Enhanced Bioaccumulation of Heavy Metals by Bacterial Cells with

Chapter 24

Downloaded by NATL UNIV OF SINGAPORE on March 29, 2017 | http://pubs.acs.org Publication Date: January 24, 2002 | doi: 10.1021/bk-2002-0806.ch024

Enhanced Bioaccumulation of Heavy Metals by Bacterial Cells with Surface-Displayed Synthetic Phytochelatins Wilfred Chen, Weon Bae, Rajesh Mehra, and Ashok Mulchandani Department of Chemical and Environmental Engineering, University of California, Riverside, CA 92521

A novel strategy using synthetic phytochelatins was described for the purpose of developing microbial adsorbents for enhanced bioaccumulation of toxic metals. Synthetic genes encoding for several metal-chelating phytochelatin analogs (Glu-Cys) Gly (ECs) were synthesized and displayed on the surface of E. coli using different anchor systems. Cells displaying ECs exhibited chain-length dependent increase in cadmium accumulation. A similar increase in H g accumulation was observed with cells expressing EC20 on the surface. The ability to genetically engineer ECs with precisely defined chain length could provide an attractive strategy for developing high-affinity bioadsorbents suitable for heavy metal removal. n

2 +

Introduction Because of their intrinsically persistent nature, heavy metal ions (As, Cd, Cr, Cu, Hg, N i , Pb, Se, V and Zn) are major contributors to pollution of the biosphere (1). These metals when discharged or transported into the environment may undergo transformations and can have a large environmental, public health, and economic impact (2). The increasingly restrictive Federal regulation of allowable levels of heavy metal discharge and accelerated requirements for the remediation of contaminated sites make necessary the

© 2002 American Chemical Society

Lipnick et al.; Chemicals in the Environment ACS Symposium Series; American Chemical Society: Washington, DC, 2002.

411


412 development of new approaches and technologies for heavy metal removal. Conventional technologies such as precipitation-filtration, ion exchange, reverse osmosis, oxidation-reduction, and membrane separation are often inadequate to reduce metal concentration to acceptable regulatory standards. Recent research has focused on the development of novel bioadsorbents with increased affinity, capacity, and selectivity for target metals. Immobilization is the major mechanism employed by nature (animals and plants) for counteracting heavy metal toxicity (3). Metallothioneins (MTs) and phytochelatins (PCs) are two groups of naturally occurring, cysteine-rich peptides that are synthesized for bind a wide range of heavy metals (4). Expression of MTs in E. coli to improve the bioadsorption of heavy metals is a promising technology for the development of microbial-based biosorbents (5). However, metal removal by intracellular MTs has been problematic because of the limited metal uptake (6). One approach to circumvent this problem is to directly anchor the MTs onto the cell surface (7). Suggestions have been made to use PCs in a similar manner as MTs since PCs offer many advantages, particularly the higher metal-binding capacity on a per cysteine basis (8). Because of the presence of a γ bond between amino acids, the exact biochemical and genetic mechanisms for their synthesis and chain elongation have not been elucidated. The de novo design of metal-binding peptides is a promising alternative to MTs or PCs as they offer the potential of better affinity and selectivity for heavy metals. One particular strategy is to develop organisms harboring protein analogs of PC with the general structure (Glu-Cys)nGly (ECs) that can be synthesized using theribosomalmachinery. Detailed experiments with EC2 and EC4 have shown that these peptides bind a variety of metals in a manner similar to that exhibited by PC2 and PC4 (9). Although the metal-binding stoichiometrics for ECs with higher cysteine content are still to be established, it is easy to envision that they might work in a similar fashion as EC2 and EC4. More importantly, it is possible to produce large quantities of ECs with any defined chain length of interest. In this paper, we describe the construction and characterization of recombinant Κ coli strains that anchor and display functional synthetic phytochelatins ranging from 7 to 20 cysteines (EC7, EC8, E C U , and EC20) onto the cell surface of E. coli. We demonstrate that these synthetic phytochelatins confer cadmium and mercury binding capability on the host cells and the resulting novel bioadsorbents accumulate a substantially higher amount of cadmium than the wild-type cells.


413 Experimental Strains, plasmids, media, and general procedures. E. coli strain JM105 (endAl, thi, rpsL, sbcBIS, hsdR4, A(lac-proAB), [F, traD36, proAB, lacF ΖΔΜ15]) was used as the recipient of all plasmids. Plasmids p L 0 7 , p L 0 8 , p L O l l , and pLO20 are derivatives of the vector pUC18, which bear the sequence coding for Lpp-OmpA-EC7, Lpp-OmpA-EC8, L p p - O m p A - E C l l , and Lpp-OmpA-EC20, respectively. Plasmid pINP20 was used to express the INPNC-EC20 fusion. Cultures were grown in low-phosphate M J S medium supplemented with 50 μg/ml ampicillin at 30°C to an O D of 0.3 when 1 m M IPTG was added to induce the expression of the fusion proteins. 100 μ Μ C d S 0 or H g C l was subsequently added for metal binding experiments. General molecular biology procedures followed standard protocols unless specified otherwise (10).


6 0 0

4

2

Construction of Lpp-Omp- and INPNC-EC20 fusions. The synthetic gene encoding for (Glu-Cys) oGly (EC20) was prepared using two oligonucleotides (Research genetics, Huntsville, AL): ec-a) yiTTGGA rCCATGGAATGTGAATGTGAATGTGAATGTGAATGTGAAT GTGAATGTGAGTGTGAATGTGAGTGCGAATGCGAA3' and ec-b) 5'TTrA4GC7TITAACCACATTCACATTCACATTCACATTCACATTCACA T T C G CA T T C A CA T T C G CA T T C G C A T T C G CA C T C 3 '. The two oligonucleotides were mixed, boiled, and cooled to hybridize at the underlined sequence. The preferred codons for glutamic acid (GAA) and cysteine (TGT) have been changed at some locations to less frequently used codons, G A G and T G C , respectively, to prevent unwanted hybridization. Double strand synthesis was accomplished using the Klenow fragment (Promega). The synthetic gene was digested with BamM (italicized) and Hindlll (italicized) and the resulting fragment was cloned into the yeast-£. coli shuttle vector pVT102-U, digested with the same restriction enzymes to generate pVT20. The resulting clone was sequenced to confirm the presence of the correct ec20 fragment. Construction of synthetic genes for EC7, EC8 and EC11 followed similar procedures. To construct the lpp-ompA-ec20 fusion, the Ipp-ompA fragment (481bp) was P G R amplified as described previously (11), digested with EcoRI and Kpnl and cloned into pUC18 to generate plasmid pLO. The ec20 fragments were P C R amplified from plasmid pVT20 using the primers: ec-c) 5' GCTGGA F C C T A T G G A A T G T G 3* and ec-d) 5 G C A A G G T A G A C A A G C C G 3 . The primer ec-c contains an extra base (bold) just behind the BamHl site in order to generate an in-frame fusion with Ipp-ompA. The amplified fragment was digested with BamHl and Hindlll, gel-purified and subcloned into p L O to generate pLO20. The cloning of the ec20 fragment was again confirmed by D N A sequencing. The recombinant plasmid pLO20, coding for Lpp-OmpAEC20, was used for all subsequent experiments. Plasmids p L 0 7 , p L 0 8 and 2

1

1


414 p L O l l containing the genes encoding Lpp-OmpA-EC8 and L p p - O m p A - E C l l were generated similarly. Plasmid pINP20, coding for the INPNC-EC20 fusion, was constructed by inserting the ec20 fragment into BamHUHindBI digested pINCOP (12). Radiolabeling the target proteins and SDS-PAGE analysis. Radiolabeled cysteine ( S 1075 Ci/mmol, ICN) was added at the time of induction (final concentration of 5 μΟ/πύ). After desired time of induction, 1.5 ml aliquot of each culture was centrifuged. The extracted total proteins were boiled in sample buffer (Sambook et al., 1989) for 5 min and separated by S D S - P A G E (12.5% (w/v) polyacrylamide) (Laemmli, 1970). The gel was dried and exposed to X ray film. 35


5

2 +

+

Bioaccumulation of C d and Hg2 . Cells were grown in M J S medium and induced with 1 m M IPTG for the expression of fusion proteins. C d S 0 (ΙΟΟμΜ) or H g C l (5μΜ) was added to the culture in order to allow expression of ECs in the presence of C d or Hg * Cells did not show any significant reduction in growth at this concentration of the metal. Cells were harvested after desired time of induction, washed twice with double distilled water, and treated overnight with concentrated nitric acid. Disrupted cells were then diluted with double distilled water and centrifuged for 10 min at 4°C. The concentration of metals in the soluble fraction was directly measured through atomic absorption spectrophotometer (Perkin Elmer AAS3100) or by a mercury analyzer (Bacharach). 4

2

2 +

2

Results and Discussion Expression of synthetic phytochelatins on the cell surface. A gene fusion system consisting of the signal sequence and the first nine amino acids of lipoprotein joined to a transmembrane domain from Outer Membrane Protein A (Lpp-OmpA), which has been used successfully to express a variety of proteins and enzymes onto the cell surface, was employed to anchor the different synthetic phytochelatins (11, 13). Synthetic genes coding for several synthetic phytochelatins were synthesized, linked to Ipp-ompA fusion gene and displayed on the surface of E. coli. The ability to genetically engineer E C s with precisely defined chain lengths enables us to demonstrate for the first time the metalbinding capability of any P C or E C containing up to 20 cysteines. The high cysteine content of the synthetic phytochelatins, when labelled with S cysteine, enables their ready detection by autoradiography. In the presence of 1 m M IPTG, synthesis of full-size Lpp-OmpA-EC8 (18.5 kDa), L p p - O m p A - E C l l (19 kDa), and Lpp-OmpA-EC20 (21 kDa) was detected (Fig. 1A). 35


415 A.

pL08 +

pLOll +

pLO20 +

B. Proteinase K-treated Oh 3min 10min l h


66

S5

Figure 1. (A) Expression of Lpp-OmpA-EC fusions. [ S]cysteine was added to the cultures at OD = 0.3. The cultures were further grown for 24 hours. Total cell proteins were separated on SDS-PAGE (12.5% (w/v) polyacrylamide). The gel was dried and autoradiographed. Expression from uninduced (-) and induced (+) cultures were shown. The molecular weight markers are shown in the far left lane. (B) Protease accessibility experiments. Autoradiogram of radiolabeled proteins from E. coli cells harboring pLO20 after proteinase Κ treatment. 600

Protease accessibility experiments were carried out to ascertain the presence of E C s on the surface. Cultures grown on S labeled cysteine were incubated with and without proteinase Κ and the total protein was analyzed by SDS-PAGE. For the cells incubated with proteinase K , the intensity of LppOmpA-EC20 fusions continued to decrease and was no longer detectable after 1 hr (Fig. IB). In contrast, no observable decline in the intensity was detected from cells overexpressing the MBP-EC20 fusions even after 21 hrs of incubation (data not shown). 35

2 +

+

Bioaccumulation of C d and Hg* . The metal-binding ability of whole cells expressing EC20 was tested by monitoring the binding of C d to Κ coli expressing E C s on the cell surface through atomic absorption spectrometry. A s shown in Fig. 2, strains expressing E C s on the cell surface accumulated a significantly higher amount of C d than cells carrying pUC18. This result confirmed that all E C s retain metal-binding capability independent of chain length. However, the chain length of E C s did influence the overall C d accumulation. The amount of C d accumulated increased with increasing cysteine residues in the ECs (Fig. 2). Cells with EC20 expressed on the surface 2 +

2 +

2 +


416 (ca. 60 nmol C d 7mg dry weight of cell) accumulated almost twice the amount of C d compared to cells expressing E C U . This result is consistent with the increasing number of metal-binding centers present 2 +


70

pUC18

pL07

pL08

pL011

pLO20

+

Figure 2. Bioaccumulation of Cd* by cells expressing ECs on the cell surface. Plasmids pUC18 were used as negative controls. The data were obtained from 5 independent experiments. To demonstrate the binding capability of E C s to other heavy metals, H g accumulation of various Κ coli strains were investigated. As shown in Figure 3, E. coli strain carrying pUC18 accumulated a very low level of H g and whole cell accumulation of Hg * was again increased with EC20 expressed on the surface. 2 +

2 +

2

2 +

Bioaccumulation of C d by cells expressing INPNC-EC20. One of the problems associated with surface expression using the Lpp-OmpA fusion system is the severe growth inhibition. In the case of EC20, cell growth was virtually stopped after induction. To explore the possibility of improving cell growth, a different anchor system based on the truncated ice nucleation protein (INPNC) was used. Cells carrying pINP20 showed no sign of growth inhibition even after induction. The final cell density was more than 2-fold higher than cells carrying pL020. However, whole cell accumulation of C d was only 50% that of cells carrying pLO20. This difference may reflect a lower level of EC20 expressed on the cell surface (Figure 4). Recently, we demonstrated that expression of proteins on the cell surface was 60-fold more efficient in Pseudomonas than in 2 +



417

pUC18

pLO20

2

Figure 3. Bioaccumulation ofHg * by cells expressing EC20 on the cell surface. Plasmids pUC18 were used as negative controls. The data were obtained from 2 independent experiments.

5

20

27

44

Time (hr) 2

Figure 4. Cell growth (Δ, pLO20 and £7, pINP20) and Cd * accumulation (white bar, pLO20 and black bar, pINP20) for cells expressing EC20 on the surface using either the Lpp-OmpA or INPNC anchor.


418 Ε. coli using the ice nucleation protein anchor. A n alternative strategy to further improve the whole cell accumulation of heavy metal is to express EC20 on the surface of Pseudomonas or related species (14). The resulting recombinants could be immobilized onto solid supports for continuous removal of heavy metals.


Acknowledgments This work was supported by the U C Biotechnology Research and Education Program and the U S E P A (R827227).

References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.

11. 12. 13. 14.

Nriagu, J.O. and Pacyna, J.M. Nature 1989, 333, 34. Gadd, G . M . and White, C. Trends Biotechnol. 1993, 11, 353. Mehra, R.K. and Winge, D.R. J. Cell. Biochem. 1991, 45, 30. Stillman, M J , Shaw III, F C , Suzuki. K T . 1992. Metallothioneins. V C H Publishers. Pazirandeh, M.; Chrisey, L . A . ; Mauro, J . M . ; Campbell, J.R. and Gaber, B.P. Appl. Microbiol. Biotechnol. 1995, 43, 1112. Chen, S. and Wilson, D. W. Appl. Environ. Microbiol. 1997, 63, 2442. Sousa, C.; Kotrba, P.; Ruml, T.; Cebolla, A . and de Lorenzo, V . J. Bacteriol. 1998, 180, 2280. Zenk, M H . Gene 1996, 179, 21. Bae, W. and Mehra, R.K. J. Inorg. Biochem. 1991, 68, 201. Sambrook, J, Fritsch, E F , Maniatis, T. 1989. Molecular Cloning - A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Richins, R.; Kaneva, I.; Mulchandani, A . and Chen, W. Nat. Biotechnol. 1997, 15, 984. Shimazu, M.; Mulchandani, A . and Chen, W. Biotechnol Prog. 2001, In Press. Francisco, J.A., Earhart, C.F. and Georgiou, G. Proc. Natl. Acad. Sci. USA 1992, 89, 2713. Shimazu, M.; Mulchandani, A . and Chen, W. Unpublished Results.


Enhanced Bioaccumulation of Heavy Metals by Bacterial Cells with

Recommend Documents