Engineering Eschericha coli for Enhanced Tyrosol Production

May 22, 2017 - Tyrosol is a phenolic compound found in olive oil and wines. The health benefits of tyrosol have attracted considerable attention. Beca...
27 downloads 3 Views 1MB Size
Download PDF
Article pubs.acs.org/JAFC

Engineering Eschericha coli for Enhanced Tyrosol Production Yuxiang Xue,†,‡ Xianzhong Chen,*,†,‡ Cui Yang,†,‡ Junzhuang Chang,†,‡ Wei Shen,† and You Fan†,‡ †

Key Laboratory of Carbohydrate Chemistry & Biotechnology, Ministry of Education, Jiangnan University, Wuxi 214122, China School of Biotechnology, Jiangnan University, Wuxi 214122, China

‡

ABSTRACT: Tyrosol is a phenolic compound found in olive oil and wines. The health benefits of tyrosol have attracted considerable attention. Because the tyrosol extraction from plants poses a major obstacle, biosynthesizing this compound using microbial hosts is of interest. In this study, the phenylpyruvate decarboxylase gene ARO10 and the aromatic amino acid aminotransferase gene ARO8 were introduced into Escherichia coli to generate two recombinant tyrosol producers. Deleting the prephenate dehydratase gene pheA and the phenylacetaldehyde dehydrogenase gene feaB improved the tyrosol production. Under the optimal fermentation conditions, a recombinant strain overexpressing ARO10 gene produced 4.15 mM tyrosol from 1% (w/v) glucose during a 48 h shake flask cultivation. Furthermore, when tyrosine was used as the substrate, the recombinant strain co-overexpressing ARO8 and ARO10 genes displayed a higher tyrosol yield, in which 8.71 mM tyrosol was produced from 10 mM tyrosine. This investigation suggests that microbial tyrosol production has application potential. KEYWORDS: tyrosol [2-(4-hydroxyphenyl) ethanol], Ehrlich pathway, metabolic engineering, whole-cell biocatalysis, Escherichia coli

■

INTRODUCTION The aromatic compound tyrosol plays an important industrial and pharmaceutical role. This compound and its derivatives have been used for the production of various organic compounds. For example, this bitter additive ingredient improves the taste of Japanese rice wine (sake).1 Moreover, tyrosol, as a possible precursor, can be used for the preparation of hydroxytyrosol, which is a vital antioxidant and plays a critical role in several aspects for human health and polymer production. In the field of medicine, tyrosol has been reported to have biologically relevant properties, including a role in the prevention of cardiovascular diseases,1 osteopenia,2 and melanin pigmentation.3 It has also been shown to have antiinflammatory activity4 and is used as an intermediate in the organic synthesis of critical medicines such as metoprolol, betaxolol, and Salidroside.5,6 In view of health benefits offered by tyrosol, several attempts have been made to produce tyrosol. Tyrosol has been found as a naturally occurring compound in olive oil and wine.7 Olive oil mill wastewater, which is a polluted byproduct of the olive oil production process, is also a potential source of tyrosol; however, the development of effective separation methods from the wastewater pose an obstacle.8 For industrial purposes, tyrosol is often synthesized chemically.9 The yields of tyrosol are low in chemical process for synthesis of tyrosol, besides problems encountered in its purification. Recently, microorganisms have been used as a host for tyrosol production through genetic engineering. The biosynthetic pathway for tyrosol production naturally includes two established pathways (Figure 1). The first pathway consists of the conversion of L-tyrosine into tyramine by tyrosine decarboxylase (TDC) and further consecutive transformation of tyramine into tyrosol by tyramine oxidase (TYO) and alcohol dehydrogenase (ADH). 10 Tyrosol can also be synthesized from L-tyrosine through the sequential action of aminotransferase, pyruvate decarboxylase, and ADHs, termed the yeast Ehrlich pathway.11,12 © 2017 American Chemical Society

In this study, a recombinant strain was constructed possessing the capacity to produce tyrosol by introducing a yeast pyruvate decarboxylase gene ARO10 into Escherichia coli BL21 (DE3). After knocking out the pheA and feaB genes in the recombinant strain above and determining optimal culture conditions of the recombinant strain, tyrosol production of 4.15 mM from 1% glucose was achieved. In addition, a whole reaction to produce tyrosol using a constructed strain was utilized, in which a yeast pyruvate decarboxylase gene ARO10 and a yeast aromatic amino acid aminotransferase gene ARO8 were cloned, and 2.40 mM from 2.8 mM tyrosine and 8.71 mM from 10 mM tyrosine were achieved, respectively.

■

MATERIALS AND METHODS

Genetic Material, Microbial Hosts, and Plasmids. The bacterial strains and plasmids used in this study are listed in Table 1. E. coli JM109 was used as host for plasmid construction. E. coli BL21(DE3) was engineered as the parental strain to produce tyrosol. All gene-deletion strains were derived from E. coli BL21(DE3) using the classical Red homologous recombination method.13 The pRSFDuet-1 expression vectors were obtained from Novagen (Darmstadt, Germany). The Duet expression vectors were designed for the coexpression of two target open reading frames (ORFs). This vector contains two multiple cloning sites (MCS), each of which is preceded by a T7-lac promoter and a ribosome binding site (RBS) (Table 1). Three plasmids involved in the Red recombinase expression system, pKD46, pKD13, and pCP20 (Table 1), which were previously stored in our lab, were used in this study. Pathway and Plasmid Construction. All PCR primers used are listed in Table 2. All restriction enzymes and DNA ligase were purchased from TaKaRa (DaLian, China). The Duet plasmid system was used to construct the tyrosol biosynthetic pathway. A pyruvate decarboxylase gene, ARO10 (GenBank: 851987),14 was amplified from Received: Revised: Accepted: Published: 4708

April 1, 2017 May 18, 2017 May 22, 2017 May 22, 2017 DOI: 10.1021/acs.jafc.7b01369 J. Agric. Food Chem. 2017, 65, 4708−4714

Article

Journal of Agricultural and Food Chemistry

Figure 1. Engineered tyrosol pathway in E. coli. ARO8, aromatic amino acid aminotransferase; ARO10, phenylpyruvate decarboxylase; TDC, tyrosine decarboxylase; TYO, tyramine oxidase; ADH, alcohol dehydrogenase; FeaB, phenylacetaldehyde dehydrogenase; PheA, chorismate mutase and prephenate dehydratase; CHA, chorismate; PP, phenylpyruvate; PHE, phenylalanine; 4HPP, 4-hydroxyphenylpyruvate; 4HPAA, 4hydroxyphenyacetaldehyde; 4HPA, 4-hydroxyphenylacetate; TYR, tyrosine. The 4-hydroxyphenylacetate competition pathway was deleted by knocking out the E. coli chromosomal gene feaB by the Red recombinase method.13 The feaB-deleting cassette was PCR amplified with primers P1 and P2 (Table 2) using pKD13 as template. The phenylalanine competition pathway was deleted by knocking out the E. coli chromosomal gene pheA (GenBank: 947081) utilizing the above method. The pheA-deleting cassette was PCR amplified with primers P3 and P4 (Table 2) using pKD13 as template. The FLP recombination target (FRT)-flanked antibiotic resistance genes used for selection were deleted by using a temperature-conditional plasmid, pCP20, expressing FLP recombinase from a thermo inducible promoter. Growth Media and Culture Conditions. The media used were LB broth medium (10 g/L tryptone, 5 g/L yeast extract,10 g/L NaCl) and M9Y minimal medium(M9Y) containing 1 × M9 minimal salts, 5 mM MgSO4, 0.1 mM CaCl2, 1% (w/v) glucose, supplemented with 0.025% (w/v) yeast extract. Furthermore, when needed, kanamycin (50 μg/mL) was supplemented to the medium. A single colony of the engineered E. coli strain harboring the recombinant plasmid was inoculated into 10 mL of liquid LB medium containing appropriate antibiotic and subsequently cultured overnight at 37 °C and 200 rpm. The culture was then diluted with 50 mL of fresh LB medium and incubated in a rotary shaking incubator at 37 °C and 200 rpm. When the culture reached between 0.6−0.8 absorbance units, measured at 600 nm, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.5 mM. The culture was incubated for a further 8−10 h at 27 °C at 200 rpm to induce recombinant protein expression. Subsequently, the cells were recovered by centrifugation, washed once, and resuspended in 50 mL of M9Y medium, and cultured at 30 °C for 48 h with shaking at 200 rpm for the extraction of compounds. Samples (1 mL) were collected at appropriate time points and analyzed by HPLC. The shake-flask experiments were conducted in triplicates. Whole-Cell Reaction. Erlenmeyer flasks (50 mL) were used in all experiments for tyrosol production. Cells were collected after induction by centrifugation at 8000g for 10 min, washed with 0.85%

Table 1. Strains and Plasmids Used in This Study plasmids and strains

relevant genotype and characteristics

pKD46 pKD13 pCP20 pRSFDUet-1

Ampr, helper plasmid Ampr, helper plasmid Ampr, helper plasmid double T7 promoters, two MCS, RSF1030 origin; Kanar pRSFDUet-1 carrying ARO10 and ARO8 pRSFDUet-1 carrying ARO10 cloning host F−ompThsdSB(rBmB) gal dcm (DE3) BL21(DE3) carrying pRDFDuet-1 BL21(DE3) carrying pRS1 BL21(DE3) carrying pRS2 E. coli BE3 ΔfeaB carrying pRS2 E. coli BE3 ΔpheAΔfeaB carrying pRS2 MATα ura3-52 trp1 leu2Δ1 his3Δ200 pep4::HIS3 prb1Δ1.6R can1 GAL (pIU211: URA3)

pRS1 pRS2 E. coli E. coli E. coli E. coli E. coli E. coli E. coli

JM109 BL21(DE3) BE1 BE2 BE3 BE4 BE5

S. cerevisiae EBY100

source or reference CGSC CGSC CGSC Invitrogen our lab this study CTCC Invitrogen this study this study this study this study this study Invitrogen

Saccharomyces cerevisiae EBY100 (Invitrogen) with the primers ARO10-F (NcoI) and ARO10-R (BamHI) (Table 2). An aromatic amino acid aminotransferase gene, ARO8 (GenBank: 852672),14 was amplified from S. cerevisiae EBY100 with the primers ARO8-F (NdeI) and ARO8-R (XhoI) (Table 2). The ARO10 gene was digested and inserted into the BamHI/NcoI sites of vector pRSFDuet-1, resulting in pRSFDuet-ARO10 (Figure 2). To construct pRSFDuet-ARO10ARO8, the ARO8 gene was introduced into NdeI/XhoI sites of vector pRSFDuet-ARO10 (Figure 2). Constructs were confirmed by enzyme digestion and DNA sequencing. A list of plasmids and strains used in this study are listed in Table 1. 4709

DOI: 10.1021/acs.jafc.7b01369 J. Agric. Food Chem. 2017, 65, 4708−4714

Article

Journal of Agricultural and Food Chemistry Table 2. Oligonucleotides Used in This Study name

oligonucleotide sequence (5′−3′)

relevant characteristic

P1 P2 P3 P4 ARO10-F ARO10-R ARO8-F ARO8-R

ATGACAGAGCCGCATGTAGCAGTATTAAGCCAGGTCCAACAGTTTCTCGAGTGTGGCTGGAGCTGCTTC TTAATACCGTACACACACCGCTTAGTTTCACACCAACCGTCCAGCCAGTATTCCGGGGATCCGTCGACC AGGCAACACTATGACATCGGAAAACCCGTTACTGGCGCTGCGAGAGAAAAGTGTGGCTGGAGCTGCTTC TCAGGTTGGATCAACAGGCACTACGTTCTCACTTGGGTAACAGCCCAATAATTCCGGGGATCCGTCGACC CATGCCATGGATGGCACCTGTTACAATTG CGGGCGCGCGGATCCCTATTTTTTATTTCTT GGAATTCCATATGATGACTTTACCTGAATCAAAAGAC CCGCTCGAGCTATTTGGA AAT ACCAAATTCTTCGT

feaB upstream feaB downstream pheA upstream pheA downstream NcoI BamHI NdeI XhoI

E. coli. It has been reported that several types of ADHs exist in E. coli,17 which are sufficient to produce tyrosol from 4HPAA. Hence, it was accessed whether tyrosol can be produced from tyrosine by expressing the S. cerevisiae ARO8 and ARO10 genes from plasmid pRS1 in E. coli BL21 (DE3). The tyrosol production pathway which was artificially constructed in E. coli is shown in Figure 1. Two recombinant plasmids were constructed (Figure 2) and transformed into E. coli BL21 (DE3), and two strains BE2 and BE3 were generated, respectively. It was observed that strain BE2 harboring ARO8 and ARO10 genes was able to produce 0.18 mM tyrosol in M9Y (Figure 3a), indicating that the host cell can potentially convert 4HPAA to tyrosol. In the yeast Ehrlich pathway, 4hydroxyphenylpyruvate, the key intermediate is derived from Ltyrosine by transamination. Similarly, this compound is a native metabolite in the L-tyrosine biosynthetic pathway in E. coli.20 Therefore, the strain BE3 expressing ARO10 gene was evaluated for its ability to produce tyrosol. It was found that the strain BE3 was able to produce 0.35 mM tyrosol without tyrosine (Figure 3b), indicating that the host cell can potentially synthesize tyrosol from glucose. These results indicated that expression of either ARO10 gene or AR08 and ARO10 genes can render E. coli BL21 (DE3) to synthesize tyrosol. Effect of Elimination of Competitive Pathways on Tyrosol Synthesis. To increase the production of tyrosol in E. coli BL21 (DE3) from glucose, it was attempted to eliminate the competitive pathways to enhanced metabolic flux toward 4hydroxyphenylpyruvate in E. coli BL21(DE3). As shown in Figure 1, phenylacetaldehyde dehydrogenase (FeaB), an enzyme encoded by the E. coli gene feaB, catalyzes the oxidation of 4HPAA to 4HPA with H2O as a substrate and NAD+ as a coenzyme. Then it was evaluated whether it was able to improve the capacity of the strain for tyrosol production from glucose to delete feaB gene. Figure 3c shows that, when deleting the gene feaB in the genome of the tyrosol-producing E. coli strain BE3, the tyrosol production of BE4 reached 0.41 mM, which was 17.1% higher than that of BE3. Thus, it was demonstrated that the gene feaB deletion blocked the oxidation of 4HPAA to 4HPA and was able to increase the tyrosol accumulation. In E. coli, chorismate is used as a precursor for the phenylalanine biosynthesis pathway, which is competitive for the tyrosine production pathway. Afterward, the competitive L-phenylalanine biosynthesis pathway was blocked out by deleting the pheA gene to intensify chorismate to the production of 4-hydroxyphenylpyruvate and L-tyrosine. Following these manipulations in the genome of the tyrosol-producing E. coli strain BE3, the strain BE5 was obtained and the yield of tyrosol was found to increase from 0.35 mM to 0.91 mM significantly (Figure 3c).

Figure 2. Profiles of the two recombinant plasmids pRS1 and pRS2 harboring genes encoding various enzymes involved in biosynthesis of tyrosol. NaCl solution twice, and resuspended in a reaction mixture (10 mL) containing tyrosine with indicated concentration, 100 mM Tris-HCl buffer (pH 7.4), 10 mM MgCl2, 2 mM NADH, 2 mM thiamine pyrophosphate, 0.2 mM pyridoxal phosphate to form a cell suspension (OD600 = 18). It was incubated in a rotary shaking incubator at 200 rpm and 30 °C for 20 h. Appropriate concentrations of surfactant (Triton X-100) was added when necessary. HPLC Analysis. For quantitative analysis of tyrosol, 10 μL supernatant from the fermented broth was analyzed using an Agilent Technologies 1260 series HPLC system (Agilent Technologies Inc., Santa Clara, CA), equipped with an octadecyl silica column (Cosmosil 5C18-MS-II column [3.0 by 150 mm] from NacalaiTesque Inc.). Buffer A (0.1% (v/v) trifluoroacetic acid) and buffer B (methanol) were used as a mobile phase.15 The methanol concentration was increased from 20% to 80% for 5 min, and this concentration was then maintained for 3 min. Compounds were eluted at 30 °C at a flow rate of 0.4 mL/min. The eluted compounds were detected by a diode array spectrophotometer (Agilent Technologies) using a wavelength of 276 nm. Under these conditions, the retention time of tyrosine and tyrosol were 3.5 and 6.02 min, respectively. Tyrosine and tyrosol used as standards were purchased from Sigma-Aldrich.

■

RESULTS Construction of the Tyrosol Biosynthetic Pathway in E. coli. It was first evaluated whether E. coli is capable of producing tyrosol from tyrosine when cultivated in M9Y media supplemented with 1 mM tyrosine. No tyrosol production was detected indicating that E. coli BL21 (DE3) did not have the ability to convert tyrosine into detectable amounts of tyrosol. Attempts were then made to construct a metabolic pathway for the production of tyrosol in E. coli BL21 (DE3). It has been reported that the tyrosol biosynthesis pathway, starting from tyrosine in S. cerevisiae, is referred to as the Ehrlich pathway.13 In this pathway (Figure 1), tyrosine is converted to tyrosol via three steps: (i) transamination of tyrosine by aminotransferase, (ii) decarboxylation of 4-hydroxyphenylpyruvate by pyruvate decarboxylase,16 and (iii) reduction of 4-hydroxyphenylacetaldehyde (4HPAA) by alcohol dehydrogenase (ADH). To produce tyrosol in E. coli, 4HPAA, a key intermediate metabolite, was needed. However, 4HPAA is not available in 4710

DOI: 10.1021/acs.jafc.7b01369 J. Agric. Food Chem. 2017, 65, 4708−4714

Article

Journal of Agricultural and Food Chemistry

Figure 4. Determination of optimal culture conditions for the strain BE5. (a) Effect of induction temperature on tyrosol titer at an OD600 of 0.6 and an IPTG concentration of 0.5 mM. (b) Effect of cell density (OD600) on tyrosol production at an IPTG concentration of 0.5 mM and a temperature of 25 °C. (c) Effect of IPTG concentration on tyrosol production at an OD600 of 0.6 and a temperature of 25 °C. Data are averages of results for three biological replicates. Error bars represent standard deviations from the means.

Figure 3. Tyrosol production by the engineered E. coli strains under different conditions. (a) Tyrosol production by strain BE2 in M9Y medium supplemented with different concentrations of tyrosine. (b) Tyrosol production by strain BE3 in M9Y medium supplemented with different concentrations of tyrosine. (c) Effect of eliminating competitive pathways on tyrosol synthesis. Data are averages of results for three biological replicates. Error bars represent standard deviations from the means.

of 0.1, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mM. The strain BE5 had highest production at an IPTG concentration of 0.2 mM (Figure 4c). As shown in Figure 4c, The tyrosol production of strain BE5 reached 4.15 mM from glucose, under their optimal culture conditions (25 °C in the induction phase, with an OD600 of 0.6−0.8 and an IPTG concentration of 0.2 mM). Determination of Whole-Cell Reaction Conditions. It is konwn that 4-hydroxyphenylpyruvate is a native metabolite in the L-tyrosine biosynthetic pathway, and this resulted in strain BE2 being constructed to produce 0.19 mM tyrosol without any tyrosine supplemented in M9Y medium.

Optimization of Tyrosol Production Process. Four different temperatures (20, 25, 28, and 30 °C) were chosen for the induction phase. The production of tyrosol was maximized at 25 °C for strain BE5 (Figure 4a). The strain BE5 was induced at OD600 values of 0.6, 0.9, 1.2, 1.5, 1.8, and 2.1. Through the gradient test described above, an OD600 of 0.6− 0.8 was adopted as representing the optimal condition for the strain BE5 (Figure 4b). IPTG was added to final concentrations 4711

DOI: 10.1021/acs.jafc.7b01369 J. Agric. Food Chem. 2017, 65, 4708−4714

Article

Journal of Agricultural and Food Chemistry Coincidently, the production of tyrosol in both strains BE2 and BE3 (Figure 3a, b) were found to increase when 1 mM tyrosine was supplemented in M9Y medium and reached 1.01 and 0.89 mM, respectively. As shown in Figure 3a and b, when using the same conditions and supplementing 2 mM tyrosine into M9Y medium, it was observed that the production of tyrosol also increased. It was reported that the dissolubility of L-tyrosine in water is only 2.8 mM (25 °C); hence, we chose 2.8 mM L-tyrosine as substrate to produce tyrosol. It was found that the strain BE2 produced 2.4 mM tyrosol in 20 h with a conversion rate of 88.2% when using 2.8 mM α-ketoglutaric acid as a cosubstrate with the cofactors (10 mM MgCl2, 2 mM NADH, 2 mM thiamine pyrophosphate, 0.2 mM pyridoxal phosphate) (Figure 5a). Under the same conditions except not adding cofactor, the production of tyrosol also reached the highest point in 20 h and yielded 2.4 mM with the same conversion rate of 88.2%. With the cofactors (10 mM MgCl2, 2 mM NADH, 2 mM thiamine pyrophosphrate, 0.2 mM pyridoxal phosphate), and using 2.8 mM tyrosine as substrate, the production of tyrosol reached 2.1 mM. In Figure 5a, during the whole cell reaction, the tyrosol production using α-ketoglutaric acid as a cosubstrate was higher than that without α-ketoglutaric acid. These results indicated that α-ketoglutaric acid as a cosubstrate was necessary to produce tyrosol in the whole-cell reaction and the endogenous cofactor of NADH was sufficient for tyrosol sythesis in E. coli BL21 (DE3) cells. Though the dissolubility of L-tyrosine in water is only 2.8 mM (25 °C), it is attempted that whether it achieved the high conversion to utilize the high titer tyrosine. In the process, the high titer tyrosine was dissolved and used gradually. Using 10 mM tyrosine and 10 mM α-ketoglutaric acid as substrates in the reaction (Figure 5b), supplemented with the above cofactors, recombinant strain BE2 yielded 8.71 mM tyrosol in 20 h with a conversion rate of 87.1%. Tyrosol production was 8.58 mM in 20 h using 10 mM of each substrate without cosubstrate ofα-ketoglutaric acid (10 mM MgCl2, 2 mM NADH, 2 mM thiamine pyrophosphate, 0.2 mM pyridoxal phosphate) resulting in a conversion rate of 85.8%. These results demonstrated that a high substrate concentration was beneficial for tyrosol production in our study, however it is necessary to evaluate tyrosol synthesis using higher concentration of tyrosine as substrate in future. For recombinant strain BE3, tyrosol titer reached up to 4.5 mM in 20 h when 10 mM tyrosine was used as substrate under the same reaction conditions (Figure 5c).

Figure 5. Determination of whole-cell reaction conditions for produce tyrosol. (a) Tyrosol synthesis by strain BE2 using 2.8 mM tyrosine as substrate under different conditions. (▼) 2.8 mM tyrosine with cofactor and 1% Triton X-100; (▲) 2.8 mM tyrosine with 1% Triton X-100; (●) 2.8 mM tyrosine and 2.8 mM α-ketoglutaric acid with 1% Triton X-100; (■) 2.8 mM tyrosine and 2.8 mM α-ketoglutaric acid with 1% Triton X-100 and cofactors. (b) Tyrosol synthesis by strain BE2 using 10 mM tyrosine as substrate under different conditions. (●) 10 mM tyrosine and 10 mM α-ketoglutaric acid with 1% Triton X-100; (■) 10 mM tyrosine and 10 mM α-ketoglutaric acid with cofactors and 1% Triton X-100. (c) Tyrosol production by strain BE3 using 10 mM tyrosine with 1% Triton X-100. Error bars represent standard deviations from the means.

■

DISCUSSION In this study, a recombinant strain possessing the ability to produce tyrosol was successfully constructed by manipulating the genome of E. coli BL21(DE3). The constructed strain was able to effectively produce 4.15 mM tyrosol from glucose using the strain BE5. In a previous study, the tyramine oxidase (TYO) gene 18 from Micrococcus luteus (accession no. AB010716) and tyrosine decarboxylase (TDC) gene19 from Papaver somniferum (accession no. U08598) were cloned into E. coli BW25113 to produce tyrosol. This constructed strain was capable of producing 0.5 mM tyrosol from 1% (w/v) glucose during a 48 h shake flask cultivation via three steps: decarboxylation, amine oxidation, and dehydrogenase.10 Subsequently, by introducing a yeast pyruvate decarboxylase gene (ARO10) into E. coli MG1655, a tyrosol producing strain was constructed. By deleting the native genes pheA and feaB, the

recombinant strain was able to produce tyrosol from 2% (w/v) glucose during a 48 h shake flask cultivation.20 The main goal of this study was to create a metabolic pathway from an intermediate metabolite to produce tyrosol in a shorter period of time for practical industrial application. In another study, a pyuvate decarboxylase gene (ipdc) was introduced into the 4712

DOI: 10.1021/acs.jafc.7b01369 J. Agric. Food Chem. 2017, 65, 4708−4714

Article

Journal of Agricultural and Food Chemistry

(3) Liu, S. H.; Pan, I. H.; Chu, I. M. Inhibitory effect of phydroxybenzyl alcohol on tyrosinase activity and melanogenesis. Biol. Pharm. Bull. 2007, 30, 1135−1139. (4) Giovannini, L.; Migliori, M.; Filippi, C.; Origlia, N.; Panichi, V.; Falchi, M.; Bertelli, A. A.; Bertelli, A. Inhibitory activity of the white wine compounds, tyrosol and caffeic acid, on lipopolysaccharideinduced tumor necrosis factor-alpha release in human peripheral blood mononuclear cells. Int. J. Tissue React. 2002, 24, 53−56. (5) Allouche, N.; Sayadi, S. Synthesis of hydroxytyrosol, 2hydroxyphenylacetic acid, and 3-hydroxyphenylacetic acid by differential conversion of tyrosol isomers using Serratia marcescens strain. J. Agric. Food Chem. 2005, 53, 6525−6530. (6) Espín, J. C.; Soler-Rivas, C.; Cantos, E.; Tomás-Barberán, F. A.; Wichers, H. J. Synthesis of the antioxidant hydroxytyrosol using tyrosinase as biocatalyst. J. Agric. Food Chem. 2001, 49, 1187−1193. (7) Di Benedetto, R.; Varì, R.; Scazzocchio, B.; Filesi, C.; Santangelo, C.; Giovannini, C.; Matarrese, P.; D’Archivio, M.; Masella, R. Tyrosol, the major extra virgin olive oil compound, restored intracellular antioxidant defences in spite of its weak antioxidative effectiveness. Nutr. Metab. Cardiovasc. Dis. 2007, 17, 535−545. (8) De Marco, E.; Savarese, M.; Paduano, A.; Sacchi, R. Characterization and fractionation of phenolic compounds extracted from olive oil mill wastewaters. Food Chem. 2007, 104, 858−867. (9) Durrwachter, J. R.; Mott, G. N.; Ramos, H., Jr.; Tafesh, A. Production of aryl ethanols. PCT WO 93/16975, 1993. (10) Satoh, Y.; Tajima, K.; Munekata, M.; Keasling, J. D.; Lee, T. S. Engineering of a tyrosol-producing pathway, utilizing simple sugar and the central metabolic tyrosine, in Escherichia coli. J. Agric. Food Chem. 2012, 60, 979−84. (11) Hazelwood, L.; Daran, J.; Van Maris, A.; Pronk, J.; Dickinson, J. The ehrlich pathway for fusel alcohol production: a century of research on Saccharomyces cerevisiae metabolism. Appl. Environ. Microbiol. 2008, 74, 2259−2266. (12) Sentheshanmuganathan, S.; Elsden, S. R. The mechanism of theformation of tyrosol by Saccharomyces cerevisiae. Biochem. J. 1958, 69, 210−218. (13) Baba, T.; Ara, T.; Hasegawa, M.; Takai, Y.; Okumura, Y.; Baba, M.; Datsenko, K. A.; Tomita, M.; Wanner, B. L.; Mori, H. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2006, 2, 2006.0008. (14) Hazelwood, L. A.; Daran, J. M.; van Maris, A. J. A.; Pronk, J. T.; Dickinson, J. R. The Ehrlich pathway for fusel alcohol production: a century of research on Saccharomyces cerevisiae metabolism. Appl. Environ. Microbiol. 2008, 74, 2259−2266. (15) Koma, D.; Yamanaka, H.; Moriyoshi, K.; Ohmoto, T.; Sakai, K. Production of Aromatic Compounds by Metabolically Engineered Escherichia coli with an Expanded Shikimate Pathway. Appl. Environ. Microb. 2012, 78, 6203−6216. (16) Vuralhan, Z.; Morais, M. A.; Tai, S. L.; Piper, M. D.; Pronk, J. T. Identification and characterization of phenylpyruvate decarboxylase genes in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 2003, 69, 4534−4541. (17) Blattner, F. R.; Plunkett, G.; Bloch, C. A.; Perna, N. T.; Burland, V.; Riley, M.; Colladovides, J.; Glasner, J. D.; Rode, C. K.; Mayhew, G. F. The Complete Genome Sequence of Escherichia coli K-12. Science 1997, 277, 1453. (18) Roh, J. H.; Wouters, J.; Depiereux, E.; Yukawa, H.; Inui, M.; Minami, H.; Suzuki, H.; Kumagai, H. Purification, cloning, and threedimensional structure prediction of Micrococcus luteus FAD-containing tyramine oxidase. Biochem. Biophys. Res. Commun. 2000, 268, 293− 297. (19) Facchini, P. J.; Luca, V. D. Differential and tissue-specific expression of a gene family for tyrosine/dopa decarboxylase in opium poppy. J. Biol. Chem. 1994, 269, 26684−26690. (20) Bai, Y. Production of salidroside in metabolically engineered Escherichia coli. Sci. Rep. 2014, 4, 6640. (21) Santos, C. N. S.; Xiao, W.; Stephanopoulos, G. Rational, combinatorial, and genomic approaches for engineering L-tyrosine production in. Proc. Natl. Acad. Sci. U. S. A. 2012, 109, 13538−13543.

genome of E. coli MG1655 overproducing tyrosine and feaB and pheA genes were deleted to generate a recombinant tyrosol producer. The resulting strain produced 8.3 mM tyrosol from 1% glucose. In our study, the main goal was to create a metabolic pathway however the tyrosine pathway was not modified. It has been reported that tyrosine-overproducing strains have already been developed.21,22 Therefore, we can use these strains to produce tyrosol from glucose in the future research. In addition, when tyrosine was incorporated into M9Y medium, the yield of tyrosol increased using the strain BE2. The phenomenon is interesting. It was never reported. In a previous study, it was found that the native E. coli BL21 (DE3) was not capable of converting tyrosine to 4-hydroxyphenylpyruvate when compared to the recombinant strain BE2. To further confirm whether the gene converting tyrosine to 4hydroxyphenylpyruvate existed in the native E. coli BL21 (DE3), the tyrB gene, encoding tyrosine aminotransferase, was deleted. To the best of our knowledge, this is the first report on the development of a whole cell reaction in E. coli for the production of tyrosol. Though the dissolubility of tyrosine in water is limited, the high titer tyrosine was dissovled and used gradually. We successfully converted 10 mM tyrosine into 8.71 mM tyrosol, achieving a conversion rate of 87.1%. The main aim of this study was to investigate conditions required for a whole cell reaction to produce tyrosol. Tyrosol is widely used as a dietary supplement and a valuable precursor compound for various industrial and pharmaceutical applications therefore making it a very attractive compound. Employing these strains for tyrosol production would produce a higher titer of tyrosol for industrial applications.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Tel: +86-510-85918122. Fax: +86-510-85918122. ORCID

Xianzhong Chen: 0000-0003-0695-3382 Notes

This article does not contain any studies with human participants or animals performed by any of the authors. The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This study was funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions, the Fundamental Research Funds for the Central Universities (JUSRP51611A, JUSRP51504), 2013AA102101-5 (863 program), and the 111 Project (No. 1112-06).

■

REFERENCES

(1) Koseki, T.; Kudo, S.; Matsuda, Y.; Ishigaki, H.; Ajiki, Y.; Muraoka, Y.; Wada, Y. Tyrosol-producing mutant yeast strain having high productivity, and method for producing fermented alcoholic beverage using the yeast. Jpn. Patent P3898652, 2007. (2) Puel, C.; Mardon, J.; Agalias, A.; Davicco, M. J.; Lebecque, P.; Mazur, A.; Horcajada, M. N.; Skaltsounis, A. L.; Coxam, V. Major phenolic compounds in olive oil modulate bone loss in an ovariectomy/inflammation experimental model. J. Agric. Food Chem. 2008, 56, 9417−9422. 4713

DOI: 10.1021/acs.jafc.7b01369 J. Agric. Food Chem. 2017, 65, 4708−4714

Article

Journal of Agricultural and Food Chemistry (22) Juminaga, D.; Baidoo, E. E.; Reddingjohanson, A. M.; Batth, T. S.; Burd, H.; Mukhopadhyay, A.; Petzold, C. J.; Keasling, J. D. Modular engineering of L-tyrosine production in Escherichia coli. Appl. Environ. Microbiol. 2012, 78, 89−98.

■

NOTE ADDED AFTER ASAP PUBLICATION This paper was published ASAP on May 20, 2017, with several incorrect GenBank codes. The corrected version reposted with the issue on June 14, 2017.

4714

DOI: 10.1021/acs.jafc.7b01369 J. Agric. Food Chem. 2017, 65, 4708−4714