Article pubs.acs.org/JAFC
Engineered Expression Vectors Significantly Enhanced the Production of 2‑Keto‑D‑gluconic Acid by Gluconobacter oxidans Yuan-yuan Shi,∥ Ke-fei Li,∥ Jin-ping Lin,* Sheng-li Yang, and Dong-zhi Wei State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, China ABSTRACT: 2-Keto-D-gluconic acid (2KGA), a precursor of the important food antioxidant erythorbic acid, can be produced by Gluconobacter oxidans. To genetically engineer G. oxidans for improved 2KGA production, six new expression vectors with increased copy numbers based on pBBR1MCS-5 were constructed via rational mutagenesis. The utility of the mutant vectors was demonstrated by the increased ga2dh mRNA abundance, enzyme activity, and 2KGA production when the ga2dh gene was overexpressed using these vectors. Among the obtained constructs, G. oxidans/pBBR-3510-ga2dh displayed the highest oxidative activity toward gluconic acid (GA). In a batch biotransformation process, the G. oxidans/pBBR-3510-ga2dh strain exhibited 2KGA productivity (0.63 g/g CWW/h) higher than that obtained using strain G. oxidans/pBBR-ga2dh (0.40 g/g CWW/h). When sufficient oxygen was supplied during the biotransformation, up to 480 g/L GA was exhausted in 45 h by the G. oxidans/ pBBR-3510-ga2dh strain and approximately 486 g/L 2KGA was produced, generating the productivity of 0.54 g/g CWW/h. KEYWORDS: expression vectors, plasmid copy number, Gluconobacter oxidans, overexpression, 2-keto-D-gluconic acid
■
INTRODUCTION
In a previous study, we analyzed the G. oxidans DSM 2003 strain, which produces solely 2KGA through GA oxidation.15 This finding made the G. oxidans DSM 2003 strain an attractive candidate for 2KGA production. For use in industrial applications, it is preferable to engineer G. oxidans to further enhance its level of catalytic activity toward glucose or GA by overexpressing the membrane-bound enzyme encoded by the ga2dh gene. An optimized expression vector is a prerequisite for the overexpression of an enzyme. Inducible promoters,16,17 additional multiple cloning sites,16 antibiotic-resistance markers,18 and reporter genes17 have been used to construct pBBR1MCS derivatives. Certain pBBR1MCS derivatives have been commonly used for genetic analysis and further improvement of G. oxidans strains. However, many of these vectors have limited effectiveness and/or low transformation efficiency because of their relatively low copy number. In the present study, we aimed to increase the number of copies of the pBBR1MCS-5 plasmid by site-directed mutagenesis of the replication-control region. Then, plasmids with increased copy number were used to overexpress the ga2dh gene in G. oxidans DSM 2003 to further enhance its level of 2KGA production.
2-Keto-D-gluconic acid (2KGA) is a valuable organic acid that is mainly used as the key intermediate in the synthesis of Disoascorbic acid (erythorbic acid), a highly valuable Food and Drug Administration-approved food additive, preservative, and mild antioxidant used by the food industry.1,2 The annual production rate of 2KGA is 5 000−6 000 tons worldwide,3 nearly all of which is currently produced by microbial fermentation. Gluconobacter oxidans,4 Serratia marcescens,5 Klebsiella pneumonia,6 Arthrobacter globiformis,7 Pseudomonas fluorescens,8 and Pseudomonas aeruginosa1 have been used for 2KGA production. During microbial fermentation or biotransformation, the production of the byproducts gluconic acid (GA) and 5-keto-gluconic acid (5KGA) lead to lowered 2KGA yields. Moreover, substrate or product inhibition remains an inescapable issue for 2KGA production using batch fermentation. Despite the development of improved strains and processes over the last several decades, considerable efforts are still underway to further improve the industrial production strains. G. oxidans is known for its rapid and incomplete oxidation of numerous sugars, sugar acids, polyols, and alcohols9 and is currently used for the industrial production of many foodrelated products, pharmaceuticals, cosmetics, and chemicals, e.g., acetic acid (vinegar), L-(−)-sorbose (used in vitamin C synthesis), 6-amino-L-sorbose (a miglitol precursor), dihydroxyacetone, and ketogluconic acids.10−12 G. oxidans can oxidize glucose to 2KGA via GA. Membrane-bound glucose dehydrogenase and membrane-bound gluconate 2-dehydrogenase (GA2DH, encoded by ga2dh) are the main enzymes responsible for this two-step reaction.13,14 However, 5-ketoor 2,5-diketogluconate are also produced from GA by other membrane-bound gluconate dehydrogenases present in Gluconobacter sp. The ratio of the produced acids depends on the strains used and their cultivation conditions. © 2015 American Chemical Society
■
MATERIALS AND METHODS
Strains and Culture Conditions. G. oxidans DSM 2003 was cultivated aerobically at 30 °C and 220 rpm in sorbitol-containing medium consisting of 8.0% sorbitol, 2.0% yeast extract, 0.1% KH2PO4, 0.03% MgSO4, and 0.01% glutamine. Because G. oxidans possesses a natural resistance to cefoxitin, the cultivation medium contained 25 μg/mL of cefoxitin. Gentamicin and cefoxitin were added to the medium to a final concentration of 25 μg/mL to select for recombinant G. oxidans strains. Escherichia coli DH5α purchased from Transgen (Beijing, China) was grown in Luria−Bertani medium Received: Revised: Accepted: Published: 5492
March 19, 2015 May 23, 2015 May 26, 2015 May 26, 2015 DOI: 10.1021/acs.jafc.5b01652 J. Agric. Food Chem. 2015, 63, 5492−5498
Article
Journal of Agricultural and Food Chemistry Table 1. Oligonucleotide Primers Used for PCR in This Study primer name
sequences (5′-3′)
M35-F M35-R M10-F M10-R Mrbs-F Mrbs-R PtufB-F PtufB-R ga2dh-F ga2dh-R qpBBR-F qpBBR-R qpGOX3-F qpGOX3-R q16S−F q16S-R qga2dh-F qga2dh-R
CAGCCACTTTTACGCAACGCATAATT TCAATTACAGATTTTCTTTAACCTACGCAATG GTATAATTGTTGTCGCGCTGCCGAAAAG GTTGCGTAAAAGTGGCAGTCAATTACAG GAAATAAGCATGGCCACGCAGTCCAGAG CTCCATGCGGTAGGGTGCCGCAC ACTGAGCTCCGATGGTAAGAAATCCACTGC ATATCTAGACCAAAACCCCGCTCCACC CTATCTAGAGGAGAAACCTGTGCCCCCCATG GAGGGATCCTTCAGTTCAGTGAGACCGCATCATC CGGATTCACCGTTTTTATCAGGCTC AGTGTGACCGTGTGCTTCTCAAATG GTATTGGGCTGCGTTCGT AATGGGTTTCATGGTGGC GCGGTTGTTACAGTCAGATG GCCTCAGCGTCAGTATCG CCAGAACCTGTCCCAGTCCAC CAGAAAGGCTGCGAGTTGAC
at 37 °C and 200 rpm. Gentamicin was added to a final concentration of 25 μg/mL for plasmid maintenance. General Molecular Biological Techniques. Routine molecular biological techniques were performed according to Sambrook et al.19 The restriction enzymes and T4 DNA ligase used were purchased from Fermentas (St. Leon-Rot, Germany). Pfu DNA polymerase (Transgen, Beijing, China) was used for PCR amplification of the insets, and Taq PCR MasterMix (Zoman, Beijing, China) was used for the test PCR reactions. The primers used in this study are listed in Table 1. Transformation of G. oxidans was performed by triparental mating, essentially as described by Hölscher et al.20 Site-Directed Mutagenesis to Construct an Improved pBBR1MCS-5 Series. Site-directed mutagenesis upstream of the gene rep in pBBR1MCS-5 was performed, including the −10 and −35 region of the promoter and the ribosome binding site (RBS), using a TOYOBO KOD-Plus-Mutagenesis Kit (Tokyo, Japan) according to the manufacturer’s instructions. The primers used for each mutation are listed in Table 1. The pBBR1MCS-5 plasmid was mutated to generate pBBR-10, pBBR-35, pBBR-3510, pBBR-RBS, pBBR-R10, pBBR-R35, and pBBR-R31. Among the resulting plasmids, pBBR-10 was mutated at the −10 region (CATAAT to TATAAT) using the primers M10-F and M10-R. pBBR-35 was mutated at the −35 region (TTGACT to TTGACA) using the primers M35-F and M35-R. pBBR-3510 was created using two rounds of mutagenesis using the primer pairs M35-F and M35-R and M10-F and M10-R consecutively. pBBR-RBS was mutated at the ribosome binding site (GGAGA) of the rep gene (to GGAGGAAA) using the primers Mrbs-F and Mrbs-R. pBBR-R10 was created using two rounds of mutagenesis using the primer pairs M10-F and M10-R and Mrbs-F and Mrbs-R consecutively. pBBR-R35 was created using two rounds of mutagenesis using the primer pairs M35-F and M35-R and Mrbs-F and Mrbs-R consecutively, and pBBR-R31 was created using three rounds of mutagenesis using the primer pairs M35-F and M35-R, M10-F and M10-R, and Mrbs-F and Mrbs-R consecutively. Construction of Recombinant Plasmids. The fragments of the G. oxidans tuf B promoter and the ga2dh gene were amplified with PCR using the primer pairs PtufB-F and PtufB-R and ga2dh-F and ga2dh-R, respectively, using chromosomal DNA as the template. The resulting fragment of the tuf B gene was digested using SacI/XbaI and was ligated into pBBR1MCS-5 digested with the same enzymes to produce the recombinant plasmid pBBR1MCS-tuf B. The fragment of ga2dh was digested using XbaI/BamHI and was cloned into pBBR1MCS-tuf B digested with the same enzymes to generate pBBR-ga2dh. The plasmids pBBR-10-ga2dh, pBBR-35-ga2dh, pBBRRBS-ga2dh, pBBR-3510-ga2dh, pBBR-R10-ga2dh, pBBR-R35-ga2dh, and pBBR-R31-ga2dh were constructed in the same manner. All of the
restriction site
SacI XbaI XbaI BamHI
resulting recombinant plasmids were confirmed by sequencing, and these plasmids were transformed into G. oxidans DSM 2003 through triparental mating.20 Real-Time PCR. The plasmid copy number and level of gene transcription were determined using RT-qPCR. The StepOnePlus Real-Time PCR System (Applied Biosystems, California, United States) was used for qPCR amplification and detection. The qPCR analyses were conducted in a total volume of 20 μL using the CWBIO FastSYBR Mixture (with Rox) (Beijing, China) according to the manufacturer’s recommendations. All of the reactions were performed in triplicate. The recombinant G. oxidans cells were cultured at 30 °C and 220 rpm for 22 h. Plasmid DNA was collected from 3 mL cultures according to the Biomiga Plasmid Miniprep Kit protocol (San Diego, CA, United States). The extracted plasmids were used as templates, and the cryptic plasmid pGOX3 was used as the internal single-copy reference. The primer pairs qpBBR-F and qpBBR-R and qpGOX3-F and qpGOX3-R were used in the respective reactions.21 Total RNA was isolated from 15 mL cultures using Takara RNAiso Plus (Dalian, China) following the manufacturer’s instructions. A 1 μg sample of RNA was reverse transcribed into cDNA using the Takara PrimeScript RT reagent kit including gDNA Eraser (Dalian, China). The relative abundance of the ga2dh transcripts in the recombinant strains was analyzed using RT-qPCR with the primers qga2dh-F and qga2dh-R. The 16S rRNA gene was used as the internal standard and detected with the primers q16S-F and q16S-R. Preparation of Membrane Fractions. The G. oxidans cells were harvested by centrifugation at 8 000 rpm for 10 min and washed twice with 20 mM potassium phosphate buffer (pH 7.5). The washed cells were resuspended with the same buffer at a cell wet weight (CWW) concentration of 0.1 g/mL and then disrupted using an ultrasonifier (Xinzhi, Ningbo, China) for 99 cycles (300 W, 5 s sonication, 5 s pause on ice). After centrifugation at 8 000 rpm for 15 min to remove the cell debris, the supernatants were centrifuged at 40 000 rpm for 60 min. The sediments were collected and designated the membrane fractions, which were resuspended into 100 mM NaAc buffer (pH 5.5) on ice subsequently. Enzyme Activity Assay and Protein Concentration Determination. GA2DH activity was determined at 30 °C by measuring the initial reduction rate of 2,6-dichlorophenolindophenol (2,6-DCIP, Sigma, St. Louis, MO, United States) at 600 nm on a SpectraMax 190 instrument (Molecular Devices, California, United States), and a molar extinction coefficient of 10.8 mM−1 cm−1 for DCIP was used for the calculation.22 The basal reaction mixture consisted of 5 mM DCIP and 6.5 mM phenazine methosulfate (PMS, Sigma, St. Louis, MO, United States) in 50 mM potassium phosphate buffer (pH 6.0) and was 5493
DOI: 10.1021/acs.jafc.5b01652 J. Agric. Food Chem. 2015, 63, 5492−5498
Article
Journal of Agricultural and Food Chemistry prepared just before the assay. The reaction mixtures (200 μL) for enzyme assay containing 80 μL of basal reaction mixture and 0.015 mg of protein in 50 mM potassium phosphate buffer (pH 6.0) was incubated at 30 °C for 5 min, and the reactions were started by adding 50 mM prewarmed GA. One unit of GA2DH activity was defined as the amount of the enzyme that catalyzes the reduction of 1 μM DCIP per min at 30 °C. Protein concentration was determined by the method of Bradford,23 using bovine serum albumin as a standard. Relative 2KGA Production by the Different G. oxidans Strains. The relative level of 2KGA production was evaluated in the different G. oxidans strains by determining the concentration of 2KGA after 2 h of catalysis. The G. oxidans strains were cultivated for 22−24 h, after which the cells were collected by centrifugation at 7 000 rpm for 20 min. The reaction system contained 10 g CWW/L resting cells and 40 g/L GA in 50 mL shaking flasks with a working volume of 10 mL. The reactions were performed at 30 °C and 200 rpm using a rotary shaker. All of the experiments were conducted in triplicate. Biotransformation of GA to 2KGA. Biotransformation of GA to 2KGA was performed in a 7 L fermenter with a working volume of 1.5 L at 30 °C and 600 rpm, with the pH maintained at 5.8 using NaOH. The G. oxidans cells were cultivated for 22−24 h, after which the cells were collected by centrifugation at 7 000 rpm for 20 min. The reaction solutions contained 30 g CWW/L resting cells and 320 or 480 g/L GA. Filtered air was injected at a flow rate of 8 L/min to provide dissolved oxygen for the reaction. Quantification of GA and 2KGA. Quantification of GA and 2KGA was performed using high-performance liquid chromatography (HPLC). The substances were separated using an ICSep COREGEL87H3 column (Transgenomic, New Haven, CT, United States) at 35 °C, using 0.008 N H2SO4 as the mobile phase at a flow rate of 0.35 mL/min, with UV absorption evaluated at 210 nm.
Figure 1. Maps showing the mutations created in the pBBR1MCS-5 plasmid derivatives. The mutations were numbered according to the corresponding base pair positions in pBBR1MCS-5. The nucleotides listed in front of the numbers indicate the wild-type sequences. The nucleotides listed after the numbers indicate the mutated sequences. “GAAins” after the numbers indicates that GAA was inserted at that position.
pBBR-RBS. pBBR-RBS had a GGAGA to GGAGGAAA mutation in the ribosomal binding site of pBBR1MCS-5. A combination of mutations at −10 and −35 of the promoter region and the ribosomal binding site generated the mutant plasmids pBBR-R10, pBBR-R35, and pBBR-R31 (Figure 1). After being transformed into G. oxidans DSM 2003, six of the seven mutant plasmids, with the exception of pBBR-R10, were found to be capable of stable replication. Determination of the Relative Plasmid Copy Number of the Mutant Plasmids in G. oxidans. The relative plasmid copy numbers were determined by qPCR using the total plasmids isolated from recombinant G. oxidans DSM 2003 as the templates. The cryptic plasmid pGOX3,9 which is a low copy-number plasmid in G. oxidans with a large size of 14 547 bp, was used as the internal single-copy reference.21 The relative plasmid copy numbers were calculated from the threshold cycle (CT) using the 2ΔCT method as described by Zhang et al.21 The CT values are calculated automatically by the instrument according to the amplification plot, while ΔCT is the difference between the CT value of the single-copy reference and that of the plasmids. The results showed that the relative plasmid copy numbers of pBBR1MCS-5, pBBR-10, pBBR-35, pBBR-RBS, pBBR-R35, pBBR-3510, and pBBR-R31 in G. oxidans were 24 ± 6, 37 ± 8, 43 ± 8, 28 ± 8, 59 ± 5, 36 ± 7, and 43 ± 3 greater than that of pGOX3, respectively, demonstrating that the plasmid copy numbers of all the engineered plasmids in G. oxidans were higher than that of pBBR1MCS-5 plasmid (Table 2). The copy numbers of the plasmid derivatives with mutations in the −10 or/and −35 region were increased by 50−104% compared to the copy number of the control plasmid. A single insertion of GAA at nucleotide 1786 of pBBR1MCS-5 had little effect on plasmid copy number. Overexpression of the ga2dh Gene in G. oxidans Using Different Mutant Vectors. To demonstrate the utility of the mutant plasmids for engineering G. oxidans, the key enzyme involved in 2KGA formation, GA2DH, was overexpressed in G. oxidans DSM 2003 using the mutant vectors
■
RESULTS AND DISCUSSION Construction of Mutant Derivatives of Plasmid pBBR1MCS-5. The plasmid used as the template for mutagenesis was the broad-host-range vector pBBR1MCS-5,18 which has been used to express genes of interest in Acetobacter and Gluconobacter strains.24−28 The replication control region of pBBR-based plasmids is the rep gene.29,30 Tao et al. performed localized random mutagenesis in the replication control region of a pBBR-based plasmid pBHR1 and showed that single amino acid change of serine to leucine at codon 100 of the replication protein and single nucleotide change of C to T at 46 bp upstream of the rep gene caused the increase of plasmid copy number by 3−7 fold.31 The promoter and the ribosome binding site located in the upstream region of rep gene regulate the expression of rep gene. Thus, based on the pBBR1MCS-5, the mutant plasmids pBBR-10, pBBR-35, and pBBR-3510 were constructed by mutagenesis of −10 and −35 promoter regions to improve the expression of rep (Figure 1). Plasmid pBBR-10 contained a C to T (C1707T) mutation at 86 bp upstream of the rep gene, generating a CATAAT to TATAAT mutation in the −10 promoter region. The plasmid pBBR-35 contained a T to A (T1689A) mutation at 104 bp upstream of the rep gene, generating a TTGACT to TTGACA mutation in the −35 promoter region. pBBR-3510 contained two mutations, C1707T and T1689A. These mutations made the promoter equipped with conserved −35 and −10 hexamers sequences,32 thus increasing the promoter activity and the expression level of the rep gene. Jacob et al. previously observed that increasing the base complementarity of the ribosomal binding site and the 3′ end of the gene encoding the 16S rRNA enhanced the binding of the mRNA to the ribosome.33−37 An insertion of GAA (GAA1786ins) at 7 bp upstream of the rep gene in pBBR1MCS-5 was generated, yielding the mutant plasmid 5494
DOI: 10.1021/acs.jafc.5b01652 J. Agric. Food Chem. 2015, 63, 5492−5498
Article
Journal of Agricultural and Food Chemistry
Table 2. Results of the Quantification of Relative Plasmid Copy Number in G. oxydans DSM 2003 Using Real-Time PCRa plasmid pBBR1MCS-5 pBBR-10 pBBR-35 pBBR-RBS pBBR-R35 pBBR-3510 pBBR-R31
CT-pGOX3 19.01 19.63 19.22 20.53 19.82 20.15 19.94
± ± ± ± ± ± ±
CT-pBBR
0.22 0.12 0.06 0.01 0.07 0.18 0.01
14.42 14.44 13.79 15.73 13.94 14.98 14.53
± ± ± ± ± ± ±
relative copy number
0.09 0.10 0.17 0.36 0.04 0.08 0.10
24 37 43 28 59 36 43
± ± ± ± ± ± ±
ratio
6 8 8 8 5 7 3
1 1.54 1.79 1.17 2.50 1.50 1.79
± ± ± ± ± ± ±
0.24 0.33 0.33 0.33 0.21 0.29 0.13
a The 2ΔCT method was used for quantitation. Plasmid pBBR1MCS-5 was used as the control sample. The relative copy numbers were determined by comparing the value of the plasmids to that of the cryptic plasmid pGOX3. Ratio refers to the ratio of the copy number of plasmids to that of pBBR1MCS-5.
under the control of the G. oxidans tuf B promoter, which has been widely used in G. oxidans.25−27 The parental plasmid pBBR1MCS-5 was used as the control for ga2dh expression. The relative copy numbers of plasmids harboring ga2dh gene in G. oxidans were also detected. As shown in Table 3, the Table 3. Results of the Relative Copy Number of Plasmids Harboring ga2dh Gene Using Real-Time PCRa plasmid
CT-pGOX3
CT-pBBR
relative copy number
pBBRga2dh pBBR-10ga2dh pBBR-35ga2dh pBBRRBSga2dh pBBR-R35ga2dh pBBR3510ga2dh pBBR-R31ga2dh
15.91 ± 0.03
11.96 ± 0.05
15 ± 1
1.00 ± 0.07
15.77 ± 0.34
11.24 ± 0.10
23 ± 8
1.53 ± 0.54
17.23 ± 0.12
12.14 ± 0.19
34 ± 8
2.27 ± 0.53
15.56 ± 0.06
11.11 ± 0.03
22 ± 1
1.47 ± 0.06
15.47 ± 0.13
10.17 ± 0.05
39 ± 6
2.60 ± 0.40
15.01 ± 0.03
9.48 ± 0.11
46 ± 5
3.07 ± 0.33
G.oxidans strains were prepared and used to determine the GA2DH activities toward GA. As shown in Table 4, compared
15.13 ± 0.14
10.24 ± 0.11
30 ± 5
2.00 ± 0.33
Table 4. Activities of the Membrane-Bound GA2DH of Different G. oxydans Strainsa
ratio
Figure 2. Relative abundance of ga2dh transcripts in the different G. oxidans strains. All of the cells were cultured in sorbitol-containing medium for 22 h and were harvested for total RNA isolation. The relative transcription levels of the ga2dh gene were determined using real-time PCR. The values were compared to that of the strain G. oxidans/pBBR-ga2dh.
The 2ΔCT method was used for quantitation. Plasmid pBBR-ga2dh was used as the control sample. The relative copy numbers were determined by comparing the value of plasmids to that of the cryptic plasmid pGOX3. Ratio refers to the ratio of the copy number of plasmids to that of pBBR-ga2dh.
a
strains G. G. G. G. G. G. G. G.
plasmids copy numbers were affected by ga2dh overexpression, and the relative plasmid copy numbers of mutant plasmids harboring ga2dh gene were higher than that of pBBR-ga2dh, which was similar to the result of empty vectors. However, instead of pBBR-R35-ga2dh, the copy number of plasmid pBBR-3510-ga2dh (46 ± 5) was the highest, increased by 207% compared to that of pBBR-ga2dh (15 ± 1). To validate the relative transcription level of the ga2dh gene between the recombinant G. oxidans strains harboring the various plasmids, the ga2dh mRNA levels were assessed using real-time PCR. Using 16S rRNA as the internal standard, it was clearly demonstrated that the highest abundance of ga2dh transcripts was observed in the G. oxidans/pBBR-3510-ga2dh strain, which was approximately 22-fold higher than that of the control strain G. oxidans/pBBR1MCS and approximately 6-fold higher than that of the G. oxidans/pBBR-ga2dh strain (Figure 2). GA2DH is a membrane-bound protein and is responsible for the oxidation of GA to 2KGA. Membrane fractions of different
oxidans/pBBR1MCS oxidans/pBBR-ga2dh oxidans/pBBR-10-ga2dh oxidans/pBBR-35-ga2dh oxidans/pBBR-3510-ga2dh oxidans/pBBR-RBS-ga2dh oxidans/pBBR-R35-ga2dh oxidans/pBBR-R31-ga2dh
GA2DH activity (U/mg protein) 0.43 1.28 1.60 2.10 3.95 1.97 3.35 2.90
± ± ± ± ± ± ± ±
0.06 0.09 0.11 0.10 0.07 0.28 0.23 0.11
a
Each value represents the average value and standard deviation of three independent experiments.
to the strain G. oxidans/pBBR-ga2dh, the GA2DH activities of the obtained constructs using the mutant vectors were increased. Among these strains, G. oxidans/pBBR-3510-ga2dh displayed the highest GA2DH activity (3.95 ± 0.07 U/mg protein). The seven recombinant strains were used to catalyze GA in shaking flasks, and their 2KGA production in 2 h were determined to compare their productivities of 2KGA. The 2KGA concentration achieved by the G. oxidans strain containing pBBR1MCS-5 was set as the control value. As shown in Figure 3, all of the ga2dh-overexpressing strains 5495
DOI: 10.1021/acs.jafc.5b01652 J. Agric. Food Chem. 2015, 63, 5492−5498
Article
Journal of Agricultural and Food Chemistry
Figure 3. Levels of 2KGA production by G. oxidans strains containing various plasmids. The catalytic reactions were performed under the same conditions. The values were compared to that of the strain G. oxidans/pBBR-ga2dh.
produced concentrations of 2KGA higher than that of the control strain (G. oxidans/pBBR1MCS). More 2KGA was produced by the recombinant strains containing mutant plasmids compared to the 2KGA production of G. oxidans/ pBBR-ga2dh. Among these strains, G. oxidans/pBBR-3510ga2dh exhibited the highest level of 2KGA production, corresponding to the highest relative transcription level of the ga2dh gene and highest GA2DH activity. Biotransformation of GA to 2KGA by the Recombinant G. oxidans/pBBR-3510-ga2dh Strain. To assess the potential industrial use of G. oxidans/pBBR-3510-ga2dh, which exhibited the greatest increase in 2KGA production, scaled-up biotransformation of GA was performed in a 7 L fermenter with a continuous air supply. The reaction system contained 30 g CWW/L resting cells and 320 g/L GA. To exclude the effects of the empty vector, G. oxidans/pBBR1MCS was also included in the analysis. The level of 2KGA production by the three G. oxidans strains harboring pBBR-3510-ga2dh, pBBR-ga2d, or pBBR1MCS-5 is summarized in Figure 4. Time course analysis of GA oxidation by G. oxidans/pBBR-3510-ga2dh revealed that approximately 320 g/L 2KGA accumulated from 320 g/L GA in 17 h, generating a productivity of 0.63 g/g CWW/h. In contrast, the G. oxidans/pBBR-ga2dh and G. oxidans/ pBBR1MCS strains required more time to complete this reaction, leading to the productivities of 0.40 g/g CWW/h and 0.22 g/g CWW/h, respectively. Thus, the overexpression of ga2dh in G. oxidans with the mutant plasmid pBBR-3510 significantly accelerated the oxidative reaction and resulted in increased 2KGA production, which was enhanced by approximately 58% and 186% compared to that of ga2dh-overexpressing G. oxidans harboring the control plasmid pBBR1MCS-5 or the parental strain containing the empty vector, respectively. When the initial GA concentration was increased to 480 g/L, 30 g CWW/L of resting G. oxidans/pBBR-3510-ga2dh cells still completely exhausted the supplied GA and produced 474 g/L 2KGA when a continuous air supply was provided, although the conversion time was extended to 96 h, corresponding to a productivity of 0.16 g/g CWW/h (Figure 5). This reaction could not be completed by the G. oxidans/pBBR1MCS or the G. oxidans/pBBR-ga2dh strain (data not shown). In addition to substrate or product inhibition, we observed that an insufficient
Figure 4. Comparative 2KGA production and GA consumption of G. oxidans/pBBR1MCS, G. oxidans/pBBR-ga2dh, and G. oxidans/pBBR3510-ga2dh in a 7 L fermenter supplied with 320 g/L GA.
Figure 5. Time course of the oxidation of GA by the engineered strain G. oxidans/pBBR-3510-ga2dh.
oxygen supply had a negative impact on the performance of G. oxidans/pBBR-3510-ga2dh. During the entire reaction process, the DO level in the fermenter remained less than zero despite the fact that the agitation speed and aeration rate were maintained as high as possible. Thus, oxygen instead of air was supplied continuously to support the oxidation of 480 g/L GA. As expected, 45 h after initiating the reaction, nearly all of the supplied GA had been exhausted by G. oxidans/pBBR-3510ga2dh and approximately 486 g/L 2KGA had been accumulated, corresponding to a productivity of 0.36 g/g CWW/h. Compared to the results of previous studies,8 the G. oxidans/pBBR-3510-ga2dh strain created in this study showed the highest level of 2KGA production and a relatively high productivity level. 5496
DOI: 10.1021/acs.jafc.5b01652 J. Agric. Food Chem. 2015, 63, 5492−5498
Article
Journal of Agricultural and Food Chemistry
■
(13) Matsushita, K.; Toyama, H.; Adachi, O. Respiratory chains and bioenergetics of acetic acid bacteria. Adv. Microb. Physiol. 1994, 36, 247−301. (14) Hölscher, T.; Schleyer, U.; Merfort, M.; Bringer-Meyer, S.; Görisch, H.; Sahm, H. Glucose oxidation and PQQ-dependent dehydrogenases in Gluconobacter oxydans. J. Mol. Microbiol. Biotechnol. 2009, 16, 6−13. (15) Chen, H.; Li, K.; Shu, X.; Liu, L.; Lin, J.; Wei, D. High-yield production of 2-keto-D-gluconate by resting cells of Gluconobacter oxydans. Sci. Technol. Food Ind. 2012, 19, 177−181 (in Chinese). (16) Schleyer, U.; Bringer-Meyer, S.; Sahm, H. An easy cloning and expression vector system for Gluconobacter oxydans. Int. J. Food Microbiol. 2008, 125, 91−95. (17) Kallnik, V.; Meyer, M.; Deppenmeier, U.; Schweiger, P. Construction of expression vectors for protein production in Gluconobacter oxydans. J. Biotechnol. 2010, 150, 460−465. (18) Kovach, M. E.; Elzer, P. H.; Hill, D. S.; Robertson, G. T.; Farris, M. A.; Roop, R. M., II; Peterson, K. M. Four new derivatives of the broad-host-range cloing vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 1995, 166, 175−176. (19) Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY. 1989. (20) Hölscher, T.; Görisch, H. Knockout and overexpression of pyrroloquinoline quinone biosynthetic genes in Gluconobacter oxydans 621H. J. Bacteriol. 2006, 188, 7668−7676. (21) Zhang, L.; Lin, J.; Ma, Y.; Wei, D.; Sun, M. Construction of a novel shuttle vector for use in Gluconobacter oxydans. Mol. Biotechnol. 2010, 46, 227−233. (22) Sugisawa, T.; Hoshino, T. Purification and properties of membrane-bound D-sorbitol dehydrogenase from Gluconobacter suboxydans IFO 3255. Biosci., Biotechnol., Biochem. 2002, 66, 57−64. (23) Bradford, M. M. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of proteindye binding. Anal. Biochem. 1976, 72, 248−254. (24) Merfort, M.; Herrman, U.; Ha, S. W.; Elfari, M.; Bringer-Meyer, S.; Görisch, H.; Sahm, H. Modification of the membrane-bround glucose oxidation system in Gluconobacter oxydans significantly increases gluconate and 5-keto-D-gluconic acid accumulation. Biotechnol. J. 2006, 1, 556−563. (25) Merfort, M.; Herrman, U.; Bringer-Meyer, S.; Sahm, H. Highyield 5-keto-D-gluconic acid formation is mediated by soluble and membrane-bound gluconate-5-dehydrogenases of Gluconobacter oxydans. Appl. Microbiol. Biotechnol. 2006, 73, 443−451. (26) Li, M.; Wu, J.; Liu, X.; Lin, J.; Wei, D. Enhanced production of dihydroxyacetone from glycerol by overexpression of glycerol dehydrogenase in an alcohol dehydrogenase- deficient mutant of Gluconobacter oxydans. Appl. Microbiol. Biotechnol. 2010, 101, 8294− 8299. (27) Zhang, J.; Li, S.; Xu, H.; Zhou, P.; Zhang, L.; Ouyang, P. Purification of xylitol dehydrogenase and improved production of xylitol by increasing XDH activity and NADH supply in Gluconobacter oxydans. J. Agric. Food Chem. 2013, 61, 2861−2867. (28) Gätgens, C.; Degner, U.; Bringer-Meyer, S.; Herrmann, U. Biotransformation of glycerol to dihydroxyacetone by recombinant Gluconobacter oxydans DSM 2343. Appl. Microbiol. Biotechnol. 2007, 76, 553−559. (29) Antoine, R.; Locht, C. Isolation and molecular characterization of a novel broad-host-range plasmid from Bordetalla bronchiseptica with sequence similarities to plasmids from Gram-positive organisms. Mol. Microbiol. 1992, 6, 1785−1799. (30) Kovach, M. E.; Phillips, R. W.; Elzer, P. H.; Roop, R. M., II; Peterson, K. M. pBBR1MCS: a broad-host-range cloning vector. Biotechniques 1994, 16, 800−802. (31) Tao, L.; Jackson, R. E.; Cheng, Q. Directed evolution of copy number of a broad host range plasmid for metabolic engineering. Metab. Eng. 2005, 7, 10−17.
AUTHOR INFORMATION
Corresponding Author
*No. 130 Meilong Road, East China University of Science and Technology, Shanghai 200237, China. Tel.: +86-2164252981. Fax: +86-2164250068. E-mail:
[email protected]. Author Contributions ∥
Y.S. and K.L.: these authors contributed equally.
Funding
This study was financially supported by the National Key Basic Research Development Program of China (Grant 2012CB721003), the Natural Science Foundation of China (Grant 21276084), the Shanghai Natural Science Foundation (Grant 15ZR1408600), the National Major Science and Technology Projects of China (Grant 2012ZX09304009), and the Fundamental Research Funds of the Central Universities. Notes
The authors declare no competing financial interest.
■
ABBREVIATIONS
■
REFERENCES
GA, gluconic acid; 2KGA, 2-keto-D-gluconic acid; ga2dh, gluconate-2-dehydrogenase; HPLC, high-performance liquid chromatography; CWW, cell wet weight
(1) Chia, M.; Nguyen, T. B. V.; Choi, W. J. DO-stat fed-batch production of 2-keto-D-gluconic acid from cassava using immobilized aeruginosa. Appl. Microbiol. Biotechnol. 2008, 78, 759−765. (2) Rehwoldt, R. Tracking the use of antioxidants through industry surveys. Food Chem. Toxicol. 1986, 24, 1039−1041. (3) Sun, W.; Yun, Q.; Zhou, Y.; Cui, F.; Yu, S.; Zhou, Q.; Sun, L. Continuous 2-keto-gluconic acid (2KGA) production from corn starch hydrolysate by Pseudomonas f luorescens AR4. Biochem. Eng. J. 2013, 77, 97−102. (4) Kulka, D.; Hall, A. N.; Walker, T. K. Formation of 2-keto-Dgluconic acid, 5-keto-D-gluconic acid, and tartronic acid by acetobacter species. Nature 1951, 167, 905−906. (5) Minisenhermer, T. J.; Anderson, R. F.; Lagoda, A. A.; Tyler, D. Production of 2-ketogluconic acid by Serratia marcescens. Appl. Microbiol. 1965, 13, 393−396. (6) Wei, D.; Xu, J.; Sun, J.; Shi, J.; Hao, J. 2-Ketogluconic acid production by Klebsiella pneumonia CGMCC 1.6366. J. Ind. Microbiol. Biotechnol. 2013, 40, 561−570. (7) Teng, W.; Sun, W.; Yu, B.; Cui, F.; Qian, J.; Wang, L.; Qi, X.; Wei, H. Continuous conversion of rice starch hydrolysate to 2-keto-Dgluconic acid by Arthrobacter globiformis C224. Biotechnol. Bioprocess Eng. 2013, 18, 709−714. (8) Sun, W.; Zhou, Y.; Zhou, Q.; Cui, F.; Yu, S.; Sun, L. Semicontinuous production of 2-keto-gluconic acid by Pseudomonas f luorescens AR4 from rice starch hydrolysate. Bioresour. Technol. 2012, 110, 546−551. (9) Prust, C.; Hoffmeister, M.; Liesegang, H.; Wiezer, A.; Fricke, W. F.; Ehrenreich, A.; Gottschalk, G.; Deppenmeier, U. Complete genome sequence of the acetic acid bacterium Gluconobacter oxydans. Nat. Biotechnol. 2005, 23, 195−200. (10) Gupta, A.; Singh, V. K.; Qazi, G. N.; Kumar, A. Gluconobacter oxydans: its biotechnological applications. J. Mol. Microbiol. Biotechnol. 2001, 3, 445−456. (11) Deppenmeier, U.; Hoffmeister, M.; Prust, C. Biochemistry and biotechnological applications of Gluconobacter stains. Appl. Microbiol. Biotechnol. 2002, 60 (3), 233−242. (12) Macauley, S.; McNeil, B.; Harvey, L. M. The genus Gluconobacter and its applications in biotechnology. Crit. Rev. Biotechnol. 2001, 21, 1−25. 5497
DOI: 10.1021/acs.jafc.5b01652 J. Agric. Food Chem. 2015, 63, 5492−5498
Article
Journal of Agricultural and Food Chemistry (32) Grana, D.; Youderian, P.; Susskind, M. M. Mutations that improve the ANT promoter of Salmonella phage P22. Genetics 1985, 110, 1−16. (33) Jacob, W. F.; Santer, M.; Dahlberg, A. E. A single base change in the Shine-Dalgarno region of 16S rRNA of Escherichia coli affects translation of many proteins. Proc. Natl. Acad. Sci. U. S. A. 1987, 84, 4757−4761. (34) Calogero, R. A.; Pon, C. L.; Canonaco, M. A.; Gualerzi, C. O. Selection of the mRNA translation initiation region by Escherichia coli ribosomes. Proc. Natl. Acad. Sci. U. S. A. 1988, 85, 6427−6431. (35) Gold, L.; Pribnow, D.; Schneider, T.; Shinedling, S.; Swebillius, S. B.; Stormo, G. D. Translation initiation in prokaryotes. Annu. Rev. Microbiol. 1981, 35, 365−403. (36) Thanaraj, T. A.; Pandit, M. W. An additional ribosomal-binding site on mRNA of highly expressed genes and a bifunctional site on the colicin fragment of 16S rRNA from Escherichia coli: important determinants of efficiency of translation- initation. Nucleic Acids Res. 1989, 17, 2973−2985. (37) Kozak, M. Comparison of initiation of protein synthesis in prokaryotes, eukaryotes, and organelles. Microbiol. Rev. 1983, 47, 1− 45.
5498
DOI: 10.1021/acs.jafc.5b01652 J. Agric. Food Chem. 2015, 63, 5492−5498
