty acids: implications for epithelial protection. Biochem. J. 2009, 420, 211−219. (65) Charrier, J. A.; Martin, R. J.; McCutcheon, K. L.; Raggio, A. M.; Goldsmith, F.; Goita, M.; Senevirathne, R. N.; Brown, I. L.; Pelkman, C.; Zhou, J.; Finley, J.; Durham, H. A.; Keenan, M. J. High fat diet partially attenuates fermentation responses in rats fed resistant starch from high-amylose maize. Obesity 2013, 21, 2350−2355. (66) Toden, S.; Bird, A. R.; Topping, D. L.; Conlon, M. A. Differential effects of dietary whey, casein and soya on colonic DNA damage and large bowel SCFA in rats fed diets low and high in resistant starch. Br. J. Nutr. 2007, 97, 535−543. (67) Toden, S.; Bird, A. R.; Topping, D. L.; Conlon, M. A. High red meat diets induce greater numbers of colonic DNA double-strand breaks than white meat in rats: attenuation by high-amylose maize starch. Carcinogenesis 2007, 28, 2355−2362. (68) Ingerslev, A. K. The Impact of Short-Chain Fatty Acids on Metabolic Responses − Studies in Pigs Fed Diets with Contrasting Sources M


Effects of Resistant Starch and Arabinoxylan on Parameters

Recommend Documents