Article pubs.acs.org/EF
Enhanced 1‑Butanol Production in Engineered Klebsiella pneumoniae by NADH Regeneration Miaomiao Wang, Lijuan Hu, Lihai Fan, and Tianwei Tan* National Energy R&D Center for Biorefinery, Beijing Key Laboratory of Bioprocess, Beijing University of Chemical Technology, Beijing 100029, People’s Republic of China ABSTRACT: 1-Butanol, as a next-generation biofuel, is an important target product of biorefinery research. With the introduction of the CoA-dependent pathway or Ehrlich pathway, many engineered strains have been developed to produce 1butanol, although cofactor imbalance occurred in engineered strains by the introduction of the 1-butanol synthesis pathway. Several studies have been performed to regenerate NADH by overexpressing NAD+-dependent enzymes. However, the significant role of cofactor regeneration in 1-butanol production and the transcription level of the target genes have seldom been studied. The 1-butanol producer, recombinant Klebsiella pneumoniae (KLA), was constructed by overexpressing the genes kivd, leuABCD, and adhE1 under the control of tac promoter in this study, and several NADH regeneration strategies were adopted to solve the problem of NADH imbalance, including the introduction of NAD+-dependent enzymes (formate dehydrogenase, pyridine nucleotide transhydrogenase, and glucose dehydrogenase) or elimination of the NADH competition pathway (1,3propanediol synthesis). The resultant NADH/NAD+ ratio, 1-butanol production, and transcription levels have been significantly affected. In comparison to the wild-type strain, the NADH/NAD+ ratio in the reengineered strains was increased by 78−135%, and the transcript levels of target genes have been obviously interfered. Moreover, the resultant 1-butanol titer was increased by 83−114% in comparison to KLA.
1. INTRODUCTION Biobutanol produced from various renewable resources is considered a better alternative fuel than bioethanol because of its higher energy density and higher hydrophobicity.1 1-Butanol has been produced by introducing the CoA-dependent 1butanol synthesis pathway or Ehrlich pathway into various hosts.1−5 In both of the two pathways, NADH/NADPH is the indispensable part and the introduced NADH-requiring pathway will lead to the imbalance of the intracellular cofactor.6,7 Although the cofactor can be added to the reaction system, it is expensive and stoichiometric additions are not economically feasible.7 This problem could be solved by introducing NADH regeneration systems.7 Several enzymes had previously been used for cofactor regeneration. The NAD+-dependent formate dehydrogenase gene ( fdh1) from Candida boidinii8 was overexpressed in Escherichia coli to improve the succinate productivity by increasing the NADH availability. The soluble pyridine nucleotide transhydrogenase (sth) from Pseudomonas fluorescens,9 an enzyme that can convert NADPH to NADH, was overexpressed in E. coli for hydromorphone production. Glycerol dehydrogenase from Klebsiella pneumoniae10 has been expressed and tested for glycerol metabolism and 2,3butanediol production in K. pneumoniae. Glycerol-3-phosphate dehydrogenase (gpd1) from Saccharomyces cerevisiae11 was expressed in K. pneumoniae to provide NAD+ for enhancing 3-hydroxypropionic acid production. Glucose dehydrogenase (gdh)12 and glucose-6-phosphate dehydrogenase (g6pdh)7 consume glucose for NADH regeneration. In all of these studies, the intracellular cofactor levels have been improved significantly. Since the last century, K. pneumoniae has been studied extensively because of its capacity to metabolize glycerol and its © 2015 American Chemical Society
similar genetic background to E. coli. Although it is a pathogenic microorganism, research on the production of important chemicals, such as 1,3-propanediol,8 3-hydroxypropionic acid,1113 and 2-butanol,14 is progressing. In this study, K. pneumoniae has been engineered for 1-butanol biosynthesis and two distinct kinds of NADH regeneration systems were adopted in this 1-butanol producer. Detailed analysis of the cell density, glycerol consumption, product redistribution, and expression levels of the target genes comprehensively assessed the efficiency of the engineered NADH regeneration systems. Moreover, this study revealed the significant role of cofactors in 1-butanol production and the transcription processes of the target genes.
2. EXPERIMENTAL SECTION 2.1. Reagents. Restriction enzymes and ligase were obtained from New England Biolabs (Ipswich, MA). Polymerase and other enzymes are obtained from TAKARA (Dalian, China). The kits used for genomic DNA isolation, plasmid extraction, and gene retrieval were purchased from Omega Bio-Tek (Norcross, GA). The DNA recovery kit was purchased from Biomed (Beijing, China). The kit used for NAD+/NADH quantitation was purchased from COMIN (Suzhou, China). The total RNA extraction kit, QuantScript RT kit, and SuperReal PreMix Plus (SYBR Green) kit used for real time polymerase chain reaction (RT-PCR) were purchased from Tiangen (Beijing, China). All other chemicals used in this study were of analytical grade or chromatographic grade obtained from Beijing Chemical Company (Beijing, China). 2.2. Bacterial Strains. The strains, plasmids, and primers used in this study are listed in Table 1. Received: January 4, 2015 Revised: February 9, 2015 Published: February 27, 2015 1823
DOI: 10.1021/acs.energyfuels.5b00009 Energy Fuels 2015, 29, 1823−1829
Article
Energy & Fuels Table 1. Strains, Plasmids, and Primers Used in This Study strain, plasmid, or primer E. coli TOP10 K. pneumoniae 13 Kp-pk-TBB Kp-pk-kivd KLA KLAF KLAU KLAG KLAR pET28a pET-Ptac pET-Ptac-K pET-Ptac-KL pET-Ptac-A pET-Ptac-KLA pACYC-Duet pACYC-pk pACYC-fdh pACYC-gdh pACYC-udh pACYC-gdrf12-dhaB123-dhaT kivd-F (BamH I) kivd-R (Sac I) leuABCD-F (Hind III) leuABCD-R (Xho I) adhE1-F (EcoR I) adhE1-R (Xho I) Ptac-F (Xho I) fdh-F (BamH I) fdh-R (Xho I) gdh-F (BamH I) gdh-R (Xho I) udh-F(BamH I) udh-R (Xho I) qPCR-16S-F qPCR-16S-R qPCR-kivd-F qPCR-kivd-R qPCR-adhE1-F qPCR-adhE1-R qPCR-leu-F qPCR-leu-R
genotype or sequencea Strains applied for harvesting plasmid wild type (screened from K. pneumoniae KCTC2242) K. pneumoniae 13, pET-pk-ter-bdhB-bdhA K. pneumoniae 13, pET-pk-kivd K. pneumoniae 13, pET-Ptac-KLA K. pneumoniae 13, pET-Ptac-KLA, pACYC-fdh K. pneumoniae 13, pET-Ptac-KLA, pACYC-udh K. pneumoniae 13, pET-Ptac-KLA, pACYC-gdh K. pneumoniae 13, pET-Ptac-KLA, pACYC-gdrf12-dhaB123-dhaT Plasmids pBR322 ori, Kanr pBR322 ori, Kanr, tac promoter from pET-Ptac, Ptac::kivd from pET-Ptac, Ptac::kivd-leuABCD(KP) from pET-Ptac, Ptac::adhE1(CA) from pET-Ptac, Ptac::kivd-leuABCD(KP)-Ptac::adhE1(CA) P15A ori, Cmr p15A ori, Cmr, pk promoter p15A ori, Cmr, Ppk::fdh(PP) p15A ori, Cmr, Ppk::gdh(KP) p15A ori, Cmr, Ppk::udh(KP) p15A ori, Cmr, Ppk::gdrf 2b-gdrf1b-dhaB3b-dhaB1b-dhaB2b-dhaTb Primers CACGGATCCATGTACACTGTCGGTGACTACCT GACGAGCTCTTAGGACTTGTTCTGTTCAGCGAAC CGCAAGCTTATGAGCCAGCAAGTCATTATTTTCG ATACTCGAGTTAATTCATAAACGCCGGCAGCTTG ACAGAATTCATGAAAGTCACAACAGTAAAGG CCGCTCGAGTTAAGGTTGTTTTTTAAAACAATTTAT ACACTCGAGCGATCCCGCGAAATTGACAA CCGGGATCCATGAAAATCGTTCTCGTTTTGT CCGCTCGAGTTATGCGACCTTTTTGT GGCGGATCCATGTATCCAGATTTAAAAG ATACTCGAGTTTTATCCGCGTCCT ACAGGATCCATGTCACACTCTTGGG CACCTCGAGGACAAGGCGTTAAAAC ACTCCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG TCCTGATGCTGGGTGT AGTTCTGGATGCTTTCG GATAAAGTCCGTGAAGTG CCTCATACATAGCCAAAA CCGACATCGCTGCTAACG GCGGGCGGATTCAAAA
reference or source laboratory collection laboratory collection 15 15 this study this study this study this study this study
this this this this this
study study study study study
this this this this 15
study study study study
a In plasmid descriptions, parentheses indicate the source of the gene as follows: CA, C. acetobutylicum; PP, P. pastoris; and KP, K. pneumoniae. Primer sequences are shown 5′ → 3′. bA 300 base pair (bp) reverse complementary sequence of the subject gene.
2.3. Plasmid Construction. All plasmid constructs were sequenced for verification with genomics. A list of plasmids and primers used is shown in Table 1. The fundamental vector pET-Ptac was devised from pET28a by substituting the original promoter with the tac promoter. The kivd gene (encoded α-ketoisovalerate decarboxylase, Genbank accession code LLKF_1386) from Lactococcus lactis was synthesized by Inovogen after codon optimization and ligated into pET-Ptac cut with BamH I and Sac I to create pET-Ptackivd. The leuABCD gene (encoded 2-isopropylmalate synthase, Genbank accession code KPN2242_02835; 3-isopropylmalate dehydrogenase, Genbank accession code KPN2242_02830; and isopropylmalate isomerase, Genbank accession code KPN2242_02820) was amplified from K. pneumoniae genomic DNA using primers leuABCDF and leuABCD-R. PCR products were digested with Hind III and Xho
I and ligated into the same sites of pET-Ptac-K to create pET-Ptac-KL. The adhE1 gene (encoded aldehyde/alcohol dehydrogenase 1, Genbank accession code CA_P0162) was amplified from Clostridium acetobutylicum genomic DNA using primers adhE1-F and adhE1-R. PCR products were digested with EcoR I and Xho I and ligated into pET-Ptac to create pET-Ptac-A. The fragment Ptac-adhE1 was amplified from pET-Ptac-A using the primers Ptac-F and adhE1-R. PCR products were digested with Xho I and ligated into pET-Ptac-KL to create pET-Ptac-KLA. The fundamental plasmid pACYC-pk was devised from pACYCDuet by substituting the first original promoter with a native promoter pk of the first subunit of dhaB gene cluster (Genbank accession code KPN2242_20530) in K. pneumoniae. The fdh gene (encoded formate dehydratase, Genbank accession code PAS_chr3_0932) was amplified 1824
DOI: 10.1021/acs.energyfuels.5b00009 Energy Fuels 2015, 29, 1823−1829
Article
Energy & Fuels
Figure 1. (A) Diagram showing the genetically engineered metabolic pathway of 1-butanol producer K. pneumoniae (KLA). (B) Enzymes used for NADH regeneration in engineered K. pneumoniae. FDH, formate dehydrogenase from P. pastoris GS115; GDH, glucose dehydrogenase from K. pneumoniae; and UDH, pyridine nucleotide transhydrogenase from K. pneumoniae. (NH4)2SO4, 0.01 g of FeSO4·7H2O, and 0.01 g of CaCl2 per liter of water) and 1000× trace element solution (2.72 g of ZnCl2·6H2O, 32 g of FeSO4, 0.68 g of MnCl2·4H2O, 1.88 g of CoCl2·6H2O, 0.24 g of H3BO3, 0.02 g of Na2MoO4, 1.88 g of CuCl2·2H2O, and 40 mL of concentrated HCl per liter of water). The medium mentioned above was sterilized by autoclaving at 116 °C for 25 min. Before inoculation, kanamycin and/or chloromycetin were added for the selection of the recombinant strains and the final concentrations were 50 and 85 mg/L, respectively. The flask fermentation was carried out at 37 °C and 140 rpm for the entire culture period. A single colony of the strain transformed with the desired plasmids was cultured overnight in LB with appropriate antibiotics (50 mg/L kanamycin and 85 mg/L chloramphenicol). On the next day, the overnight culture was inoculated at 1% into 50 mL (100 mL screw cap flasks) of fresh fermentative culture with appropriate antibiotics. The cultures were grown at 37 °C and 150 rpm to an OD600 of 0.4−0.6 and
from Pichia pastoris GS115 genomic DNA using primers fdh-F and fdh-R; the gdh gene (encoded glucose dehydrogenase, Genbank accession code KPN2242_14815) was amplified from K. pneumoniae genomic DNA with primers gdh-F and gdh-R; and the udh gene (encoded soluble pyridine nucleotide transhydrogenase, Genbank accession code KPN2242_24300) was amplified from K. pneumoniae genomic DNA using primers udh-F and udh-R. All three genes were digested with BamH I and Xho I and ligated into pACYC-pk to create pACYC-fdh, pACYC-gdh, and pACYC-udh, respectively. 2.4. Culture Media, Inoculation, and Flask Culture of Recombinant K. pneumoniae. E. coli TOP 10 and the derivatives were grown in lysogeny broth (LB) medium (5 g of yeast extract, 5 g of NaCl, and 10 g of tryptone per liter of water). The seed culture of K. pneumoniae was LB with a relevant antibiotic. The flask culture of K. pneumoniae and the derivatives were kp medium8 (5 g of glucose, 20 g of glycerol, 3 g of yeast extract, 1.3 g of KH2PO4, 3.4 g of K2HPO4·3H2O, 0.24 g of MgSO4·7H2O, 3.0 g of 1825
DOI: 10.1021/acs.energyfuels.5b00009 Energy Fuels 2015, 29, 1823−1829
Article
Energy & Fuels then induced with 0.2% 50 mg/mL isopropyl-β-D-thiogalactopyranoside (IPTG), and after that, the cultures were grown at 30 °C. 2.5. Analysis of Cell Density and Metabolites. Cell density was analyzed by measuring the optical density of culture broth at 600 nm using a spectrophotometer (Thermo Scientific, Waltham, MA). The specific growth rates were estimated from OD600 data. 1-Butanol and isopentanol were analyzed by gas chromatography (GC, GC-2010, Shimazu, Japan) equipped with a flame ionization detector and DB-FFAP capillary column.4 The metabolites, glycerol, 1,3-propandediol (1,3-PDO), 2,3-butanediol (2,3-BD), lactic acid, and acetic acid, filter supernatant were determined by UltiMate 3000 highperformance liquid chromatography (HPLC, Thermo Scientific, Waltham, MA) equipped with a Bio-Rad (Bio-Rad Laboratories, Hercules, CA) Aminex HPX-87H column (0.5 mM H2SO4, 0.6 mL/ min, with a column temperature at 65 °C), refractive index detector (RID), and ultraviolet (UV) detector. The extraction and determination of intracellular NAD+ and NADH were carried out according to the instructions of the manufacturer (Comin Biotechnology, Suzhou, China). 2.6. Analysis of Transcript Levels. K. pneumoniae cells were collected by centrifugation of 1 mL of culture media. RNA was isolated according to the instructions of the manufacturer (TIANGEN Biotech, China), and the concentration was measured using the NanoDrop 1000 (Thermo Scientific, Waltham, MA). Synthesis of cDNA from mRNA was carried out using the Quantscript RT First Strand cDNA Synthesis Kit (TIANGEN Biotech, China) according to the instructions of the manufacturer. Quantitative PCRs were performed in a Rotor-Gene Q system (Analytikjena, Germany). All reactions were performed in triplicate. The amplification mixture (final volume of 20 μL) contained 10 μL of 2× SYBR Green Mix (TIANGEN Biotech, China), 300 nM forward and reverse primers, and 2 μL of cDNA (diluted 1:100). Primer sequences are provided in Table 1. Cycling conditions and control reactions were performed according to the instructions of the manufacturer.
Figure 2. Flask fermentation result of K. pneumoniae KLA (pET-PtacKLA).
1A). Therefore, NADH is imbalanced in the introduced pathway and, thus, may hamper 1-butanol synthesis. 3.2. Effect of NADH Regeneration on Intracellular Concentrations of NAD+ and NADH. Constructing NADH regeneration systems (either overexpressing NAD+-dependent enzymes or eliminating the NADH consumption pathway) in engineered K. pneumoniae was expected to increase the total intracellular NADH pool and, thus, strengthen the flux of the NADH-dependent pathway. In this section, the strain KLAR was reengineered for decreasing the NADH consumption by downregulating the production of 1,3-PDO and the strains KLAF, KLAU, and KLAG were reengineered for NADH regeneration by introducing NAD+-dependent enzymes. The intracellular NAD+ and NADH in reengineered strains were measured (Figure 3). With the introduction of the 1-
3. RESULTS 3.1. Construction of the 1-Butanol Synthesis Pathway in K. pneumoniae. The wild-type strain (K. pneumoniae 13) did not produce any detectable butanol from glycerol because of the lack of 1-butanol synthesis enzymes. In our previous work, the modified CoA-dependent and Ehrlich pathways were successfully introduced into the wild-type strain by expressing the ter-bdhB-bdhA and kivd genes under the control of its native promoter and 1-butanol was produced with the titer of 15.0 mg/L in KpTBB and 28.7 mg/L in Kp-kivd.15 To further enhance 1-butanol production, the gene kivd was introduced under the control of the strongly induced tac promoter as well as the other genes involved in the Ehrlich pathway (Figure 1A). The fermentation result of K. pneumoniae mutant KLA (pETPtac-KLA) showed that 1,3-PDO and 2,3-BD were two major byproducts (Figure 2); however, significant amounts of 1butanol and isopentanol were also produced, confirming that the introduction of the Ehrlich pathway into K. pneumoniae enabled the host to produce 1-butanol. Moreover, the final 1butanol titer and the specific BuOH yield were 58 mg/L and 57.9 mg of BuOH/g of cell, respectively. The final butanol titer in KLA was higher than that in KpTBB and Kp-kivd, confirming that replacement with a strong induced promoter and overexpressing genes involved in the 1-butanol synthesis pathway was beneficial for product production. However, the final 1-butanol titers obtained in these fermentations were low, which could be attributed to the cofactor imbalance. In the 1butanol synthesis pathway, two molecules of NADH were consumed and one molecule was produced (shown in Figure
Figure 3. Effects of the NADH regeneration system introduced into K. pneumoniae on the concentrations of intracellular NADH, NAD+, and NADH/NAD+ ratio.
butanol synthesis pathway, the NAD+ level was higher and the NADH level and NADH/NAD+ ratio were less than those in the wild type. The cofactor imbalance situation was modified by introduced NADH regeneration systems. The NADH/NAD+ ratio has been improved to different degrees. The NADH regeneration system in the host led to a lower level of NAD+ and a higher level of NADH; however, the effect of NADH regeneration was not the same. Among the reengineered strains that introduced NAD+-dependent en1826
DOI: 10.1021/acs.energyfuels.5b00009 Energy Fuels 2015, 29, 1823−1829
Article
Energy & Fuels zymes, the NADH/NAD+ ratio in KLAF was highest, which was increased by 135% compared to the wild type. With the elimination of the NADH competition pathway, the NADH/ NAD+ ratio was increased by 78% compared to the ratio in the type strain. These results demonstrate that both overexpressing the NAD+-dependent enzymes and eliminating the NADH competition pathway are the effective methods for NADH regeneration. They can effectively change the redox status of cofactors and the quantities of intracellular NAD+ and NADH, hence enhancing the intracellular NADH/NAD+ ratio. 3.3. Effect of NADH Regeneration on mRNA Levels of the Genes Involved in 1-Butanol Synthesis. As described above, the NADH regeneration system can significantly affect the intracellular redox status; the consequent effect on the gene-expression level of the target pathway was studied in this section. The strain KLA was used as the control; the housekeeping 16s gene was used as an internal standard; and the mRNA levels of the target genes (kivd, leu, and adhE1) were analyzed by RT-PCR (shown in Figure 4).
concentrations of major metabolites of the parent and recombinant strains were determined (Figures 5 and 6).
Figure 5. Effects of the NADH regeneration system introduced into K. pneumoniae KLA on the cell growth and product synthesis.
Figure 4. Gene-expression levels of target genes involved in the 1butanol synthesis pathway in the reengineered strains.
The mRNA level of target genes in engineered strains was normalized by 16s RNA, and the normalized mRNA level in KLA was assumed to be 1.0. The gene-expression levels of target genes in the 1-butanol synthesis pathway were affected significantly by the introduced NADH regeneration systems. The largest change of target gene-expression levels happened in KLAF and KLAU, and the levels were about 1/3−1/5 and 3−5 times of that in KLA, respectively. The smallest change happened in KLAR, and the expression levels of the genes kivd, leuABCD, and adhE1 were 69, 81, and 112% of that in KLA, respectively. In comparison to KLA, the expression levels of kivd and leuABCD in KLAG were almost the same and the expression of adhE1 was twice as high. 3.4. Effect of NADH Regeneration on Metabolite Redistribution. Metabolic profiles of the parent and reengineered K. pneumoniae were monitored in parallel flasks. As previously described, the NADH regeneration systems significantly affect the redox status of the cells and the transcription level of the target genes. Therefore, the carbon fluxes of the NADH-dependent pathways, especially the 1butanol synthesis pathway, were expected to be triggered to increase in the recombinant strain. To investigate the metabolic changes in response to the NADH regeneration system, the
Figure 6. Effects of the NADH regeneration system introduced into K. pneumoniae KLA on the byproduct production.
As seen from Figure 5, the reengineered strains (KLAF, KLAU, KLAG, and KLAR) have a similar cell growth rate and final OD600 with the control (KLA). During the first 18 h, the 1butanol titer did not change significantly. At the stationary phase, the 1-butanol titer was increased significantly in the strains containing the NADH regeneration system, regardless of overexpressing NAD+-dependent enzymes or eliminating the NADH competition pathway. At 24 h, the 1-butanol titer in KLAF, KLAU, KLAG, and KLAR was increased by 67, 50, 32, and 83% compared to the control, respectively. With the introduction of a 1-butanol synthesis pathway, isopentanol can be produced (290 ± 20 mg/L) in KLA. After the introduction of the NADH regeneration system, the yield of isopentanol in reengineered strains was reduced by 12−28% of that in KLA. 1827
DOI: 10.1021/acs.energyfuels.5b00009 Energy Fuels 2015, 29, 1823−1829
Article
Energy & Fuels
aspects. On the basis of our study of both effective NADH regeneration strategies, eliminating the NADH competition pathway is indicated more than overexpressing NAD+-dependent enzymes for the special chemical produced. This may be attributed to the metabolic burden caused by overexpressing relative enzymes being higher, and eliminating the NADH competition pathway can drive the relative pathway to improve production of target compounds. Although the promoter is usually considered as the main determinant to affect the transcriptional level of target genes, we found that the transcriptional levels could also be affected by the intracellular redox status (Figure 4).
The byproduct production by the NADH regeneration mutant was investigated, and the production titers at 24 h are shown in Figure 6. In comparison to the control (KLA), the recombinant strains containing the NADH regeneration system produced less 1,3-PDO and lactate, more 2,3-BD, and almost the same amount of acetate. The titers of 1,3-PDO and lactate were reduced by 6−30 and 83−90%, respectively. On the contrary, the yield of 2,3-BD in all reengineered strains was increased by 20−85%; the engineered strains containing the NADH regeneration system produced almost the same amount of acetate as the control.
4. DISCUSSION Although K. pneumoniae is a pathogenic microorganism, it has been engineered to produce chemicals for many years, because of its capacity to metabolize glycerol, proliferate rapidly, and have a similar genetic background to E. coli. Besides, glycerol as a byproduct of the biodiesel production is abundantly and increasingly produced. It is an abundant bioresource feedstock to produce valuable chemicals. Therefore, K. pneumoniae is a potential host to be engineered to produce 1-butanol. There are two distinct pathways (CoA-dependent and Ehrlich pathways) to synthesize 1-butanol in microbials. The Ehrlich pathway has several advantages over the CoAdependent pathway, and more importantly, it circumvents the production of some toxic metabolites, especially CoA-dependent intermediates.16 This pathway was established in K. pneumoniae 13, and 1-butanol was successfully detected. Meanwhile, isopentanol was successfully produced by introducing the Ehrlich pathway. Cofactors are essential to lots of biochemical reactions. As published in the Kyoto Encyclopedia of Genes and Genomes (KEGG, http://www.genome.jp/kegg/), NADH is involved in more than 700 biochemical reactions and NADPH is involved in 887 biochemical reactions.17 Manipulation of cofactor balance, status, and level are the main focus in the cofactor engineering studies. The strategy to solve the cofactor imbalance in KLA caused by an exogenous Ehrlich pathway and a resultant metabolite distribution was studied in this paper. 1-Butanol synthesis needs NADH as the cofactor, and consequently, introducing this pathway to K. pneumoniae led to NADH imbalance (shown in Figure 3). To solve this problem, both strategies of introducing NAD+-dependent enzymes and eliminating the NADH consumption pathways were applied. The present study demonstrates that both kinds of NADH regeneration systems are effective to enhance the intracellular NADH amount and NADH/NAD+ ratio (shown in Figure 3). Among the three introduced NAD+-dependent enzymes, FDH from P. pastoris GS115 can enhance the NADH amount and NADH/NAD+ ratio at the highest level. The changed redox status affects the cell physiology, expression level of target genes, and carbon flux redistribution in metabolic engineering. Application of UDH, an enzyme that can directly catalyze the transfer reaction between NADPH and NADH,7 to the 1butanol producer, resulted in the greatest increase in target gene expression. The highest target gene-expression level did not correspond with the highest target product yield. The largest increase of 1-butanol production was observed in KLAR instead of KLAU, and 1-butanol production in KLAR was increased by 83% of that in KLA (shown in Figure 5). This may be due to the biosystem of strain being very complicated. The transcription and translation of genes will be affected by many
5. CONCLUSION On the basis of the fast growth rate of K. pneumoniae (even faster than E. coli) and the capability to survive on crude glycerol as the sole carbon source, it is considered an appropriate host to be engineered to produce 1-butanol. In this study, the Ehrlich pathway for 1-butanol synthesis was constructed in the wild-type K. pneumoniae and the cofactor imbalance in this 1-butanol producer was resolved by adopted NADH regeneration, introducing dehydrogenase-like enzymes or downregulating the NADH consumption pathway. Both the intracellular NADH amount and ratio of NADH/NAD+ were increased in all of the reengineered strains that contained NADH regeneration systems compared to KLA. The target gene-expression levels and 1-butanol titer were affected by the introduced NADH regeneration systems. Interference of the NADH competition pathway was the better strategy for enhancing 1-butanol production compared to introducing NAD+-dependent enzymes.
■
AUTHOR INFORMATION
Corresponding Author
*Telephone: +86-10-64416691. Fax: +86-10-64715443. E-mail:
[email protected]. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This work was supported by the National Basic Research Program of China (973 Program, 2013CB733600 and 2012CB725200), the National Natural Science Foundation of China (21390202 and 21436002), and the National Key Scientific Instruments and Equipment Development Special Fund (2012YQ0401400302).
■
REFERENCES
(1) Atsumi, S.; Cann, A. F.; Connor, M. R.; Shen, C. R.; Smith, K. M.; Brynildsen, M. P.; Chou, K. J. Y.; Hanai, T.; Liao, J. C. Metabolic engineering of Escherichia coli for 1-butanol production. Metab. Eng. 2008, 10 (6), 305−311. (2) Atsumi, S.; Hanai, T.; Liao, J. C. Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature 2008, 451 (7174), 86−89. (3) Bhandiwad, A.; Shaw, A. J.; Guss, A.; Guseva, A.; Bahl, H.; Lynd, L. R. Metabolic engineering of Thermoanaerobacterium saccharolyticum for n-butanol production. Metab. Eng. 2014, 21, 17−25. (4) Lan, E. I.; Liao, J. C. Metabolic engineering of cyanobacteria for 1-butanol production from carbon dioxide. Metab. Eng. 2011, 13 (4), 353−363. (5) Yu, M. R.; Zhang, Y. L.; Tang, I. C.; Yang, S. T. Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab. Eng. 2011, 13 (4), 373−382.
1828
DOI: 10.1021/acs.energyfuels.5b00009 Energy Fuels 2015, 29, 1823−1829
Article
Energy & Fuels (6) Wubbolts, M. G.; Terpstra, P.; Beilen, J. B. V.; Kingma, J.; Meesters, H. A. R.; Witholt, B. Variation of cofactor levels in Escherichia coli. J. Biol. Chem. 1990, 265 (29), 17665−17672. (7) Uppada, V.; Bhaduri, S.; Noronha, S. B. Cofactor regeneration An important aspect of biocatalysis. Curr. Sci. India 2014, 106 (7), 946−957. (8) Wu, Z.; Wang, Z.; Wang, G. Q.; Tan, T. W. Improved 1,3propanediol production by engineering the 2,3-butanediol and formic acid pathways in integrative recombinant Klebsiella pneumoniae. J. Biotechnol. 2013, 168 (2), 194−200. (9) Boonstra, B.; Rathbone, D. A.; French, C. E.; Walker, E. H.; Bruce, N. C. Cofactor regeneration by a soluble pyridine nucleotide transhydrogenase for biological production of hydromorphone. Appl. Environ. Microb. 2000, 66 (12), 5161−5166. (10) Wang, Y.; Tao, F.; Xu, P. Glycerol dehydrogenase plays a dual role in glycerol metabolism and 2,3-butanediol formation in Klebsiella pneumoniae. J. Biol. Chem. 2014, 289 (9), 6080−6090. (11) Li, Y.; Su, M. Y.; Ge, X. Z.; Tian, P. F. Enhanced aldehyde dehydrogenase activity by regenerating NAD+ in Klebsiella pneumoniae and implications for the glycerol dissimilation pathways. Biotechnol. Lett. 2013, 35 (10), 1609−1615. (12) Chen, Y. Y.; Ko, T. P.; Lin, C.-H.; Chen, W. H.; Wang, A. H. J. Conformational change upon product binding to Klebsiella pneumoniae UDP-glucose dehydrogenase: A possible inhibition mechanism for the key enzyme in polymyxin resistance. J. Struct. Biol. 2011, 175 (3), 300−310. (13) Huang, Y. N.; Li, Z. M.; Shimizu, K.; Ye, Q. Simultaneous production of 3-hydroxypropionic acid and 1,3-propanediol from glycerol by a recombinant strain of Klebsiella pneumoniae. Bioresour. Technol. 2012, 103 (1), 351−359. (14) Oh, B. R.; Heo, S. Y.; Lee, S. M.; Hong, W. K.; Park, J. M.; Jung, Y. R.; Kim, D. H.; Sohn, J. H.; Seo, J. W.; Kim, C. H. Production of 2butanol from crude glycerol by a genetically-engineered Klebsiella pneumoniae strain. Biotechnol. Lett. 2013, 36 (1), 57−62. (15) Wang, M. M.; Fan, L. H.; Tan, T. W. 1-Butanol production from glycerol by engineered Klebsiella pneumoniae. RSC Adv. 2014, 4, 57791−57798. (16) Shen, C. R.; Liao, J. C. Metabolic engineering of Escherichia coli for 1-butanol and 1-propanol production via the keto-acid pathways. Metab. Eng. 2008, 10 (6), 312−320. (17) Carpi, A. Progress in Molecular and Environmental BioengineeringFrom Analysis and Modeling to Technology Applications; InTech: Rijeka, Croatia, 2011; pp 427−444.
1829
DOI: 10.1021/acs.energyfuels.5b00009 Energy Fuels 2015, 29, 1823−1829
