Enhanced isoprene production by reconstruction of metabolic balance

Subscriber access provided by UNIV OF THE WESTERN CAPE

Article

Enhanced isoprene production by reconstruction of metabolic balance between strengthened precursor supply and improved isoprene synthase in Saccharomyces cerevisiae Zhen Yao, Pingping Zhou, Bingmei Su, Sisi Su, Lidan Ye, and Hongwei Yu ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.8b00289 • Publication Date (Web): 25 Aug 2018 Downloaded from http://pubs.acs.org on August 25, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Synthetic Biology

Enhanced isoprene production by reconstruction of metabolic balance between strengthened precursor supply and improved isoprene synthase in Saccharomyces cerevisiae Zhen Yao†, Pingping Zhou†, Bingmei Su§, Sisi Su║, Lidan Ye†,‡,* Hongwei Yu†,‡,* †

Institute of Bioengineering, College of Chemical and Biological Engineering,

Zhejiang University, Hangzhou 310027, PR China ‡

Key Laboratory of Biomass Chemical Engineering of Ministry of Education,

Zhejiang University, Hangzhou 310027, PR China §

Fujian Key Laboratory of Marine Enzyme Engineering, College of Biological

Science and Engineering, Fuzhou University, Fuzhou 350116, PR China. ║

College of Life Science and Technology, Beijing University of Chemical Technology,

Beijing 100029, PR China

1

ACS Paragon Plus Environment

ACS Synthetic Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Isoprene, as a versatile bulk chemical, has wide industrial applications. Here, we attempted to improve isoprene biosynthesis in Saccharomyces cerevisiae by simultaneous strengthening of precursor supply and conversion via a combination of pathway compartmentation and protein engineering. At first, a superior isoprene synthase mutant ISPSLN was created by saturation mutagenesis, leading to almost 4-fold improvement in isoprene production. Subsequent introduction of ISPSLN to strains with strengthened precursor supply in either cytoplasm or mitochondria implied an imperfect match between the synthesis and conversion of the isopentenyl pyrophosphate (IPP)/dimethylallyl diphosphate (DMAPP) pool. To reconstruct metabolic balance between the upstream and downstream flux, additional copies of diphosphomevalonate decarboxylase gene (MVD1) and isopentenyl-diphosphate delta-isomerase gene (IDI1) were introduced into the cytoplasmic and mitochondrial engineered strains. Finally, the diploid strain created by mating the above haploid strains produced 11.9 g/L of isoprene, the highest ever reported in eukaryotic cells.

KEYWORDS: protein engineering, pathway compartmentation, metabolic balance, isoprene biosynthesis, Saccharomyces cerevisiae

T

he wide applications of isoprene, ranging from synthetic rubber

production to pesticide manufacturing and potential fuel additive,

together with the fact that its supply suffers from fluctuations in the petroleum 2


Page 2 of 36

Page 3 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


industry, has drawn increasing attention to its biosynthesis. In particular, Escherichia coli has been extensively explored as a microbial cell factory for isoprene production 1-4

. Recently, as high as 24 g/L of isoprene production was achieved in E. coli by

building synergy between the two isoprenoid precursor pathways, MVA pathway and methylerythritol 4-phosphate (MEP) pathway.5 However, phage invasion represents a major risk for industrial production using prokaryotic cell factories, whereas the dependence of gene expression on expensive inducers in E. coli forms another obstacle for production of bulk chemicals such as isoprene. Integration of the isoprene synthesis pathway into the genome of the eukaryote Saccharomyces cerevisiae provides a solution to the above problems, however, with very low isoprene yield.6 Adoption of a cytoplasmic push-pull-restrain strategy enhanced the metabolic flux towards isoprene synthesis, resulting in accumulation of 37 mg/L isoprene.7 Pathway compartmentation into the acetyl-CoA-rich mitochondria followed by mating this strain with the above-mentioned cytoplasmic engineered strain led to gram-scale isoprene production.8 On the other hand, direction evolution of ISPS in combination with expression enhancement also dramatically improved isoprene production in the cytoplasmic engineered strain.9 However, in both cases not the whole pathway was optimized, but only the upstream or downstream section was engineered. Considering that sufficient supply of precursors and their fast conversion to the target product together constitutes the key to an unimpeded synthetic pathway and thus efficient biosynthetic process, it would be interesting to investigate the effect of combinatorial engineering on isoprene biosynthesis. In particular, the metabolic 3



balance at the connecting node when combining the separately engineered upstream and downstream pathway sections deserves investigation. Flux imbalance in synthetic pathways often leads to accumulation of cytotoxic intermediates, loss of carbon flow and formation of byproducts, resulting in impaired growth and suboptimal product yield.10-14 Therefore, how to strengthen the pathway flux and meanwhile keep a delicate balance becomes a common issue in biosynthesis. In this work, efforts were made to achieve simultaneous enhancement of the upstream and downstream sections of the isoprene synthetic pathway by combining protein engineering and pathway compartmentation. To bridge the reinforced precursor supply with the accelerated isoprene formation, the generation and interconversion of IPP/DMAPP as the connecting node was carefully regulated by overexpressing MVD1 and IDI1, and the outcome was comparatively discussed between the mitochondrial and cytoplasmic engineering strains (Fig 1). Finally, a combinatorially engineered diploid strain was constructed by mating the optimal haploid strains, and examined for isoprene production capability in high-density fermentation.

Figure 1. Combinatorial engineering of isoprene biosynthesis in S. cerevisiae by pathway compartmentation, protein engineering and fine-tuning of the connecting node. The upstream section of the isoprene synthetic pathway was engineered by mitochondrial compartmentalization and cytoplasmic push-pull-restrain regulation of the MVA pathway to enhance precursor supply, whereas 4


Page 4 of 36

Page 5 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the downstream pathway section was strengthened by protein engineering of ISPS. Flux imbalance between the pathway sections led to suboptimal isoprene production and/or repressed cell growth. To reconstruct metabolic balance between the separately enhanced upstream and downstream pathway sections, the generation and interconversion of the IPP/DMAPP pool as the connecting node was carefully regulated. Enlarged font of "MVA pathway" represents strengthening of MVA pathway by the cytoplasmic push-pull-restrain strategy. Dashed arrow towards squalene indicates down-regulation of the competitive squalene synthetic pathway. Green valves represent the rate-limiting enzymes, and red curved arrows denote regulation of the enzyme activity or expression.

RESULTS AND DISCUSSION Saturation mutagenesis at F340 and A570 of isoprene synthase increased isoprene production. The poor activity and low expression of plant isoprene synthase in microorganisms render the conversion of DMAPP to isoprene a major rate-limiting step in its heterologous production. Our previous efforts in ISPS engineering via directed evolution yielded a positive ISPS mutant ISPSM4 (F340L/A570T) with 3-fold activity improvement.9 In order to further improve ISPS activity so as to pull the metabolic flux towards isoprene, we attempted to create superior ISPS mutants by means of saturation mutagenesis, based on the two hot spots (F340 and A570) identified in directed evolution. All mutants were expressed from a centromeric plasmid p416XWP01-URA15 in a DMAPP-overaccumulating strain BY4742-C-04 (BY4742, ∆lpp1:: ERG10-HMGS, ∆ho:: tHMG1-ERG12, ∆dpp1:: tHMG1-PMK, ∆gal80:: MVD1-IDI1).9 Intriguingly, the catalytic efficiency of ISPS was improved by replacement of F with four different nonpolar amino acid residues at site 340 (Fig. 2a), valine, leucine, isoleucine and methionine, whereas substitution of A with polar amino acid residues except tyrosine at site 570 led to activity improvement (Fig. 2b). Screening of mutants generated by combinatorial mutagenesis suggested ISPSLN as the best mutant, which increased isoprene production by 295% and 50% comparing to 5



the wild-type ISPS and ISPSM4, respectively (Fig. 2c).

Figure 2. Fractional changes in isoprene titers of single-site mutants generated by saturation mutagenesis at site 340 (a), site 570 (b) and double-site mutants constructed by combinatorial mutagenesis (c) as shown by isoprene production of BY4742-C-04 in sealed vials. Combined mutants indicate double substitutions at both 340 and 570 loci (For example, mutant IC represents combination of F340I and A570C). WT means wild-type ISPS. BY4742-C-04 harboring ISPSM4 (F340L/A570T) was included as an additional control. The data presented are the mean of three biological replicates. Error bars represent the standard deviations.

F340 locates in the proximity to the active site composed of triple hydrophobic residues F338-V341-F485 (Fig. 3a). The hydrophobic nature of the active site of isoprene synthase is beneficial for binding of the 5-carbon substrate DMAPP.16 That is probably the reason why only hydrophobic amino acids could increase the catalytic efficiency of ISPS. In addition, in comparison with the original residue phenylalanine, all positive substitutions have smaller side chains, leading to decreased steric hindrance for DMAPP binding in the active site. In contrast, introduction of residues with a large side chain, e.g. tryptophan, into site 340 led to dramatic decrease in 6


Page 6 of 36

Page 7 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


catalytic efficiency of ISPS (Fig 2a). For proline, besides its large side chain, the proper active conformation may be hindered by its innate conformational rigidity. Among all positive mutants, F340L showed the best catalytic performance, increasing the isoprene production by 32%. A570 locates at the C-terminus of the protein, in the entrance of the active pocket (Fig. 3a). Considering the protein nature of hydrophobic core and hydrophilic surface, 17, 18

substitution of the solvent-exposed non-polar side chain of alanine with polar

ones could increase the physical stability of folded protein, leading to a more effective catalysis reaction.19, 20 According to the docking results, the hydrophilic groups –OH in substitution of Thr and –NH2 in substitution of Asn were indeed exposed to the solvent (Fig 3b). In addition, considering its location at the entrance of the active pocket, the properties of the site 570 residue may influence the formation of the favorable chair-like binding conformation of DMAPP, thus affecting the elimination process of diphosphate group of DMAPP.9 In comparison to mutant ISPSM4, introduction of asparagine with a larger side chain into this site instead of threonine obviously increased isoprene production (Fig 2c). However, substitutions with larger side chains than asparagine, such as tyrosine and glutamine, dramatically decreased isoprene production. Especially when tyrosine with the largest side chain among polar amino acid residues was introduced in site 570, the catalytic efficiency of ISPS was decreased by 54% as compared to the wild type. These results implied that the size of the active pocket entrance may play a vital role in catalysis. Only a proper entrance size that is neither too small nor too large ensures efficient catalysis. 7



Page 8 of 36

In combinatorial mutagenesis, mutant ISPSLN showed the highest isoprene synthesis efficiency among all combinations of substitutions at F340 and A570 loci (Fig. 2c). In consistence, the docking results showed higher binding affinity absolute value of ISPSLN to the substrate DMAPP (5.7 kcal/mol) as compared to those of ISPSM4 (5.5 kcal/mol) and the wild-type ISPS (5.3 kcal/mol).

Figure 3. Structure of the ISPS-DMAPP complex. Structural models were constructed based on 3N0F (PDB ID) as the template by SWISS-MODEL and molecular docking analysis was conducted for the wild-type ISPS and its mutants using AutoDock Vina. (a) Active site pocket of ISPS and its mutants; (b) Protein surface. Red, DMAPP; green, amino acid residues; gray, protein.

To sum up, introduction of nonpolar residues surrounding the active site and polar residues at the entrance of the active pocket and on the surface of the protein contributed to the improvement in catalytic efficiency of ISPS, which provides a perspective

for

further

engineering

efforts.

When

expressed

in

the

DMAPP-overaccumulating strain BY4742-C-04, the superior mutant ISPSLN 8


Page 9 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


significantly improved isoprene production to almost 4 folds, providing a good starting strain for further metabolic engineering.

Combination of isoprene synthase engineering with pathway compartmentation. Supply of DMAPP/IPP could be enhanced by either strengthening the cytoplasmic MVA flow or pathway compartmentation into the acetyl-CoA-rich mitochondria.7, 8 In order to investigate the cooperative effect of ISPS engineering with mitochondrial engineering and ISPS engineering with cytoplasmic engineering, the best mutant ISPSLN was respectively expressed in strain BY4742-M-04-HIS (BY4742, ∆lpp1::ERG10-MLS-MLS-HMGS, ∆ho::tHMG1-MLS-MLS-ERG12, ∆dpp1::tHMG1MLS-MLS-PMK, ∆gal80::MVD1-MLS-MLS-IDI, his3::HIS3) expressing the complete MVA pathway in mitochondria8 and strain YXM10 (BY4741, HMG1::tHMG1, ∆PERG20::PHXT1,

∆ty4::ERG10-ACS2,

∆GAL80::LEU2)

engineered

by

a

cytoplasmic push-push-restrain strategy,7 and the isoprene production was determined in sealed-vial cultures to avoid loss of isoprene by evaporation during cultivation. As shown in Fig. 4, both strains produced significantly more isoprene than their counterparts harboring the wild-type ISPS, by 123% and 182% respectively. The improvement of isoprene production by ISPSLN in BY4742-M-04-HIS and YXM10 was not as much in BY4742-C-04. Meanwhile, no biomass improvement was obtained by replacing the wild-type ISPS with ISPSLN. Taking together the cytotoxicity of DMAPP when overaccumulated,12, 22 we can come to the assumption that the precursor supply was

not excessive to match the activity of the wild-type

ISPS and may become deficient when the ISPSLN mutant with higher activity was 9



expressed. The obviously lower isoprene production by mitochondrial engineered strain in sealed-vial cultures as compared to the cytoplasmic engineered strain was in consistence with our previous observation. In our previous work, the mitochondrial engineered strain BY4742-M-04-MISPS-MISPS also showed poor growth and isoprene synthesis when cultured in sealed vials (0.8 mg/L), whereas the isoprene production was improved to 108 mg/L in aerobic batch fermentation.8 In contrast, the influence of oxygen supply on cytoplasmic engineered strain (YXM10-ISPS-ISPS) was not that significant (11 mg/L vs. 37 mg/L).7 Therefore, the poor performance of mitochondrial engineered strains in sealed-vial culture could be attributed to the conflict between the limited oxygen supply and the large oxygen demand by mitochondrial metabolism.

Figure 4. Comparison of the wild-type ISPS and ISPS mutants in mitochondria engineered and cytoplasm engineered S. cerevisiae. Cells were cultured in sealed vials. The data presented are the mean of three biological replicates. Error bars represent the standard deviations. (a) Strain BY4742-M-04-HIS with the complete MVA pathway compartmented into the mitochondria; (b) Strain YXM10 engineered by a cytoplasmic push-pull-restrain strategy.

Balance reconstruction by regulation of MVD1 and IDI1 expression. IDI1 has been long recognized to play an important role in isoprene synthesis of E. coli, by 10


Page 10 of 36

Page 11 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


shifting the balance of IPP/DMAPP pool toward DMAPP.21 However, overexpression of IDI1 in S. cerevisiae did not obviously improve isoprene production.7 To examine whether IPP/DMAPP isomerization has emerged as a new rate-limiting step in the strains

constructed

above,

IDI1

was

overexpressed

chromosomally

in

BY4742-M-04-HIS and YXM10, generating BY4742-M-05-HIS and YXM52, respectively. As a result, the isoprene production in the cytoplasm engineered YXM52-ISPSLN was slightly improved (by 14%) (Fig. 5a), whereas no obvious change

was

observed

for

the

mitochondria

engineered

strain

BY4742-M-05-HIS-ISPSLN as compared to BY4742-M-04-HIS-ISPSLN (Fig. 6a). In both cases, the biomass was not influenced. In addition, the ethanol yield in BY4742-M-05-HIS-ISPSLN was not higher than in BY4742-M-04-HIS-ISPSLN (Fig. 6b), indicating no detriment was caused on respiration by IDI1 overexpression in mitochondria.22 Excessive accumulation of the IPP/DMAPP pool would lead to growth inhibition due to the cytotoxicity of pyrophosphates,23 whereas shortage of either IPP or DMAPP would restrict the production of isoprene. Therefore, the failure to promote isoprene synthesis by IDI1 overexpression in the mitochondrial engineered strain indicated there was no excessive IPP to be converted to DMAPP.

11



Page 12 of 36

Figure 5. Balancing the metabolic flux of cytoplasm engineered S. cerevisiae through overexpression of IDI1 and MVD1. Cells were cultured in sealed vials. The data presented are the mean of three biological replicates. (a) Isoprene production and OD600. Error bars represent the standard deviations. (b) Copy numbers of MVD1 and IDI1and squalene accumulation. Data represent the means ± standard deviations.

Catalyzing the final step of the MVA pathway, MVD1 directly contributes to the IPP level. Its overexpression is therefore expected to enhance the IPP/DMAPP pool. However, isoprene production turned out to decrease by 7% and 48%, respectively, when MVD1 was overexpressed in cytoplasm engineered YXM53-ISPSLN (Fig. 5a) and

mitochondria

engineered

BY4741-M-06-HIS-ISPSLN

(Fig.

6a)

strains.

Meanwhile, the biomass was decreased by 17% and 44%, respectively. Clearly, decrease in isoprene synthesis was mainly caused by biomass loss. Correspondingly, both the byproduct (squalene) accumulation of YXM53-ISPSLN and the ethanol yield of BY4741-M-06-HIS-ISPSLN were obviously increased (Fig. 5b, Fig. 6b), demonstrating occurrence of metabolic imbalance upon MVD1 overexpression. Considering the cytotoxicity of IPP, taken together with the observation that no negative effect on biomass was caused by IDI1 overexpression, the repressed growth and decreased isoprene production could be attributed to the excessive accumulation 12


Page 13 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of IPP rather than metabolic burden caused by protein overexpression. Unlike the cytoplasm, which can detoxify IPP via natural pathways such as squalene synthesis, mitochondria lack IPP-consuming branch pathways, explaining the much more severe growth inhibition of the mitochondrial engineered strain upon MVD1 overexpression.

Figure 6. Balancing the metabolic flux of mitochondria engineered S. cerevisiae through overexpression of IDI1 and MVD1. Cells were cultured in sealed vials. The data presented are the mean of three biological replicates. (a) Isoprene production and OD600. Error bars represent the standard deviations. (b) Copy numbers of MVD1and IDI1and ethanol yield. Data represent the means ± standard deviations.

To reestablish the metabolic balance, IDI1 and MVD1 were co-overexpressed in YXM10 and BY4742-M-04-HIS, generating YXM54 and BY4741-M-07-HIS, respectively. Restoration of biomass and improvement of isoprene production were observed in both strains (Fig. 5a, Fig. 6a). Meanwhile, the ethanol yield and squalene concentration were decreased to levels similar to those of the starting strains (Fig 5b, Fig 6b). These results demonstrated better match between DMAPP supply and the ISPSLN activity upon IDI1 and MVD1 co-overexpression, accompanied with relief of 13



Page 14 of 36

IPP toxicity. However, in the mitochondrial engineered strain, growth inhibition was still not completely relieved, which is in consistence with its higher sensitivity to IPP accumulation observed above. Integrating

an

additional

copy

of

IDI1

into

the

genome

of

BY4741-M-07-HIS-ISPSLN fully restored cell growth and further improved isoprene synthesis, indicating reestablished metabolic balance (Fig. 6a). In contrast, no enhancement of isoprene production but rather slightly decreased biomass was observed when a second IDI1 copy was expressed in YXM54-ISPSLN (Fig. 5a). A similar phenomenon was found in BY4741-M-09-HIS-ISPSLN overexpressing three additional copies of IDI1 in addition to one additional copy of MVD1, implying metabolic burden caused by excessive gene overexpression. Only when MVD1 and IDI1 were co-expressed in reasonable copy numbers, obvious improvement of isoprene production could be achieved without damaging cell growth. Finally, the best engineered haploid strains YXM54-ISPSLN (Fig. 5a) and BY4741-M-08-HIS-ISPSLN (Fig. 6a) produced 19.9 mg/L and 1.54 mg/L isoprene in sealed vials, representing 45% and 196% improvement over their parent strains without additional IDI1/MVD1 (YXM10-ISPSLN and BY4741-M-04-HIS-ISPSLN), respectively.

Fermentation of diploid S. cerevisiae in 5 L bioreactor. Diploid S. cerevisiae cells have shown advantages in high-density fermentation such as higher biomass and stress tolerance. Our previous study found the diploid strain YXMH03 created by hybridization of cytoplasmic engineered YXM10 and mitochondrial engineered 14


Page 15 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


BY4741-M-04-HIS expressing the wild-type ISPS exhibited improved cell growth and isoprene productivity as compared to its haploid parents.8 Considering the sensitivity of isoprene synthesis to the IPP/DMAPP pool, expression of the ISPS mutant was comparatively analyzed using high- and low-copy-number episomal plasmids

pESC-URA-ISPSM4-MISPSM4

and

p416XWP01-ISPSM4-MISPSM4.

High-copy-number expression of ISPSM4 led to higher biomass and isoprene production together with low byproduct accumulation (Fig. 7a, Fig. 7b). In contrast, low expression level of ISPSM4 resulted in poor growth and isoprene synthesis as well as higher ethanol production, implying respiration damage caused by overaccumulation of DMAPP, which led to low isoprene yield (Table 1). Therefore, pESC was used for later experiments. In consistence with the data obtained from sealed-vial cultures, ISPSLN showed superior performance over ISPSM4, producing 549 mg/L isoprene in YXMH03 (Fig. 7b, Fig. 7c, Table 1).

Figure 7. Batch fermentation of diploid strains in a 5 L fermenter. Error bars indicate standard deviations (n=3). (a), YXMH03-low-ISPSM4; (b), YXMH03-ISPSM4; (c), YXMH03-ISPSLN; (d), YXMH32-ISPSLN. 15



Page 16 of 36

Table 1. Fermentation parameters of diploid strains in batch fermentation Strains

Growth

Titer

Yield

rate (h-1)

(g/L)

(mg/g sucrose)a

OD600

YXMH03-ISPSb

-

0.246±0.032

12.3±1.7

14.3

YXMH03-low-ISPS

0.29±0.021

0.361±0.017

18.1±2.2

12.9±0.64

YXMH03-ISPSM4

0.33±0.011

0.475±0.026

23.8±4.2

18.26±0.33

YXMH03-ISPSLN

0.32±0.021

0.549±0.030

27.5±3.9

18.42±0.035

YXMH32-ISPSLN

0.36±0.019

1.044±0.024

52.2±8.8

19.35±0.031

M4

a b

Theoretical yield, 132.6 mg/g sucrose, Ref 9. Ref 8. To evaluate the performance of the diploid strain created by integration of ISPS

engineering and pathway compartmentation, and meanwhile to investigate the role of MVD1/IDI1 balance in isoprene production, YXMH32-ISPSLN was created by hybridization of BY4741-M-08-HIS and YXM54, followed by transformation with high-copy plasmid pESC-URA-ISPSLN-MISPSLN and comparatively analyzed with YXMH-03-ISPSLN in batch fermentation. As high as 1.044 g/L of isoprene was produced by YXMH32-ISPSLN (Fig. 7d, Table 1), about 2 folds that of YXMH03-ISPSLN, unambiguously pointing to the importance of balancing the MVD1/IDI1 node. Through protein engineering and restoring balance between upstream and downstream pathways, isoprene yield in batch fermentation was improved from 12.3 mg/g sucrose to 52.2 mg/g sucrose, reaching nearly 40% of the theoretical yield (Table 1). Finally, fed-batch fermentation was performed using YXMH32-ISPSLN, achieving an OD600 of 143 and an isoprene production of 11.9 g/L (Fig. 8), which is the highest ever reported for eukaryotic cells.

16


Page 17 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8. Fed-batch fermentation of YXMH32-ISPSLN in 5 L fermenter. Error bars are represented by standard deviations (n=3).

Pathway imbalance is a commonly encountered issue in synthetic biology, leading to suboptimal production of the target metabolite. When solving the existing problems such as insufficient precursor supply and poor enzyme activity, the match between reinforced formation and conversion of metabolic intermediates should also be considered. Otherwise, new bottlenecks may emerge. Imbalance between the upstream and downstream pathway sections usually causes accumulation of toxic metabolites and reduced cell growth, limiting the efficiency of biosynthesis. For maximized production of isoprene in S. cerevisiae, we enhanced the flux of the upstream MVA pathway by co-utilization of the acetyl-CoA resources in mitochondria and cytoplasm via dual regulation, eliminated the downstream rate-limiting step by protein engineering of ISPS, and achieved an overall strengthened and meanwhile balanced isoprene synthetic pathway by fine-tuning the copy numbers of MVD1/IDI1 located at the connecting node of the upstream and downstream pathway sections. Reconstruction of balance between the upstream and downstream sections of the pathway was reflected not only by the restored biomass, but also by the significantly improved isoprene production. Finally, the diploid strain YXMH32-ISPSLN produced 17



Page 18 of 36

11.9 g/L of isoprene, which is the highest ever reported in eukaryotes. This work provided a comprehensive engineering strategy for reconstruction of metabolic balance between strengthened MVA pathway and accelerated DMAPP conversion based on variations of byproduct accumulation and biomass, which may provide useful reference for the biosynthesis of other IPP/DMAPP-derived chemicals.

METHODS Construction of plasmids and strains. For compartmentation of the isoprene synthetic pathway into mitochondria, mitochondrial localization signal (MLS) from subunit of the cytochrome oxidase (CoxIV) was fused to the N-terminus of each gene. The

nucleotide

sequence

of

MLS

is

ATGCTTTCACTACGTCAATCTATAAGATTTTTCAAGCCAGCCACAAGAACT TTGTGTAGCTCTAGATATCTGCTTCAG. For example, SalI-MLS-ISPS-HindIII was generated by PCR amplification of SalI-MLS and MLS-ISPS-HindIII using plasmid pESC-URA-ISPS-MISPS8 as the template, followed by fusion of the PCR products using overlap extension PCR. In the same manner, MLS was added to the N-termini of IDI1 and MVD1. All primers and plasmids are listed in Supporting Information. E. coli Top10 (Novagen, Merck KGaA, Darmstadt, Germany) was routinely used for plasmid propagation. For generation of ISPS mutants, saturation mutagenesis of ISPS was conducted by PCR using plasmid p416XWP01-ISPS as the template, and the PCR products were cloned into the BamHI and SalI sites of plasmid p416XWP01-URA.15 To create 18


Page 19 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


high-copy-number shuttle plasmids harboring ISPS mutants used for isoprene fermentation

in

mitochondrial

SalI-MLS-MUTANT-HindIII

was

engineering cloned

into

strains,

fragment

pESC-URA,

generating

pESC-URA-MLS-MUTANT. Fragment NotI-MUTANT-SpeI was cloned into pESC-URA-MLS-MUTANT,

generating

pESC-URA-MUTANT-MMUTANT

for

isoprene

plasmid fermentation

in

cytoplasmic/mitochondrial dual regulation diploid strains. Homologous arms were added into integrative plasmids by overlap extension PCR

24

. Fragments BamHI-IDI1-SalI and BamHI-MLS-IDI1-SalI were amplification

products from the genome of S. cerevisiae BY4741, and were cloned into the corresponding yeast integrative plasmids by a standard digestion and ligation method. MVD1 was cloned and inserted into the plasmids in a similar manner, using EcoRI and NotI as the digestion sites. Plasmids were linearized using SfiI before transformation into S. cerevisiae via the LiAc/SS carrier DNA/PEG method.25 Yeast strains used in this paper are listed in Table 2.

Table 2. List of strains used in this study Strains BY4741

Description MATa,

his3∆1,

Plasmids

Reference

leu2∆0,

None

26

leu2∆0,

None

26

None

8

met15∆0, ura3∆0 BY4742

MATα,

BY4724-C-04

BY4742,

his3∆1,

lys2∆0, ura3∆0 ∆lpp1::TCYC1-ERG10-PGAL1-PG AL10-HMGS-TADH1,

∆ho::

TTPS1-tHMG1-PGAL7-PGAL2-ER G12-TPGK1, 19



Page 20 of 36

∆dpp1::TCYC1-tHMG1-PGAL1-P GAL10-PMK-TADH1,

∆gal80::

TTPS1-MVD1-PGAL7-PGAL2-IDI1 -TPGK1 YXM10

BY4741,

(HMG1)::tHMG1,

None

7

p416XWP01-

This study

∆PERG20::PHXT1, ∆ty4::ERG10-ACS2, ∆GAL80::LEU2 YXM10-ISPSLN

YXM10

ISPSLN YXM52

YXM10,

None

This study

p416XWP01-

This study

∆ura3::TADH1-MCS-PGAL10PGAL1-IDI1-TCYC1 YXM52-ISPSLN

YXM52

ISPSLN YXM53

YXM10,

∆ura3::

None

This study

p416XWP01-

This study

TADH1-MVD1-PGAL10-PGAL1MCS-TCYC1 YXM53-ISPSLN

YXM53

YXM54

YXM10,

ISPSLN None

This study

p416XWP01-

This study

∆ura3::TADH1-MVD1-PGAL10PGAL1-IDI1-TCYC1 YXM54-ISPSLN

YXM54

ISPSLN YXM55

YXM54,

None

This study

p416XWP01-

This study

∆ho::TADH1-MCS-PGAL10-PGAL1 -IDI1-TCYC1 YXM55-ISPSLN

YXM55

ISPSLN BY4742-M-04-HIS

BY4742,

None

8

p416XWP01

This study

∆lpp1::TCYC1-ERG10-MLSPGAL1-PGAL10-MLS-HMGSTADH1,∆ho::TTPS1-tHMG1-ML S-PGAL7-PGAL2-MLS-ERG12TPGK1, ∆dpp1::TCYC1-tHMG1MLS-PGAL1-PGAL10-MLS-PMKTADH1, ∆gal80::TTPS1-MVD1MLS-PGAL7-PGAL2-MLS-IDI1TPGK1, his3:: HIS3 BY4742-M-04-HIS-

BY4742-M-04-HIS


-MISPSLN BY4742-M-04-HIS,

None

∆ura3::TADH1-MCS-PGAL1020


This study

Page 21 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


PGAL1-MLS-IDI1-TCYC1 BY4742-M-05-HIS-

BY4742-M-05-HIS

p416XWP01

BY4742-M-06-HIS

This study

-MISPSLN

ISPSLN BY4742-M-04-HIS,

None

This study

∆ura3::TADH1-MVD1-MLSPGAL10-PGAL1-MCS-TCYC1 BY4742-M-06-HIS-

BY4742-M-06-HIS

p416XWP01



None

This study

BY4742-M-07-HIS,

p416XWP01

This study

BY4742-M-07-HIS,

None

This study

p416XWP01

This study

∆ura3::TADH1-MVD1-MLSPGAL10-PGAL1-MLS-IDI1-TCYC1 BY4742-M-07-HISISPSLN BY4742-M-08-HIS

-MISPSLN ∆lys2::TADH1-MCS-PGAL10PGAL1-MLS-IDI1-TCYC1

BY4742-M-08-HIS-

BY4742-M-08-HIS



None

This study

p416XWP01

This study

∆ty4::TADH1-MCS-PGAL10PGAL1-MLS-IDI1-TCYC1 BY4742-M-09-HIS-

BY4742-M-09-HIS

ISPSLN

-MISPSLN None

8

Diploid BY4742-M-04-HIS x

p416XWP01-

This study

YXM10

ISPSM4- MISPSM4


pESC-URA-ISPSM4-

YXM10

MISPSM4

YXMH03-ISPSLN


pESC-URA-ISPSLN-

YXM54

MISPSLN

YXMH32


None

This study


pESC-URA-ISPSLN-

This study

YXM54

MISPSLN

YXMH03


YXMH03-low-ISPSM4

YXM10

YXMH03-ISPSM4

This study This study

YXM54 YXMH32-ISPSLN

PrimeStar DNA polymerase, T4 ligase and all restriction enzymes were purchased from Takara (Dalian, China). Molecular docking analysis of ISPS. SWISS-MODEL27 was used to perform 21



homology modeling of ISPS using 3N0F (PDB ID) as the template. Based on the structural model, molecular docking analysis was conducted for the wild-type ISPS and its mutants using AutoDock Vina.28 Media and culture conditions in sealed vials. Considering the low boiling point (34°C) of isoprene, sealed vials were used for shake-flask experiments. Synthetic complete drop-out medium7 was used for cultivation of recombinant yeast transformed with plasmids harboring ISPS or its mutants. Glucose and sucrose were used respectively as the carbon source in synthetic complete drop-out medium (SD-URA and SS-URA for short).8 All haploids were transformed with low-copy-number plasmids derived from p416XWP01-ISPS. Single yeast colonies were picked into 5 mL SD-URA medium, and cultivated at 30 °C, 220 rpm for 24 h. The seed broth was then inoculated into 17 mL sealed vials containing 3 mL SS-URA medium to an initial OD600 of 0.05 and incubated at 30 °C, 220 rpm for 24 h. Gas Chromatography (GC) analysis of isoprene. Isoprene was analyzed by a GC system (Fuli, Wenling, China) equipped with an HP-FFAP column (30 m × 0.25 mm, 0.25 µm, Agilent) and a flame ionization detector (FID), under detection condition of 80 °C oven temperature, 180 °C injector temperature and 180°C detector temperature. Two hundred microliter of sample from headspace of sealed vials or off-gas of the fermenter was injected into the GC system. Isoprene standard was purchased from Aladdin (Shanghai, China). High Performance Liquid Chromatography (HPLC) analysis of sugars, ethanol and squalene. Sugars and ethanol were measured at 45°C by HPLC system 22


Page 22 of 36

Page 23 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


equipped with a refractive-index detector (LC-20AT, Shimadzu) and a Bio-Rad HPX-87H column using 5 mM H2SO4 as mobile phase at a flow rate of 0.6 mL min-1. Squalene was extracted using hot HCl-acetone method24 and analyzed by HPLC equipped with a C18 column under conditions previously described.29 All standard compounds were purchased from Sigma-Aldrich (St. Louis, MO). Batch and fed-batch fermentation in 5 L bioreactor. Single colonies were picked into 5 mL SD-URA medium and incubated at 30 °C, 220 rpm for 24 h. The seed culture was inoculated into three flasks of 100 mL fermentation medium,30 consisting of 25 g/L glucose, 15 g/L (NH4)2SO4, 8 g/L KH2PO4, 3 g/L MgSO4, 0.72 g/L, ZnSO4·7H2O, 12 mL/L vitamin solution and 10 mL/L trace elements solution, to an initial OD600 of 0.05 and cultivated at 30 °C, 220rpm, for 24 h. Three hundred milliliter of the seed culture was inoculated into a 5 L bioreactor containing 2.5 L of fermentation medium (sucrose instead of glucose was used as the carbon source)8 for batch fermentation. Fermentation in the bioreactor was conducted at 30 °C, 400 rpm, with an air flow rate of 1-3 vvm and an overpressure of 0.05 MPa, and pH was maintained at 5.5 by automatic addition of ammonium hydroxide. Off-gas and fermentation broth were sampled for analysis at intervals. For fed-batch fermentation. The fermentation conditions were the same as those described above for batch fermentation. Feeding was started at 20 h when the ethanol concentration dropped to below 3 g/L. The feeding solution contained 500 g/L glucose, 9.0 g/L KH2PO4, 2.5 g/L MgSO4, 3.5 g/L K2SO4, 0.28 g/L Na2SO4, 10 mL/L trace elements solution and 12 mL/L vitamin solution. Ammonium hydroxide was 23



used not only to maintain the set pH, but also to provide nitrogen source. Isoprene and OD600 were determined every three hours.

ASSOCIATED CONTENT Supporting Information Brief descriptions in nonsentence format listing the contents of the files supplied as Supporting Information.

AUTHOR INFORMATION Corresponding Author *E-mail: [email protected] *E-mail: [email protected] ORCID Lidan Ye: 0000-0002-6248-8457 Hongwei Yu: 0000-0002-9144-4496

Author Contributions Z. Y., L. Y., and H. Y. designed the study and prepared the manuscript. Z.Y and P. Z. performed saturation mutagenesis, metabolic engineering and fermentation experiments. B. S. and S. S. analyzed the data of docking results. Z. Y., and L. Y. analyzed and discussed the results. ACKNOWLEDGEMENTS This work was financially supported by the Natural Science Foundation of China (Grant Nos. 21576234 and 21776244) and Qianjiang Talents Project of Zhejiang Province. REFERENCES (1).

Zhao, Y., Yang, J., Qin, B., Li, Y., Sun, Y., Su, S., and Xian, M. (2011) Biosynthesis of isoprene in Escherichia coli via methylerythritol phosphate 24


Page 24 of 36

Page 25 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(2).

(3).

(4).

(5).

(6).

(7).

(8).

(9).

(10).

(11).

(12).

(13).

(14).

(MEP) pathway. Appl. Microbiol. Biotechnol. 90, 1915-1922. Lv, X., Xu, H., and Yu, H. (2012) Significantly enhanced production of isoprene by ordered coexpression of genes dxs, dxr, and idi in Escherichia coli. Appl. Microbiol. Biotechnol. 97, 2357-2365. Yang, J., Xian, M., Su, S., Zhao, G., Nie, Q., Jiang, X., Zheng, Y., and Liu, W. (2012) Enhancing Production of Bio-Isoprene Using Hybrid MVA Pathway and Isoprene Synthase in E. coli. PloS One 7, e33509. Zurbriggen, A., Kirst, H., and Melis, A. (2012) Isoprene Production Via the Mevalonic Acid Pathway in Escherichia coli (Bacteria). BioEnergy Res. 5, 814-828. Yang, C., Gao, X., Jiang, Y., Sun, B., Gao, F., and Yang, S. (2016) Synergy between methylerythritol phosphate pathway and mevalonate pathway for isoprene production in Escherichia coli. Metab. Eng. 37, 79-91. Hong, S. Y., Zurbriggen, A. S., and Melis, A. (2012) Isoprene hydrocarbons production upon heterologous transformation of Saccharomyces cerevisiae. J. Appl. Microbiol. 113, 52-65. Lv, X., Xie, W., Lu, W., Guo, F., Gu, J., Yu, H., and Ye, L. (2014) Enhanced isoprene biosynthesis in Saccharomyces cerevisiae by engineering of the native acetyl-CoA and mevalonic acid pathways with a push-pull-restrain strategy. J. Biotechnol. 186, 128-136. Lv, X., Wang, F., Zhou, P., Ye, L., Xie, W., Xu, H., and Yu, H. (2016) Dual regulation of cytoplasmic and mitochondrial acetyl-CoA utilization for improved isoprene production in Saccharomyces cerevisiae. Nat. Commun. 7, 12851. Wang, F., Lv, X., Xie, W., Zhou, P., Zhu, Y., Yao, Z., Yang, C., Yang, X., Ye, L., and Yu, H. (2017) Combining Gal4p-mediated expression enhancement and directed evolution of isoprene synthase to improve isoprene production in Saccharomyces cerevisiae. Metab. Eng. 39, 257-266. Pfleger, B. F., Pitera, D. J., Smolke, C. D., and Keasling, J. D. (2006) Combinatorial engineering of intergenic regions in operons tunes expression of multiple genes. Nat. Biotechnol. 24, 1027-1032. Pitera, D. J., Paddon, C. J., Newman, J. D., and Keasling, J. D. (2007) Balancing a heterologous mevalonate pathway for improved isoprenoid production in Escherichia coli. Metab. Eng. 9, 193-207. Withers, S. T., Gottlieb, S. S., Lieu, B., Newman, J. D., and Keasling, J. D. (2007) Identification of Isopentenol Biosynthetic Genes from Bacillus subtilis by a Screening Method Based on Isoprenoid Precursor Toxicity. Appl. Environ. Microbiol. 73, 6277-6283. Anthony, J. R., Anthony, L. C., Nowroozi, F., Kwon, G., Newman, J. D., and Keasling, J. D. (2009) Optimization of the mevalonate-based isoprenoid biosynthetic pathway in Escherichia coli for production of the anti-malarial drug precursor amorpha-4,11-diene. Metab. Eng. 11, 13-19. Li, Q., Fan, F., Gao, X., Yang, C., Bi, C., Tang, J., Liu, T., and Zhang, X. (2017) Balanced activation of IspG and IspH to eliminate MEP intermediate 25



(15).

(16).

(17). (18).

(19).

(20).

(21).

(22).

(23).

(24).

(25). (26).

(27).

(28).

accumulation and improve isoprenoids production in Escherichia coli. Metab. Eng. 44, 13-21. Xie, W., Ye, L., Lv, X., Xu, H., and Yu, H. (2015) Sequential control of biosynthetic pathways for balanced utilization of metabolic intermediates in Saccharomyces cerevisiae. Metab. Eng. 28, 8-18. Köksal, M., Zimmer, I., Schnitzler, J.-P., and Christianson, D. W. (2010) Structure of Isoprene Synthase Illuminates the Chemical Mechanism of Teragram Atmospheric Carbon Emission. J. Mol. Biol. 402, 363-373. Dill, K. A. (1985) Theory for the Folding and Stability of Globular Proteins. Biochemistry 24, 1501-1509. Kauzmann, W. (1959) Some Factors in the Interpretation of Protein Denaturation. In Advances in Protein Chemistry (Anfinsen, C. B., Anson, M. L., Bailey, K., and Edsall, J. T., Eds.), pp 1-63. Shental-Bechor, D., and Levy, Y. (2008) Effect of glycosylation on protein folding: A close look at thermodynamic stabilization. Proc. Natl. Acad. Sci. USA 105, 8256-8261. Mills, B. J., and Laurence Chadwick, J. S. (2018) Effects of localized interactions and surface properties on stability of protein-based therapeutics. J. Pharm. Pharmacol. 70, 609-624. Zhou, C., Li, Z., Wiberley-Bradford, A. E., Weise, S. E., and Sharkey, T. D. (2013) Isopentenyl diphosphate and dimethylallyl diphosphate/isopentenyl diphosphate ratio measured with recombinant isopentenyl diphosphate isomerase and isoprene synthase. Anal Biochem 440, 130. Vemuri, G. N., Eiteman, M. A., McEwen, J. E., Olsson, L., and Nielsen, J. (2007) Increasing NADH oxidation reduces overflow metabolism in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 104, 2402-2407. Martin, V. J. J., Pitera, D. J., Withers, S. T., Newman, J. D., and Keasling, J. D. (2003) Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nat. Biotechnol. 21, 796. Xie, W., Liu, M., Lv, X., Lu, W., Gu, J., and Yu, H. (2014) Construction of a Controllable b-Carotene Biosynthetic Pathway by Decentralized Assembly Strategy in Saccharomyces cerevisiae. Biotechnol. Bioeng. 111, 125-133. Gietz, R. D., and Schiestl, R. H. (2007) High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2, 31-34. Brachmann, C. B., Davies, A., Cost, G. J., Caputo, E., Li, J., Hieter, P., and Boeke, J. D. (1998) Designer Deletion Strains derived from Saccharomyces cerevisiae S288C: a Useful set of Strains and Plasmids for PCR-mediated Gene Disruption and Other Applications. YEAST 14, 115-132. Waterhouse, A., Bertoni, M., Bienert, S., Studer, G., Tauriello, G., Gumienny, R., Heer, F. T., de Beer, T. A P., Rempfer, C., Bordoli, L., Lepore, R., and Schwede, T. (2018) SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res., gky427-gky427. Trott, O., and Olson, A. J. (2009) AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and 26


Page 26 of 36

Page 27 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(29).

(30).

multithreading. J. Comput. Chem., NA-NA. Xie, W., Lv, X., Ye, L., Zhou, P., and Yu, H. (2015) Construction of lycopene-overproducing Saccharomyces cerevisiae by combining directed evolution and metabolic engineering. Metab. Eng. 30, 69-78. Hoek, P. V., Hulster, E. D., Dijken, J. P. V., and Pronk, J. T. (2000) Fermentative Capacity in High-Cell-Density Fed-Batch Cultures of Baker' Yeast. Biotechnol. Bioeng. 68, 517-523.

27



Table of Contents

28


Page 28 of 36

Page 29 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Combinatorial engineering of isoprene biosynthesis in S. cerevisiae by pathway compartmentation, protein engineering and fine-tuning of the connecting node. The upstream section of the isoprene synthetic pathway was engineered by mitochondrial compartmentalization and cytoplasmic push-pull-restrain regulation of the MVA pathway to enhance precursor supply, whereas the downstream pathway section was strengthened by protein engineering of ISPS. Flux imbalance between the pathway sections led to suboptimal isoprene production and/or repressed cell growth. To reconstruct metabolic balance between the separately enhanced upstream and downstream pathway sections, the generation and interconversion of the IPP/DMAPP pool as the connecting node was carefully regulated. Enlarged font of "MVA pathway" represents strengthening of MVA pathway by the cytoplasmic push-pull-restrain strategy. Dashed arrow towards squalene indicates down-regulation of the competitive squalene synthetic pathway. Green valves represent the rate-limiting enzymes, and red curved arrows denote regulation of the enzyme activity or expression. 340x98mm (300 x 300 DPI)



Figure 2. Fractional changes in isoprene titers of single-site mutants generated by saturation mutagenesis at site 340 (a), site 570 (b) and double-site mutants constructed by combinatorial mutagenesis (c) as shown by isoprene production of BY4742-C-04 in sealed vials. Combined mutants indicate double substitutions at both 340 and 570 loci (For example, mutant IC represents combination of F340I and A570C). WT means wild-type ISPS. BY4742-C-04 harboring ISPSM4 (F340L/A570T) was included as an additional control. The data presented are the mean of three biological replicates. Error bars represent the standard deviations. 271x178mm (300 x 300 DPI)


Page 30 of 36

Page 31 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Structure of the ISPS-DMAPP complex. Structural models were constructed based on 3N0F (PDB ID) as the template by SWISS-MODEL and molecular docking analysis was conducted for the wild-type ISPS and its mutants using AutoDock Vina. (a) Active site pocket of ISPS and its mutants; (b) Protein surface. Red, DMAPP; green, amino acid residues; gray, protein. 340x246mm (300 x 300 DPI)



Figure 4. Comparison of the wild-type ISPS and ISPS mutants in mitochondria engineered and cytoplasm engineered S. cerevisiae. Cells were cultured in sealed vials. The data presented are the mean of three biological replicates. Error bars represent the standard deviations. (a) Strain BY4742-M-04-HIS with the complete MVA pathway compartmented into the mitochondria; (b) Strain YXM10 engineered by a cytoplasmic push-pull-restrain strategy. 300x115mm (300 x 300 DPI)


Page 32 of 36

Page 33 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. Balancing the metabolic flux of cytoplasm engineered S. cerevisiae through overexpression of IDI1 and MVD1. Cells were cultured in sealed vials. The data presented are the mean of three biological replicates. (a) Isoprene production and OD600. Error bars represent the standard deviations. (b) Copy numbers of MVD1 and IDI1and squalene accumulation. Data represent the means ± standard deviations. 313x173mm (300 x 300 DPI)



Figure 6. Balancing the metabolic flux of mitochondria engineered S. cerevisiae through overexpression of IDI1 and MVD1. Cells were cultured in sealed vials. The data presented are the mean of three biological replicates. (a) Isoprene production and OD600. Error bars represent the standard deviations. (b) Copy numbers of MVD1and IDI1and ethanol yield. Data represent the means ± standard deviations. 301x173mm (300 x 300 DPI)


Page 34 of 36

Page 35 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. Batch fermentation of diploid strains in a 5 L fermenter. Error bars indicate standard deviations (n=3). (a), YXMH03-low-ISPSM4; (b), YXMH03-ISPSM4; (c), YXMH03-ISPSLN; (d), YXMH32-ISPSLN. 336x188mm (300 x 300 DPI)



Figure 8. Fed-batch fermentation of YXMH32-ISPSLN in 5 L fermenter. Error bars are represented by standard deviations (n=3). 137x97mm (300 x 300 DPI)


Page 36 of 36

Enhanced isoprene production by reconstruction of metabolic balance

Recommend Documents