Enhanced Osteogenic Activity of TiO2 Nanorod Films with Microscaled

Subscriber access provided by UNIV OSNABRUECK

Article 2

Enhanced osteogenic activity of TiO nanorod films with micro-scaled distribution of Zn-CaP Meng He, Xiaoyi Chen, Kui Cheng, Wen-Jian Weng, and Huiming Wang ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.6b01284 • Publication Date (Web): 01 Mar 2016 Downloaded from http://pubs.acs.org on March 2, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Enhanced osteogenic activity of TiO2 nanorod films with micro-scaled distribution of Zn-CaP Meng Hea, 1, Xiaoyi Chenb, 1, Kui Chenga, Wenjian Wenga, *, Huiming Wangb,* a

School of Materials Science and Engineering, State Key Laboratory of Silicon Materials, Zhejiang University, Hangzhou 310027, China. b The Affiliated Stomatology Hospital of Medical College, Zhejiang University, Hangzhou 310003, China. *Wenjian Weng: E-mail: [email protected], *Huiming Wang: E-mail: [email protected] Abstract The topography at micro/nano-scale and bioactive composition of material surfaces have been thought to play vital roles in their interactions with cells. However, it is still a challenge to further modify on special topography with biodegradable composition or vice versa. In this study, TiO2 nanorod films covered with microscale-distributed Zn-containing calcium phosphate (Zn-CaP) were prepared, trying to create a micro/nano-scale topography and Zn2+ release capability. MC3T3-E1 cells cultured on TiO2 nanorod film with sparsely distributed Zn-CaP (TiO2/S-ZCP) had significantly higher biological responses than those on the films with densely distributed Zn-CaP (TiO2/D-ZCP) and full-covered Zn-CaP (F-ZCP). TiO2/S-ZCP film was demonstrated to facilitate osteogenic differentiation much more strongly than F-ZCP and TiO2/D-ZCP films based on evaluations of ALP, related gene expressions and ECM mineralization. The higher osteogenic differentiation on TiO2/S-ZCP film is ascribed to that the micro/nano-scale topography from Zn-CaP coverage promotes cell adhesion and filopodia extension, and induces differentiation-orientation in initial stage; And consequently Zn2+ release results in enhancement of differentiation. Therefore, we believe that a better organization of the micro/nanotopography and bioactive ion release in surface would be a promising way to enhance osteogenic activity for orthopedic and dental implants. Keywords: TiO2 nanorods, nanotopography, microtopography, calcium phosphate, Zinc, osteogenesis 1. Introduction Metallic implants, such as titanium (Ti) and tantalum (Ta), are commonly used in orthopedics and dentistry due to their good mechanical properties and excellent biocompatibility1-3, but the pure metallic surface fails to meet the demand of osseointegration. Surface modification was extensively adopted to improve osteoconductive and osteoinductive properties via structural or compositional variations. Micro/nano structured surfaces are often used in surface modifications to alter cell behaviors including adhesion, orientation, cell differentiation and migration significantly4, 5, because the structural modification could offer the surface unique properties in topography, wettability and surface energy. Cells interact with native topographical structures in many ways, often through a naturally occurring phenomenon known as contact guidance, which is 1

These authors contributed equally to this work.

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

characterized by the response of cells to structures on the micrometer and sub-micrometer scale6. With contact guidance, cells adhere and spread with type-specific cell morphology due to cell-surface mechanotransduction7, followed by migration, proliferation and differentiation8-12. Microscaled topography influences cell shape and cytoskeletal tension13, which further result in a differentiated phenotype. Micro/nano gratings/grooves were observed to facilitate differentiation of stem cells to myoblasts14, fibroblasts15 and neuroblast6. In addition, round geometry is beneficial to differentiation of stem cells to adipocytes, while star-shaped micropattern with sharp angle or slightly lengthened micropattern is beneficial to differentiation of stem cells to osteoblasts16. Moreover, cells differentiate along the osteogenic lineage under the restriction effect of microwell on cell size17. On the other hand, nanotopography exhibits unique surface properties thanks to their significantly increased surface area, similar dimensional scale with bone collagen fibrils and elasticity resembling that of tissues4. It is believed that nanoscale patterning involves regulation of the cell-substrate interaction through control of integrin binding sites4. The nanostructured surfaces could be constructed as nanoparticles18, nanowires19, nanotubes20 and nanorods21. In researches investigated simultaneously micro and nano topography7, 22, it has been manifested that nanotopography regulates osteoblasts proliferation, while microsacle structure significantly enhances osteoblast differentiation. Among micro/nano structured surfaces, TiO2 nanorod film has been proved to be a good topologic structure to promote cellular filopodia extension and focal adhesion formation in initial cell growth23. In compositional modification24-26, calcium phosphate (CaP)21, 27, 28 is mainly adopted in a form of coatings. The release of Ca2+ and PO43- from CaP in body favors mineralization of bone matrix and facilitates osteointegration of implants with bone. In order to further increase osteogenic activity, ionic incorporations in CaP, such as magnesium (Mg), strontium (Sr) and zinc (Zn), have been a subject of great interest29. Compared with other ions, Zn is an essential trace element in human body to promote osteoblastic cell proliferation and differentiation29 and to inhibit bone resorption via suppressing the formation of osteoclastic cells30. It has been reported that Zn incorporation into CaP could improve bioactivity and adjust the degradation rate of CaP to ensure a relatively longer biological functions29. In addition, Zn-containing CaP (Zn-CaP) has significantly higher osteoinductive activity especially differentiation enhancement of pre-osteoblastic cells. As a biodegradable biomaterial, it is imperative that CaP undergoes the process of degradation, which allows for the space to be created for new bone tissue to form and infiltrate within the implanted graft material31. Containing a variety of compounds, CaP shows diverse biodegradation behavior. Furthermore, it is thought to take place via solution-driven extracellular liquid dissolution and cell-mediated resorption processes32, whereas CaP facilitates formation of bone-like HA via reprecipitating with intracorporal Ca2+ and PO43-33. In general, CaP exhibits a long-term biodegradation. However, effect of Zn2+ is dose-dependent34, 35. Slow biodegradation could not meet the demand of an appropriate release behavior from a Zn-containing coating. Taken together, it is still a key problem to further modify on special topography with biodegradable composition or vice versa. In addition, effects of time-varying micro/nano topography on cells need to be investigated. In this work, TiO2 nanorod film was used as a nano-sized structured surface, and Zn-CaP was discontinuously distributed onto the film to create both a micro-sized topography and


Page 2 of 21

Page 3 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


compositional modification. The TiO2 nanorod films with micro-scaled distribution of Zn-CaP were characterized, and the influence of different Zn-CaP coverage on initial cell adhesion and spreading, proliferation, differentiation, and osteogenesis related gene expressions as well as ECM mineralization was evaluated by culturing pre-osteoblastic cells and also discussed. 2. Materials and Methods 2.1. Materials Ta (tantalum metal, Baoji Lihua Non-ferrous Metals Co. Ltd.) substrates in dimensions of 10 mm×10 mm×0.5 mm were used for preparation of all samples. They were ultrasonically cleaned in acetone (Sinopharm Chemical Reagent Co. Ltd.), absolute ethanol (Sinopharm Chemical Reagent Co. Ltd.) and deionized water in sequence, followed by drying in ambient air. Acetylacetone (AcAc, Aladdin), tetrabutyl tianate (TBOT, Aladdin), polyvinyl pyrrolidone (PVP K30, molecular weight = 58,000, Aladdin), calcium nitrate tetrahydrate (Ca(NO3)2·4H2O, Sinopharm Chemical Reagent Co. Ltd.), zinc nitrate hexahydrate (Zn(NO3)2·6H2O, Sinopharm Chemical Reagent Co. Ltd.), diammonium hydrogen phospate ((NH4)2HPO4, Sinopharm Chemical Reagent Co. Ltd.), polyethylene glycol (PEG, average Mn = 10000, Aladdin), ammonia solution (Sinopharm Chemical Reagent Co. Ltd.), hydrochloric acid (HCl, 36%~38% by weight, Sinopharm Chemical Reagent Co. Ltd.) were used without further purification. Mouse calvaria-derived pre-osteoblastic cells (MC3T3-E1, CRL-2594, ATCC) were utilized in the study. Other biochemical reagent will be given in the sections of related experiments below. 2.2. Samples preparation 2.2.1. Preparation of TiO2 nanorods film Preparation of TiO2 nanorods film was same as our pre-research through 2 steps23. Briefly, in the first step, absolute ethanol, deionized water, AcAc, TBOT (molar ratio of AcAc/TBOT/H2O = 0.3/1/1)and PVP were mixed to prepare TiO2 nanodots film on Ta substrate by spin-coating at 8000 rpm for 40s8.Then the spin-coated substrates were heated at 500 ℃ for 2 h in a muffle furnace. Hydrothermal treatment was adopted to procure TiO2 nanorods film in the second step. 1020 μL TBOT was added into the mixture of 48.98 mL concentrated HCl and 50 mL deionized water. Mother solution was obtained after stirring until clearly. A 100 mL Teflon vessel was filled with 80 mL mother solution and a nanodots-coated substrate was placed against the wall of the vessel with the coated side facing down at an angle. The vessel was sealed in same sized stainless steel autoclave. Hydrothermal process was set at 160 ℃ for 2 h in a drying oven. The autoclave was after cooling to room temperature. The samples was picked off, rinsed with enough deionized water and ethanol, and allowed to dry in ambient air. 2.2.2. Preparation of Zn-containing CaP suspension Ca(NO3)2·4H2O and Zn(NO3)2·6H2O were dissolved in deionized water to form mixed solution (with total concentration of Ca and Zn = 0.1 mol/L, molar ratio of Zn/Ca = 1:9). After stirring, PEG (molar ratio of EG/(Ca+Zn)=10:1) was added in the solution and vigorously stirred in ice-water bath. (NH4)2HPO4 solution (0.15 M) was added dropwise to the above solution propare a gelatinous precipitate. The pH was maintained at 10 by adding



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ammonia solution during the reaction process. Zn-containing CaP suspension was obtained with further stirring after finishing dropping. 2.2.3. Preparation of TiO2 nanorod films incorporated by Zn-CaP The Zn-CaP (100 μL/plate) was deposited on the Ta substrates with TiO2 nanorods through spin-coating at 3000 rpm (Densely distributed) or 5000 rpm (Sparsely distributed) for 60 s. For full-covered samples, dual-speed spin-coating was adopted on Ta substrates without TiO2 nanorods as 500 rpm for 10 s followed by 1000 rpm for 60 s. Then samples were left to evaporate the volatile components for 24 h in an environment with constant humidity and temperature. After that, they were heated from room temperature to 500 ℃ with heating rate of 8 ℃· min-1 and annealed for 2 h. Zn-CaP distributed on the top of TiO2 nanorods layer. After heating treatment, firm bonding between Zn-CaP and TiO2 nanorods formed. Ta substrates with and without TiO2 nanorods were used as controls. 2.3. Surface characterization Field-emission scanning electron microscope (FE-SEM, Hitachi SU-70, working voltage at 3 kV) was employed to observe the surface topography of the samples as well as initial adhesion of cells on different samples. Roughness of TiO2/D-ZCP and TiO2/S-ZCP was measured with a profiler instrument (KLA/Tencor D-100). A number of full-covered samples were used to scratch enough Zn-CaP powder out of surface for crystal phase identification. It was detected with an X-ray diffractometer (XRD, Thermo ARL X'TRA). 2.4. Zn2+ release The samples of Zn-CaP coated Ta substrates with or without TiO2 nanorods were soaked in 10 mL Tris-HCl buffer solution (pH=7.4) at 37 ℃ for 1, 3, 7 and 14 days. The soaking solutions were refreshed after every time point mentioned above. As a representative in Zn-CaP, the amounts of released Zn2+ were detected by analyzing the resulting solutions with an inductively coupled plasma mass spectrometry (ICP-MS, Thermo Fisher Scientific XSENIES). 2.5. In vitro osteogenic activity 2.5.1. Cell culture MC3T3-E1 cells (pre-osteoblastic cells, CRL-2594, ATCC) were cultured on various samples in alpha-modified Minimum Essential Medium (Alpha-MEM, Gibco) supplemented with 1% sodium pyruvate (Gibco), 1% MEM non-essential amino acids (Gibco), 1% antibiotic solution containing 10,000 units/mL penicillin and 10 mg/mL streptomycin (Gibco), and 10% fetal bovine serum (FBS, PAA, Australia) under a humidified 5.0% CO2 atmosphere at 37 ℃. Sub-confluent cells growing on tissue culture polystyrene (TCPS) were trypsinized with 0.25% trypsin containting 1 mM EDTA (Gibco), and were subcultured on various samples. 2.5.2. Cell viability Cell viability was determined by AlamarBlueTM method after culturing 1, 3, 7 days. The MC3T3-E1 cells with a density of 2.0 × 104 cells/mL were seeded on the samples. At each test


Page 4 of 21

Page 5 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


time point, the samples were rinsed with PBS twice and 500 μL fresh medium containing 5% AlamarBlueTM was added. After incubating for 4 h, the absorbance values of 100 μL medium were recorded at 570 and 600 nm. The results were calculated following the instruction of AlamarBlueTM assay. 2.5.3. Cell morphology After culturing for 24 h, the samples were rinsed with PBS twice and fixed with 2.5% glutaraldehyde. After that, the cells were dehydrated on samples with gradient ethanol solutions (30, 50, 75, 90, 95 and 100 v/v % in sequence) for 10 min each. Afterwards, the samples were dried in hexamethyl disilazane ethanol solution. SEM was employed to observe cell morphology. 2.5.4. ALP activity assay The MC3T3-E1 cells with a density of 2.0 ×104 cells/mL (for 7 days) or 1.0 × 104 cells/mL (for 14 days) were seeded on the samples (three replicates). After incubation for 7 or 14 days, culture medium was removed, the samples were rinsed with PBS for three times. In new 24-well culture plates, the cells cultured on samples were lysed with CelLytic Buffer (Sigma). The cell lysate was centrifuged at 4 ℃ for 15 min, and aliquots of supernatants were used for ALP activity measurement. The ALP activity was tested via measuring the optical density at a wavelength of 405 nm for the quantitative assay and normalized to total protein contents tested in a BCA protein assay. 2.5.5. Osteocalcin secretion The MC3T3-E1 cells (the cell density was the same as that used in ALP activity assay) were seeded on the samples (three replicates). After incubation for 7 and 14 days, the production of osteocalcin (OCN) was measured with Mouse Osteocalcin EIA Kit (Biomedical Technologies, Stoughton, MA) as the release of extracellular matrix protein into the culture medium. Briefly, the samples and standards were measured in a 96-well plate. After adding monoclonal mouse anti-OC antibody, the samples were incubated with conjugated anti-mouse antibodies. The quantitative OCN were determined via measuring the optical density at a wavelength of 405 nm. 2.5.6. Quantitative real-time PCR assay The expression of osteogenesis-related genes was examined through real-time PCR assay. The MC3T3-E1 cells with a density of 2.0 ×104 cells/mL (for 7 days) or 1.0 × 104 cells/mL (for 14 days) were seeded on the samples (three replicates). The total RNA was extracted using TRIzol reagent and the cDNA was reverse transcribed from 1.0 μg RNA. RT-PCR was conducted on the Roche LightCycler480 system with a SYBR Green I matermix. The relative expression of osteogenesis-related genes (ALP, Col-I, Runx2, BMP-2 and OCN) was normalized to that of the reference gene F-actin. The primers for RT-PCR are shown in Table 1. Table 1. Primers used for RT-PCR. Gene Forward primer sequence (5’-3’) Reverse primer sequence (5’-3’) ALP CCAGAAAGACACCTTGACTGTGG TCTTGTCCGTGTCGCTCACCAT



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Col-1 Runx-2 BMP-2 OCN F-actin

CCTCAGGGTATTGCTGGACAAC CCTGAACTCTGCACCAAGTCCT AACACCGTGCGCAGCTTCCATC GCAATAAGGTAGTGAACAGACTCC CACCCGCGAGTACAACCTTC

CAGAAGGACCTTGTTTGCCAGG TCATCTGGCTCAGATAGGAGGG CGGAAGATCTGGAGTTCTGCAG CCATAGATGCGTTTGTAGGCGG CCCATACCCACCATCACACC

2.5.7. Extracellular matrix mineralization Extracellular matrix (ECM) mineralization on the different samples was quantified through Alizarin Red staining. The MC3T3-E1 cells with a density of 1.0 ×104 cells/mL (for 14 days) or 0.5 × 104 cells/mL (for 21 days) were seeded on the samples (three replicates). After 14-day or 21-day incubation, the samples were washed with PBS twice, fixed in 5% paraformaldehyde for 1 h, and stained with 40 mM Alizarin Red for 10 min. Afterwards, 560 μL of 10% acetic acid was added to each well, and then neutralized with 40 μL of 10% ammonia hydroxide. After that, the OD values of absorbance at 600 nm were measured. 2.6. Statistical analysis The data were shown as mean ± standard deviation and analyzed using one-way ANOVA followed by Tukey’s post hoc test, p value

Enhanced Osteogenic Activity of TiO2 Nanorod Films with Microscaled

Recommend Documents