Engineering Signaling Aptamers That Rely on Kinetic Rather Than

Jan 11, 2016 - During the past decade, aptasensors have largely been designed on the basis of the notion that ligand-modulated equilibration between ...
0 downloads 0 Views 4MB Size
Download PDF
Article pubs.acs.org/ac

Engineering Signaling Aptamers That Rely on Kinetic Rather Than Equilibrium Competition Yan Du,†,§ Shu Jun Zhen,†,‡,§ Bingling Li,† Michelle Byrom,† Yu Sherry Jiang,† and Andrew D. Ellington*,† †

Institute for Cellular and Molecular Biology, Center for Systems and Synthetic Biology, and Department of Chemistry, The University of Texas at Austin, Austin, Texas 78712, United States ‡ Key Laboratory of Luminescent and Real-Time Analytical Chemistry (Southwest University), Ministry of Education, College of Chemistry and Chemical Engineering, Southwest University, 400715, Chongqing, P.R. China S Supporting Information *

ABSTRACT: During the past decade, aptasensors have largely been designed on the basis of the notion that ligandmodulated equilibration between aptamer conformations could be exploited for sensing. One implementation of this strategy has been to denature the aptamer with an antisense oligonucleotide, wait for dissociation of the antisense oligonucleotide, and stabilize the folded, signaling conformer with a ligand. However, there is a large kinetic barrier associated with releasing the oligonucleotide from the aptamer to again obtain an active, binding conformation. If the length of the antisense oligonucleotide is decreased to make dissociation from the aptamer more favorable, higher background signals are observed. To improve the general methodology for developing aptasensors, we have developed a novel and robust strategy for aptasensor design in which an oligonucleotide kinetically competes with the ligand for binding rather than having to be released from a stable duplex. While the oligonucleotide can induce conformational change, it initially chooses between the aptamer and a molecular beacon (MB), a process that does not require a lengthy pre-equilibration. Using an antiricin aptamer as a starting point, we developed a “competitive” aptasensor with a measured limit of detection (LOD) of 30 nM with an optical readout and as low as 3 nM for ricin toxin A-chain (RTA) detection on an electrochemical platform.

S

signal. However, one disadvantage of this strategy is that there is a large kinetic barrier associated with the initial equilibration of the bound blocker and the unbound blocker, especially in the case of an antisense blocker that is long enough to truly denature the aptamer (Scheme 1B). Alternatively, if the length of the blocker is decreased to the point that it can readily dissociate, then much of the aptamer will fold even in the absence of the analyte, and there will be high background signal. This trade-off makes it especially difficult to design and screen blockers for most RNA aptamers, because they usually possess long sequences and complicated secondary structures, and the RNA aptamer:blocker duplex is too stable to be perturbed by the target. While the antisense displacement strategy has frequently been used for DNA aptamers,8−11 it has only worked for three RNA aptamers: those for tobramycin,12 theophylline, and thiamine pyrophosphate (TPP).13,14 To overcome the general limitations of the antisense displacement strategy, especially for RNA aptamers, we have

elected nucleic acid binding species (aptamers) have been converted to biosensors (aptasensors) by a variety of mechanisms.1−5 Aptasensor strategies can be categorized according to the mechanism of signal tranduction:3,6,7 (a) folding strategy, where aptasensors are initially unstructured but fold upon interaction with ligands; (b) quaternary structural rearrangement strategy, in which an aptamer is split into pieces that assemble in the presence of a ligand; (c) refolding strategy, in which an inactive conformation equilibrates with and is shifted to an active conformation in the presence of a ligand; (d) antisense displacement strategy,8−10 in which aptamers are denatured using an oligonucleotide in trans (i.e., a so-called blocker sequence) and again equilibrate with an active conformation (similar to the refolding strategy) when the blocker is displaced. The antisense displacement strategy is among the most general and flexible because it requires only that a blocker strand be designed and hybridized to an aptamer, as shown in Scheme 1A.3,11 After the addition of target, the equilibrium between the inactive aptamer with a bound blocker and an active aptamer with a displaced blocker shifts. The displaced blocker can then further participate in signaling, e.g., by opening a molecular beacon (MB) and turning on a fluorescent © XXXX American Chemical Society

Received: October 16, 2015 Accepted: January 10, 2016

A

DOI: 10.1021/acs.analchem.5b03930 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry Scheme 1. Conventional “Equilibration” Aptasensora

a

(A) The conformation switching is possible because the equilibrium is shifted from the inactive structure to the active structure. (B) The conformation switching is impossible because of the high binding affinity of an aptamer and a longer blocker. (C) The sequences of RA80, MB, and all the blockers (B12, B14, B16, and B20). The bold and italic bases show the portion of the blockers that bind to RA80 and MB, respectively. The underlined region shows the stem part of the MB.

Scheme 2. “Kinetic Competition” Aptasensora

a

Prebinding of a ligand to the aptamer alters the kinetic competition (rather than the equilibrium) between blocker binding to the aptamer and blocker binding to the molecular beacon. The amount of blocker available for binding to the molecular beacon will be increased when the aptamer is occupied by RTA, leading to an indirect but RTA-dependent increase in signal.

developed a new strategy that relies on kinetic competition rather than conformational equilibration (Scheme 2). We mixed an aptamer that had previously bound to its target with a blocker and a molecular beacon. To the extent that the target occupied the aptamer, the blocker failed to bind to the aptamer but, instead, bound to the molecular beacon. The kinetic competition did not work if the target and blocker were allowed to equilibrate with the aptamer in the absence of the molecular

beacon. The amount of free blocker available for interaction with the molecular beacon was inversely proportional to the amount of target that bound to an aptamer, thus allowing easy quantitation of target binding to the aptamer. As an example, we have developed an assay for the detection of ricin,15 a biological toxin that has been used as an agent of bioterrorism.16 Previously, our lab selected RNA aptamers that could specifically recognize the ricin toxin A-chain (RTA) with B

DOI: 10.1021/acs.analchem.5b03930 Anal. Chem. XXXX, XXX, XXX−XXX

Article

C

FAM Thio C6 GATAATACGACTCACTATAGGGAATGGATCCACATCTACGAATTCAGGGGACGTAGCAATG AAGCTTCGTCAAGTCTGCAGTGAACCCAGCATCTCAGTCATTGCTACGTCCCCTGAATTC GATAATACGACTCACTATAGGGAATGGATC AAGCTTCGTCAAGTCTGCAGTG GGGAAUGGAUCCACAUCUACGAAUUCAGGGGACGUAGCAAUGACUGAGAUGCUGGGUUCACUGCAGACUUGACGAAGCUU CAGTCATTGCTA CTCAGTCATTGCTA ATCTCAGTCATTGCTA CAGCATCTCAGTCATTGCTA CAGCATCTCAGTCATTGCTA GCCTAGCAATGACTGAGATCTAGGC GCCTAGCAATGACTGAGATCTAGGC RA80 template part 1 RA80 template part 2 forward primer reverse primer RA80 B12 B14 B16 B20 Mblue-B20 MB HS-MB

Table 1. Sequence of Oligonucleotides Used

EXPERIMENTAL SECTION Materials. DNA primers, the molecular beacon (MB), and blockers (B12, B14, B16, and B20, where the number represents the number of base pairs of each blocker) were ordered from Integrated DNA Technology (Coralville, IA, USA). The methylene blue-labeled blocker B20 (Mblue-B20) was ordered from Biosearch Technologies (Novato, CA, USA). Oligonucleotide sequences are summarized in Table 1. Commercially available reagents included ricin toxin A-chain (RTA) (Vector Laboratories, Burlingame, CA, USA), bovine serum albumin (BSA) (Sigma-Aldrich, St. Louis, MO, USA), and purified Recombinant Human IgG (R&D Systems, Minneapolis, MN, USA). Wild-type T7 RNA polymerase enzyme was produced by our lab.18 The Ribonucleotide Solution Set (NTP) and the Deoxynucleotide (dNTP) Solution Mix were purchased from New England BioLabs Inc. (Ipswich, MA, USA). Human serum was obtained from Sigma-Aldrich (St. Louis, MO, USA). To collect human saliva, a 1 mL sterile syringe (BD, Franklin Lakes, NJ) with no needle was inserted under the tongue. Saliva was used immediately following collection. All other solvents and chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) and used without further purification. All DNA samples and RTA were dissolved in a phosphate-buffered saline buffer (10 mM PBS, 5 mM MgCl2, pH 7.4) and stored at 4 °C before use. Fluorescent and Electrical Readouts. Real-time fluorescence measurement was performed on a TECAN Safire plate reader (Tecan US, Inc., Morrisville, NC, USA). Square wave voltammetry (SWV) was performed with a model CH Instrument 660E electrochemical workstation (CH Instruments, Inc., Austin, TX, USA). A conventional three-electrode system was used with an Au electrode (1.2 mm in diameter) as the working electrode, an Ag/AgCl electrode as the reference electrode, and a platinum wire as the counter electrode. The measurements were made at an increment potential of 4 mV, an amplitude of 25 mV, a frequency of 50 Hz, and a voltage range of −0.4 to 0 V. All measurements were carried out at room temperature (ca. 25 °C). Confirmation of Hybridization. Hybridization reactions were developed on a 16% native polyacrylamide gel. A 20 μL aliquot of the hybridization solution (450 nM RA80, 300 nM blocker) was mixed with 5 μL of Gel Loading Dye (6×) (50% glycerol spiked with the dye Orange G) and loaded on the polyacrylamide gel. The gel was electrophoresed at 300 V at room temperature, followed by SYBR Gold staining. Bands were observed and quantitated using a Storm Scanner 840 (GE Healthcare Life Sciences, Pittsburgh, PA, USA). Synthesis of 80-mer RTA Aptamers (RA80). The RA80 sequence used was: 5′-GGGAAUGGAUCCACAUCUACGAAUUCAGGGGACGUAGCAAUGACUGAGAUGCUGGGUUCACUGCAGACUUGACGAAGCUU-3′. RA80 ssDNA templates (Parts 1 and 2, Table 1) were amplified by polymerase

sequence 5′−3′

■

name

5′ modification

3′ modification

high affinity,17 but adaptation of those aptamers to function as biosensors has generally proven difficult, in part because of the stability of the RNA structure. We achieved excellent sensitivity (with a limit of detection (LOD) of 30 nM by fluorescence and 3 nM by electrochemistry) and specificity, even in the presence of interferents such as 2.5% salt, 2.5% sugar, 10% human serum, and 10% human saliva. Overall, the kinetic competition strategy we describe is actually easier than the widely used antisense displacement strategy, as it does not even require the hybridization of the blocker to the aptamer.

Methylene Blue Iowa Black FQ

Analytical Chemistry

DOI: 10.1021/acs.analchem.5b03930 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

absence of the analyte, and there will be high background signal (as determined by native gel electrophoresis; Figure S1).19,20 As a proof of this biophysically obvious statement, we initially attempted to design signaling aptamers for the biothreat agent ricin toxin A-chain (RTA). An anti-ricin RNA aptamer17 RA80 was denatured using a complementary oligonucleotide. Equilibrium displacement of the oligonucleotide at equilibrium by ricin would in turn lead to the oligonucleotide activating a molecular beacon and thus to the production of a fluorescence signal (Scheme 1A). Such a displacement strategy has previously been used.8,10,11 While blocker oligonucleotides have previously been used with DNA aptamers, their use with RNA aptamers has been less extensive. Initially, four blockers (B20, B16, B14, and B12, the number represents the number of base pairs formed) were designed (Scheme 1C). While all of the blockers can activate the same MB,9 B14 and B12 formed fewer base-pairs with the MB (Scheme 1C) and ultimately showed a lower efficiency of binding to the molecular beacon. The value (FRA80:B+MB − FMB)/(FB+MB − FMB) was used to examine the ricin-dependent activation of the conformationswitching aptamer (Figure 1). Here, FMB refers to the

chain reaction to make dsDNA, which was then transcribed using the wild-type T7 RNA polymerase enzyme to make RNA aptamer constructs. Aptamer constructs were then gel purified using an 8% denaturing polyacrylamide gel, eluted by 0.3 M NaAc (pH 4.5), and precipitated by ethanol. The RNA pellet was dissolved in 10 mM PBS and 5 mM MgCl2 for further use. Sensing Protocol. For the “equilibration” strategy, a 20 μL mixture of 450 nM RA80 and 300 nM blocker B (B12, B14, B16, or B20) was heated to 75 °C for 3 min and then cooled slowly to 25 °C at a rate of 0.1 °C/s. Varying concentrations (from 0 to 12 μM) of 10 μL of RTA were added to the mixture and incubated at 37 °C for 1 h. For the “kinetic competition” strategy, a 20 μL mixture of 450 nM RA80 and varying concentrations (from 0 to 6 μM) of RTA were incubated at 37 °C for 45 min; then, 10 μL of 600 nM B (B16 or B20) was added to the mixture and immediately measured. Real-Time Fluorescence Measurement. Ten μL of 900 nM MB was added into 40 μL of the reaction mixtures above; 18 μL aliquots were added to different wells of a 384-well plate, which were immediately transferred to a TECAN Safire plate reader for fluorescence measurements at 25 °C. All the reagents were stored in 10 mM PBS and 5 mM MgCl2 supplemented with 1 mM (dT)21 to prevent loss of fluorescence due to plastic adsorption of oligonucleotides and protein. Electrochemical Measurement. The electrochemical sensing platform was prepared by placing 10 μL of freshly cleaved thiol-tagged MB (HS-MB, 500 nM) on a cleaned Au electrode and then covering the end of the electrode with a plastic cap to prevent evaporation. The assembly was kept for 12 h at room temperature in the dark and then was rinsed several times with PBS buffer. The interface was then covered with 5 μL of 1 mM 6-mercaptohexanol (MCH) in PBS and kept at room temperature for 1 h. After rinsing with PBS buffer, the sensing platform was stored in PBS for further experimental measurements. Initial SWV signals from the methylene blue (Mblue) reporter on blocker B20 (Mblue-B20) were measured in PBS. Signals were taken after 1 h of incubation with 15 μL aliquots of RA80 (300 nM), RTA with different concentrations (from 0 to 3 μM), and Mblue-B20 (200 nM). Note that the mixtures of RA80 and RTA were first incubated at 37 °C for 45 min before Mblue-B20 was added to the mixture and transferred to the electrode interface immediately. To detect the presence of RTA in samples containing interferents, 1.0 μM RTA was spiked into 2.5% sugar and 1.5 μM RTA was spiked into 2.5% salt, 10% human serum, and 10% human saliva.

Figure 1. Illustration of the “equilibration” strategy for RTA detection using B20, B16, B14, and B12. The bar graphs were recorded by monitoring the real-time fluorescence signal at 7 h. Fluorescence background and the response to RTA were calculated using the equation (FRA80:B+MB − FMB)/(FB+MB − FMB), where FMB refers to the fluorescence of the MB alone; FB+MB refers to the full fluorescence of the MB in the presence of 1.5-fold molar excess of blocker; FRA80:B+MB refers to the fluorescence of the molecular beacon in the presence of the aptamer:blocker complex, with or without RTA. The error bars represent the standard deviation (SD) for two individual measurements. Concentrations of reagents were RA80, 300 nM; MB, 300 nM; B (B20, B16, B14 or B12), 200 nM; and RTA, 1500 nM.

■

RESULTS AND DISCUSSION Signaling with Conformation-Switching Aptamers. Conformation-switching aptamers have been described but, for the most part, rely upon modulating the equilibrium between a folded (but inactive) aptamer and its active, folded conformation, with a concomitant change in signaling (Scheme 1A).3,11 Upon addition of target, the equilibrium binding reaction between the aptamer and the blocker is altered, leading to more free blocker that can signal, for example, via binding to a molecular beacon. However, one disadvantage of this strategy is that the signaling reaction must come to equilibrium. Given the very high affinities that append to aptamer:blocker duplexes (Scheme 1B), especially for RNA aptamers, off rates and equilibration could be much slower, limiting the utility of the sensors.11,19 Alternatively, if the length of an antisense oligonucleotide is decreased to the point that it can readily dissociate, then much of the aptamer will fold even in the

background fluorescence of the MB, while FB+MB refers to the full fluorescence of the MB in the presence of 1.5-fold molar excess of blocker. FRA80:B+MB refers to the fluorescence of the molecular beacon in the presence of the aptamer:blocker complex, with or without RTA. As has previously been observed,19,20 there is a trade-off between activation and background, with the shortest blocker (B12) showing some activation of the MB in the presence of ricin, but also much higher background in the absence of ricin. A 2-fold increase in signal was observed with B12 when 1500 nM ricin was added, and a concentration course gave a calculated LOD of ca. 120 nM (Figure S2). While we were able to design a conformationswitching aptamer sensor, the designs were inherently limited by the trade-off between signaling and background. This D

DOI: 10.1021/acs.analchem.5b03930 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

Figure 2. Kinetic experiments demonstrate system equilibrium using different length blockers, B16 (A) or B20 (B), using a real-time fluorescent readout. Black, RA80:B duplex mixed with MB; blue, B mixed with MB; cyan, MB:B duplex mixed with RA80; red, RA80, B and MB mixed together. Concentrations: RA80, 300 nM; MB, 300 nM; B16 or B20, 200 nM.

Figure 3. Illustration of the sensitivity of the “kinetic competition” strategy. (A) Real-time fluorescent measurements for different concentrations of RTA. (B) Dose−response curve for the RTA was determined using the fluorescence signal at 60 min. ΔF = F − F0 was used for evaluating the fluorescence response to RTA. F0 refers to the initial background response in the absence of target. F refers to the response in the presence of target. Inset: dose−response for RTA concentrations from 0 to 1500 nM. For this range, the correlation coefficient (R2) was 0.997 and the LOD (3σ) was calculated to be 30 nM. The error bars represent the SD for two individual measurements. Concentrations: RA80, 300 nM; MB, 300 nM; B20, 200 nM.

limitation was particularly acute with RNA-based aptamers, since the blocker strands bind much more tightly than is the case with DNA aptamers. For example, even a two base-pair extension of the blocker led to loss of sensor activity (or, conversely, a two base-pair reduction of the blocker greatly increased background). These results imply that the opportunities for tuning signaling with this mechanism are very limited. Signaling with Kinetic Competitive Aptamer Biosensors. We decided to see if the strength of antisense could be used to develop a new mechanism for aptamer biosensors. Rather than requiring that the antisense blocker be displaced by ligand, we have allowed the ligand to compete with the blocker for binding to the aptamer (Scheme 2). Prebinding of a ligand to the aptamer alters the kinetic (rather than equilibrium) competition between blocker binding to the aptamer and blocker binding to the molecular beacon. In the presence of ligand, the folded anti-ricin aptamer interacts with its RTA target to form a RA80:RTA complex prior to the simultaneous addition of the molecular beacon and blocker. The blocker (B20 or B16) can bind either to the remaining free RA80 or to the molecular beacon. The amount of blocker available for binding to the molecular beacon will be increased when the aptamer is occupied by RTA, leading to an indirect but RTA-dependent increase in signal. In other words, the ligand (RTA) is in essence a competitor of the blocker for the aptamer, and the proportion of the active, ligand-binding

conformation of the aptamer is ultimately read out via the molecular beacon. In order to determine whether this mechanism would be viable, we first had to mechanistically dissect the different steps and competitions that would occur using fluorescence measurements, since real-time monitoring of fluorescent signals could be readily carried out with multiple samples. We first carried out competitions in the absence of ricin, between blockers (B16 and B20) that both fully activated the molecular beacon and fully inactivated the aptamer. Various combinations of reagents were mixed in different orders, and the development of a fluorescent signal was observed as a function of time (Figure 2 and Scheme S1). If the aptamer is prehybridized to the blocker, the molecular beacon is not activated, as expected (black curves in Figure 2 and Scheme S1A). If the molecular beacon is prehybridized to the blocker, it is fully activated (blue curves in Figure 2) and no inactivation takes places upon addition of the aptamer (cyan curves in Figure 2 and Scheme S1B). Thus, the first “receptor” to see the blocker completely removes the blocker from any further reactions. Interestingly, when the aptamer and molecular beacon “receptors” are added to the blocker at the same time (red curves in Figure 2 and Scheme S1C), there is an intermediate signal, potentially indicating that some blocker interacted with the aptamer and some blocker interacted with the molecular beacon. This suggests that the RA80:B (B20 or B16) duplex and MB:B (B20 or B16) duplex likely have comparable binding affinities or on E

DOI: 10.1021/acs.analchem.5b03930 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

Figure 4. Selectivity test of the “kinetic competition” strategy. (A) Real-time fluorescent detection for 500 nM RTA, 650 nM human IgG, and 3 μM BSA. (B) Fluorescent responses were recorded as the fluorescence signal at 60 min. The error bars represent the SD of two individual measurements. Concentrations of reagents were 300 nM RA80, 300 nM MB, and 200 nM B20.

from Figure 3B, the RTA concentrations between 50 and 2500 nM can be readily measured. The linear relationship between ΔF and the RTA concentration from 0 to 1500 nM (correlation coefficient, R2 = 0.997) yields a detection limit (LOD; 3σ) of 30 nM. To demonstrate that the competition assay format was selective, control experiments were carried out with human IgG and BSA. In the presence of 500 nM RTA, increased fluorescence signal was observed (Figure 4) while 650 nM human IgG or 3000 nM BSA produced florescence signals similar to the buffer solution. Electrochemical Detection of Ricin. To illustrate the generality of the kinetic competitive assay strategy, it was adapted to electrochemical detection, a modality known for simplicity, high sensitivity, and low cost.22,23 As shown in Scheme 3, a 5′ thiol-modified hairpin (HS-MB) with the same

rates. When we determined the equilibrium dissociation constants (Kd) for RA80:B (B20 or B16) and MB:B (B20 or B16) (Table S1), we find that the Kd values are within an order of magnitude of one another. If the blocker is choosing between the aptamer and the molecular beacon for essentially irreversible binding, then an aptamer ligand (RTA) can potentially perturb this competition by blocking initial binding of the blocker to the aptamer. To determine if this was true, we mixed aptamer, RTA, and blocker and then waited for varying periods of time to add the molecular beacon. Only when the molecular beacon is added at the same time as the other participants in the competition reaction is a robust signal observed (Figure S3). Thus, there is an initial kinetic competition for binding to the aptamer by RTA and the blocker and that in turn impacts the kinetic competition for binding by the blocker to either the aptamer or the MB. As RTA dissociates from (or is displaced from) the aptamer, the blocker forms a complex with the aptamer that does not allow rebinding of RTA (Figure 1). We believe this kinetic competition mechanism is different from previously explored equilibration mechanisms, which return the same signal irrespective of the order of addition.21 The difference may be due in part to the different lengths of the blockers; following binding, the longer blockers employed herein are less likely to dissociate or equilibrate within the timeframe of the assay. Quantitative Detection of Ricin. Since B16 gives higher background than B20 (black curve in Figure S4), B20 was used in dose−response experiments with RTA. Some 300 nM of RA80 and a series of RTA solutions were mixed and incubated at 37 °C for 45 min (the optimized incubation time; see Figure S5). Then, 300 nM MB and 200 nM B20 were added into the mixture simultaneously (all concentrations listed so far are the final ones in the eventual reaction mixture). The reaction mixtures (18 μL aliquots) were added to different wells of a 384-well plate, which was immediately transferred to a TECAN Safire plate reader for fluorescence measurements. As shown in Figure 3A, in the presence of increasing concentrations of RTA, more B20 will be available to open the MB. This will lead to generation of fluorescent signals in a dose-dependent manner. The fluorescence intensity increases with the increased incubation time and reaches a plateau at about 60 min. The end-point changes in fluorescence intensity could be calculated as ΔF = F − F0, where F0 and F are the fluorescence intensity in the absence and presence of RTA, respectively. As can be seen

Scheme 3. Scheme of the Electrochemical Readout for RTA Detection by Using the “Kinetic Competition” Strategy

sequence as the MB was immobilized on a hand-polished gold disk electrode. RA80 and a series of RTA solutions were mixed and incubated at 37 °C for 45 min to form the RA80:RTA complex. Then, Mblue-B20 was added to the mixture, and 15 μL of this final mixture was transferred to the HS-MB modified electrode immediately and incubated for 1 h. The SWV signals from the Mblue-B20 were measured in PBS. In the presence of the target RTA, more Mblue-B20 initially remains in solution, which in turn allowed the blocker to interact with the MB on the electrode surface, producing an increased electrochemical signal. The dose−response curve of the SWV signals varied in a linear fashion with the RTA concentrations from 10 to 2000 nM (correlation coefficient, R2 = 0.985) with a LOD (3σ) calculated to be 3 nM (Figure 5A). F

DOI: 10.1021/acs.analchem.5b03930 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry

Figure 5. Sensitivity and selectivity for the “kinetic competition” strategy using electrochemical detection. (A) Sensitivity. The peak currents for the SWV response to RTA at different concentrations. Inset: dose−response for RTA concentrations from 10 to 2000 nM (correlation coefficient, R2 = 0.985) with a LOD (3σ) calculated to be 3 nM. The error bars represent SD of measurements based on three independent experiments. (B) Selectivity. Comparison of the SWV responses for no protein (NC, negative control), 3000 nM BSA, and 1000 nM RTA in PBS buffer. Concentrations: RA80, 300 nM; Mblue-B20, 200 nM.

Figure 6. Detection of RTA in the presence of interferents. (A) Comparison of the SWV responses for NC, 3000 nM BSA, and 1500 nM RTA in PBS buffer and in 2.5% salt solution. (B) Comparison of the SWV responses for NC, 3000 nM BSA, and 1000 nM RTA in PBS buffer and in 2.5% sugar solution. (C) Comparison of the SWV responses for NC, 3000 nM BSA, and 1500 nM RTA in PBS buffer and in 10% human serum. (D) Comparison of the SWV responses for NC, 3000 nM BSA, and 1500 nM RTA in PBS buffer and in 10% human saliva. Concentrations: RA80, 300 nM; Mblue-B20, 200 nM.

■

As before, BSA did not interfere with the kinetic competition assay (Figure 5B). In order to further expand the range of interferents to “white powders” that might be used to mimic a ricin attack or mask a true ricin sample,24 salt and sugar solutions were also tested. It may also prove useful to detect ricin in humans following exposure, and we therefore assessed detection in both serum and saliva.25 A SWV signal could be detected even in the presence of 2.5% salt (Figure 6A), 2.5% sugar (Figure 6B), 10% human serum (Figure 6C), or 10% human saliva (Figure 6D), although signals were smaller than those seen in PBS.

CONCLUSIONS

Using an anti-ricin aptamer as a starting point, we have developed a general and simple “kinetic competition” aptasensor strategy. This is the first aptasensor to rely on ligand-dependent changes in the kinetics of binding and folding, rather than on ligand-dependent conformational equilibration. In our new model for sensing, kinetic competition between two oligonucleotide receptors, the aptamer and a molecular beacon, for an antisense blocker is significantly altered by prebinding the ligand to the aptamer. G

DOI: 10.1021/acs.analchem.5b03930 Anal. Chem. XXXX, XXX, XXX−XXX

Article

Analytical Chemistry By measuring the fluorescence intensity of the molecular beacon, a LOD of 30 nM was achieved. The competition could be readily reformatted for other readouts. When an electrochemical sensors was used, the kinetic competition strategy gave a LOD as low as 3 nM for RTA detection on an electrochemical platform, comparable with other RNA aptamerbased strategies for RTA detection on a surface, such as microarrays (0.5 nM),26 beads (10 nM),27 and nanopores (2.8 nM)28 surfaces. One great advantage of the kinetic competition strategy (and many equilibrium-based aptasensors8,14,21) is that it is “signal on”: the more aptamer that is bound to ricin results in more of the molecular beacon being activated by blocker. Other advantages include the simplicity of constructing the reagents for the competition, since aptamer modifications are not necessary and prefabricated molecular beacons can be used, and the simplicity of modulating the competition itself, as the overlap between the aptamer, blocker, and molecular beacon sequences can be readily manipulated. As we have already seen, the modular nature of the components also makes it possible to adapt this sensing strategy to different sensor platforms, with comparable results.

■

(6) Han, K.; Liang, Z. Q.; Zhou, N. D. Sensors 2010, 10, 4541−4557. (7) Li, B. L.; Ellington, A. D. Conjugates and Sensors, RSC Biomolecular Sciences Series 2012, 211−241. (8) Nutiu, R.; Li, Y. F. J. Am. Chem. Soc. 2003, 125, 4771−4778. (9) Nutiu, R.; Li, Y. F. Chem. - Eur. J. 2004, 10, 1868−1876. (10) Li, D.; Song, S. P.; Fan, C. H. Acc. Chem. Res. 2010, 43, 631− 641. (11) Lau, P. S.; Li, Y. F. In Biosensors Based on Aptamers and Enzymes; Gu, M. B., Kim, H. S., Eds.; Springer: Heidelberg, 2014; pp 69−92. (12) Vandenengel, J. E.; Morse, D. P. Biochem. Biophys. Res. Commun. 2009, 378, 51−56. (13) Carrasquilla, C.; Lau, P. S.; Li, Y. F.; Brennan, J. D. J. Am. Chem. Soc. 2012, 134, 10998−11005. (14) Lau, P. S.; Coombes, B. K.; Li, Y. F. Angew. Chem., Int. Ed. 2010, 49, 7938−7942. (15) Li, S. S. L.; Wei, C. H.; Lin, J. Y.; Tung, T. C. Biochem. Biophys. Res. Commun. 1975, 65, 1191−1195. (16) Rainey, G. J. A.; Young, J. A. T. Nat. Rev. Microbiol. 2004, 2, 721−726. (17) Hesselberth, J. R.; Miller, D.; Robertus, J.; Ellington, A. D. J. Biol. Chem. 2000, 275, 4937−4942. (18) Chelliserrykattil, J.; Ellington, A. D. Nat. Biotechnol. 2004, 22, 1155−1160. (19) Hall, B.; Cater, S.; Levy, M.; Ellington, A. D. Biotechnol. Bioeng. 2009, 103, 1049−1059. (20) Nutiu, R.; Li, Y. F. Methods 2005, 37, 16−25. (21) Nutiu, R.; Li, Y. F. Angew. Chem., Int. Ed. 2005, 44, 1061−1065. (22) Hianik, T.; Wang, J. Electroanalysis 2009, 21, 1223−1235. (23) Miranda-Castro, R.; de-los-Santos-Alvarez, N.; Lobo-Castanon, M. J.; Miranda-Ordieres, A. J.; Tunon-Blanco, P. Electroanalysis 2009, 21, 2077−2090. (24) Hodge, D. R.; Prentice, K. W.; Ramage, J. G.; Prezioso, S.; Gauthier, C.; Swanson, T.; Hastings, R.; Basavanna, U.; Datta, S.; Sharma, S. K.; Garber, E. A. E.; Staab, A.; Pettit, D.; Drumgoole, R.; Swaney, E.; Estacio, P. L.; Elder, I. A.; Kovacs, G.; Morse, B. S.; Kellogg, R. B.; Stanker, L.; Morse, S. A.; Pillai, S. P. Biosecur Bioterror. 2013, 11, 237−250. (25) Kalb, S. R.; Barr, J. R. Anal. Chem. 2009, 81, 2037−2042. (26) Cho, E. J.; Collett, J. R.; Szafranska, A. E.; Ellington, A. D. Anal. Chim. Acta 2006, 564, 82−90. (27) Kirby, R.; Cho, E. J.; Gehrke, B.; Bayer, T.; Park, Y. S.; Neikirk, D. P.; McDevitt, J. T.; Ellington, A. D. Anal. Chem. 2004, 76, 4066− 4075. (28) Ding, S.; Gao, C.; Gu, L.-Q. Anal. Chem. 2009, 81, 6649−6655.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.analchem.5b03930. Gel electrophoresis after hybridization of RA80 with different blockers; dose-response for the “equilibration” strategy; different schemes for competition in the absence of RTA; real-time fluorescent curves; effect of preincubation of RTA and aptamer on fluorescence signal response (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*Tel: +512 471 6445. Fax: +512 471 7014. E-mail: andy. [email protected]. Author Contributions §

Y.D. and S.J.Z. contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the Defense Threat Reduction Agency (HDTRA-1-13-1-003); a National Security Science and Engineering Faculty Fellowsship (FA9550-10-1-0169); the Welch Foundation (F-1654); and the Cancer Prevention and Research Institute of Texas (RP140315). The content is solely the responsibility of the authors and does not necessarily represent the official views of the sponsors.

■

REFERENCES

(1) Lim, Y. C.; Kouzani, A. Z.; Duan, W. J. Biomed. Nanotechnol. 2010, 6, 93−105. (2) Liu, J. W.; Cao, Z. H.; Lu, Y. Chem. Rev. 2009, 109, 1948−1998. (3) Cho, E. J.; Lee, J. W.; Ellington, A. D. Annu. Rev. Anal. Chem. 2009, 2, 241−264. (4) Du, Y.; Li, B. L.; Wang, E. K. Acc. Chem. Res. 2013, 46, 203−213. (5) Mairal, T.; Ozalp, V. C.; Sanchez, P. L.; Mir, M.; Katakis, I.; O’Sullivan, C. K. Anal. Bioanal. Chem. 2008, 390, 989−1007. H

DOI: 10.1021/acs.analchem.5b03930 Anal. Chem. XXXX, XXX, XXX−XXX