Note pubs.acs.org/jnp
Enhancement of Angiogenesis by a 27 kDa Lectin from Perivitelline Fluid of Horseshoe Crab Embryos through Upregulation of VEGF and Its Receptor K. L. Surekha, Meenal Waghchoude,† and Surendra Ghaskadbi* Zoology Group, Division of Animal Sciences, Agharkar Research Institute, Pune-411 004, India ABSTRACT: Angiogenesis, the expansion of a capillary network, is implicated in several pathological conditions. Drug-based inhibition of angiogenesis is being explored as therapy. Conversely, therapeutic angiogenesis contributes to control conditions such as ischemia. Here we report pro-angiogenic activity of perivitelline fluid (PVF) from Indian horseshoe crab embryos and one of its purified fractions, a 27 kDa lectin, using the chick embryonic chorioallantoic membrane assay. Enhancement in number and diameter of blood vessels after treatment with PVF and lectin suggested their pro-angiogenic effect. Quantitative RT-PCR showed that this effect is mediated through modulation of expression of VEGF and VEGFR-2/kinase domain receptor genes.
A
lectin possess pro-angiogenic activity. Further, by using quantitative real-time PCR, we demonstrate that the proangiogenic effect of lectin is brought about through upregulation of expression of vascular endothelial growth factor (VEGF) and its receptor kinase domain receptor (KDR). Embryonic day 10 (E-10) chick embryos were used for assessing the effect of whole PVF on angiogenesis using the chick embryo CAM assay at two different concentrations (50 and 200 ng/embryo). Eggs treated with 1× PBS served as controls. Application of whole PVF resulted in increased vasculature. Quantitation of the blood vessel growth was carried out in comparable areas of control and treated CAMs by counting the primary blood vessels and secondary, tertiary, and quaternary branches emanating from the primary vessel at the site of sample application. Significant increase in the number of quaternary vessels/capillaries was observed with whole PVF treatment, suggesting its effect on microvasculature (Figure 1A−C). Whole PVF was thus found to possess pro-angiogenic activity. The whole PVF was fractionated using FPLC to obtain a major ∼27 kDa protein.5 Amino acid analysis has shown the purified 27 kDa protein to be a 221 amino acid lectin.5 Lectins are sugar-binding, cell-agglutinating glycoproteins derived from plants, animals, and microbes.6,7 Some lectins, including Gal-1, Gal-3, and Gal-9, have been reported to control numerous events in blood and vascular cells during inflammation.8 To examine if the lectin is responsible for enhanced hematopoiesis and/or angiogenesis in vivo, the CAM assay was performed using 50 and 200 ng/embryo on day 10 CAMs. Scoring of blood vessel growth and vascularization was done after 72 h.
ngiogenesis is an important biological phenomenon targeted for treating certain pathological conditions including cancer. Work on antiangiogenic therapy for cancer was initiated after Folkman’s proposition that the expansion of tumor mass beyond a size of a few cubic millimeters depends on the development of a vascular network that provides oxygen and essential nutrients.1,2 This study thus marked angiogenesis as one of the key targets in cancer research. A number of drugs are currently being developed to inhibit angiogenesis for the therapy of cancer and other vascular diseases. Therapeutic angiogenesis, on the other hand, employs several proangiogenic compounds that control the damage caused by conditions such as ischemia. Hence, the search for natural biomolecules that can either enhance or limit the formation of new blood vessels is under constant investigation. The horseshoe crab, belonging to the phylum Arthropoda, is one of the most studied invertebrate organisms.3,4 The blood of horseshoe crabs is widely used for the LAL (limulus amoebocyte lysate) test, which involves the formation of a coagulant when encountering bacterial endotoxins. Four extant species, Limulus polyphemus, Tachypleus gigas, T. tridentatus, and Carcinoscorpius rotundicauda, have been identified, and their geographical distribution is established.4 We have shown earlier that treatment of cultured chick embryos with whole perivitelline fluid (PVF) and a 27 kDa lectin, a major protein constituent obtained by fractionation of PVF from stage 19 embryos of the Indian horseshoe crab, Tachypleus gigas Müller, leads to enlargement of the heart.5 Increased hematopoiesis and blood flow was also observed in these chick embryos, pointing toward a possible pro-angiogenic effect. In the present study, we have examined the effect of PVF and the purified lectin on angiogenesis using the in vivo chick embryonic chorioallantoic membrane (CAM) assay. We find that PVF and the 27 kDa © 2013 American Chemical Society and American Society of Pharmacognosy
Received: August 24, 2012 Published: January 14, 2013 117
dx.doi.org/10.1021/np3005198 | J. Nat. Prod. 2013, 76, 117−120
Journal of Natural Products
Note
Figure 1. Induction of angiogenesis by PVF and a 27 kDa lectin of horseshoe crab embryos. Embryos were treated with whole PVF and the 27 kDa lectin on day 10, and the effect on sprouting of blood vessels was observed after 72 h. Increase in the number and size of blood vessels was observed with increased concentration of PVF (B and C) and the 27 kDa lectin (E and F) as compared to controls (A and D), suggesting a pro-angiogenic effect. Black squares represent comparable areas chosen for quantitation of blood vessels. The white * represents a blood vessel connecting the growing CAM and the embryo, and hence was not used for counting. The arrowhead represents the Whatman filter paper ring. Bar = 1 mm. Quantitation of the blood vessels was done by counting the primary vessel and the secondary, tertiary, and quaternary branches arising from the primary vessel, manually in each area, and histograms were plotted. A significant increase in the number of quaternary vessels was observed with 200 ng of PVF (G) and 200 ng of the 27 kDa lectin (H) as compared to controls. Vertical bars represent standard deviation, while * and ** denote statistical significance (p < 0.01 and p < 0.001, respectively).
Figure 2. Histological analysis of control, whole PVF-treated, and 27 kDa lectin-treated CAMs. Hematoxylin and eosin staining of serial sections of controls (A and F), whole PVF-treated (B−E), and 27 kDa lectin-treated (G and H) CAMs. An increase in the number and lumen size was observed with increased concentrations of PVF and purified lectin as compared to controls. Enlargement of the intermediate mesoderm layer (shown as an arrowhead), enriched in blood vessels, was also observed with increasing concentrations of PVF and lectin. Arrows represent blood vessel lumens. Bar = 100 μm. 118
dx.doi.org/10.1021/np3005198 | J. Nat. Prod. 2013, 76, 117−120
Journal of Natural Products
Note
Treatment with purified lectin (Figure 1E and F) resulted in increased number of capillaries as compared to controls (Figure 1D), suggesting an effect on microvasculature. Though increased quaternary vessels were observed with purified lectin, the increase in the number of vessels was comparable to CAMs treated with comparable concentrations of whole PVF. This suggests that proteins in the other six fractions may not have any significant effect on angiogenesis. Histological analysis of serial sections of controls (Figure 2A and F) and whole PVF- (Figure 2B−E) and purified lectin(Figure 2G and H) treated CAMs confirmed the proangiogenic effect of PVF and the 27 kDa lectin, as seen from an increased number and larger lumens of blood vessels. In addition, the surface area of the intermediate mesoderm layer (arrowheads in Figure 2A, D, F, H), which is rich in blood vessels, was found to be increased with increasing concentrations of PVF and lectin, further demonstrating the proangiogenic effect of PVF and the purified 27 kDa lectin. It has been reported that galectins function as an important link during VEGF- and FGF-mediated angiogenesis.9 Further, Gal-3 increases VEGFR2 density on the plasma membrane by binding to N-glycan branches. This results in increased phosphorylation in endothelial cells, thereby helping in the induction of angiogenesis.10 In order to study the influence of lectin on the expression of angiogenesis regulatory genes, VEGF, KDR, and FGF-2, CAMs were treated with 50 and 200 ng of purified lectin, and quantitative RT-PCR was performed for the genes of interest. Though no significant change was observed with FGF-2 expression, treatment of CAMs with the lectin for 24 h (Figure 3A) was found to result in a significant upregulation of VEGF and KDR, whose expression levels plateau after 72 h (Figure 3B). This effect of lectin appears quite specific, as under identical experimental conditions, expression of FGF-2 remained unaltered. The data strongly suggest that a pro-angiogenic effect of lectin and also PVF is mediated through upregulation of VEGF and its receptor, KDR, and is the underlying cause of observed enhancement of angiogenesis in the CAM assay. The present study thus demonstrates for the first time that perivitelline fluid of horseshoe crab embryos contains a 27 kDa lectin with significant pro-angiogenic activity, which is exerted through simultaneous upregulation of expression of genes encoding VEGF and its receptor.
■
Figure 3. Quantitative analysis of the expression of angiogenesis regulatory genes after treatment with the 27 kDa lectin. Upregulation of VEGF and KDR was observed with increasing concentrations of lectin after 24 h (A). No significant upregulation of VEGF and KDR was observed after 72 h incubation (B). Histograms were plotted by normalizing the values of transcript levels of VEGF, KDR, and FGF-2 with β-actin (loading control). Vertical bars represent standard deviation, while * denotes statistical significance (p < 0.01). the blunt end to puncture the air sac. A window of 1 cm square was made in the shell. Care was taken that no shell dust fell on the developing embryo. Any nonviable or unfertilized eggs were discarded. The windows were sealed with Durapore tape before eggs were returned to the incubator and kept horizontally with the window facing upward. On day 9, Whatman filter paper rings with an approximate inner diameter of 1.5 cm were placed on the CAMs and the eggs were returned to the incubator. On day 10, eggs were randomly organized into groups and different concentrations of PVF (50, 75, 150, 200, 300, and 600 ng/embryo) and purified lectin (50 and 200 ng/embryo) were placed inside the ring. Eggs treated with an equal volume of 1× PBS served as controls. After further incubation for 72 h, ice cold 4% paraformaldehyde-PBS was spread over the membrane and perfused inside such that both sides of the membrane were fixed. These embryos were left at 4 °C overnight. The CAMs were later excised and refixed in 4% ice cold paraformaldehyde-PBS for 30 min. The membranes were placed on a microscope slide, and images of control and treated CAMs were captured for comparative studies. Histology. Histological analyses of control, whole PVF-treated, and lectin-treated CAM sections were performed after hematoxylin and eosin staining.14 Paraformaldehyde-fixed membranes were washed with 1× PBS, dehydrated in a graded series of EtOH, washed with 2propanol, and cleared in xylene for 10 min. Cold infiltration was carried out three times with xylene−paraffin wax (1:1) for 30 min at room temperature followed by three changes of hot infiltration with molten paraffin wax at 60 °C. Finally the membranes were embedded individually in fresh molten paraffin wax at 60 °C. Blocks were prepared, and sections of 7 μm thickness were cut on a rotary retracting microtome. Sections were deparaffinized in xylene and gradually rehydrated in a graded series of EtOH. After a quick wash with distilled H2O, these membranes were stained with hematoxylin
EXPERIMENTAL SECTION
Collection and Fractionation of Whole PVF. Collection and fractionation of whole PVF was performed as previously described.5 Protein Estimation and SDS-PAGE. Whole PVF and purified lectin were dialyzed against sucrose to concentrate the protein using a 14 kDa cutoff dialysis tubing. This assembly was placed in an inverted position against sucrose at 4 °C until the volume was reduced to half and the protein content of whole PVF and lectin was estimated by Bradford’s method,11 with bovine serum albumin as standard and a Nanodrop spectrophotometer. The estimated protein was subjected to 12.5% SDS-PAGE to determine the size and heterogeneity of the constituent proteins. CAM Assay. The chick embryo chorioallantoic membrane assay is a unique assay to study the process of blood vessel sprouting and vessel response to both angiogenic and antiangiogenic agents.12 The assay was performed as described previously,13 with a few modifications to assess the effect of whole PVF and purified lectin on formation of new blood vessels. The surface of freshly laid white leghorn chicken (Gallus domesticus) eggs was wiped with 70% EtOH, and eggs were incubated for 4 days at 37 °C and 80% humidity. On day 4, eggs were wiped with 70% EtOH and a small hole was made at 119
dx.doi.org/10.1021/np3005198 | J. Nat. Prod. 2013, 76, 117−120
Journal of Natural Products
Note
for 30 min until the color appeared purple and differentiated with acid and alkali water. These were dehydrated in a graded series of EtOH, stained with 1% eosin, followed by a wash with distilled H2O. After dehydration, sections were cleared in xylene and mounted in depex (DPX). RNA Isolation and cDNA Synthesis. CAMs of control and treated embryos were excised, and 50−100 mg of tissue was homogenized in 1 mL of TRIZOL reagent (Invitrogen). Chloroform (200 μL) was added to the homogenate, mixed well for 15 s, and allowed to stand for 2−15 min at 4 °C. The resultant mixture was centrifuged at 13 000 rpm for 15 min at 4 °C. Total RNA was precipitated from the aqueous phase using 500 μL of 2-propanol at −20 °C for 30 min. The RNA pellet recovered after centrifugation was washed with 70% EtOH, air-dried, and dissolved in nuclease-free H2O. The integrity of RNA was checked on 1% formaldehyde agarose gel and quantified using a Nanodrop spectrophotometer. RNA (∼1−2 μg) from control, whole PVF-treated, and purified lectin-treated CAMs was used for preparation of cDNA using an Improm II cDNA synthesis kit (Promega). Quantitative Real-Time PCR. Analysis of the expression of angiogenesis regulatory genes such as VEGF, FGF-2, and VEGF receptor-2 (VEGFR2/KDR/fetal liver kinase [Flk]) was done by quantitative real-time PCR. The PCR was performed in a LightCycler carousel-based system (Roche) using LightCycler FastStart DNA MasterPLUS SYBR Green I (Roche) and primers (Table 1). The PCR
embryos. This work was supported by the Department of Biotechnology, Government of India, New Delhi. K.L.S. was a recipient of Junior and Senior Research Fellowships (NET) from the Council of Scientific and Industrial Research, New Delhi.
■
Table 1. Primer Sequences Used for Quantitative Real-Time PCR gene
primer sequence
β-actin
Fw: GTTGACAATGGCTCCGGTAT Rev: CATCGTACTCCTGCTTGCTG Fw: GGAGTTGTCGAAGGCTGCT Rev: GCGCTATGTGCTGACTCTGA Fw: CAAGTATGGCTCAACGCAGA Rev: AGGGTGTCTGTAAGGCGTGA Fw: GCACTTCAAGGACCCCAAG Rev: TCCAGGTCCAGTTTTTGGTC
VEGF
KDR
FGF-2
REFERENCES
(1) Folkman, J. N. Engl. J. Med. 1971, 285, 1182−1186. (2) Keshet, E.; Ben-Sasson, S. A. J. Clin. Invest. 1999, 104, 1497− 1501. (3) Chatterjee, A. In The Indian Horseshoe Crab − A Living Fossil; A Project Swarajya Publication: Cuttack, India, 1994. (4) Xia, X. Syst. Biol. 2000, 49, 87−100. (5) Ghaskasdbi, S.; Patwardhan, V.; Chakraborthy, M.; Agrawal, S.; Verma, M. K.; Chatterjee, A.; Lenka, N.; Parab, P. B. Cell. Mol. Life Sci. 2008, 65, 3312−3324. (6) Gul, N.; Ayvali, C. Turk. J. Biol. 2002, 26, 49−55. (7) Hamid, R.; Masood, A. Pak. J. Nutr. 2009, 8, 293−303. (8) Norling, L. V.; Perretti, M.; Cooper, D. J. Endocrinol. 2009, 201, 169−184. (9) Markowska, I.; Liu, F. T.; Panjwani, N. J. Exp. Med. 2010, 207, 1981−1993. (10) Markowska, I.; Jefferies, K. C.; Panjwani, N. J. Biol. Chem. 2011, 286, 29913−29921. (11) Bradford, M. Anal. Biochem. 1976, 72, 248−254. (12) Miller, W. J.; Kayton, M. L.; Patton, A.; O’Connor, S.; He, M.; Vu, H.; Baibakov, G.; Lorang, D.; Knezevic, V.; Kohn, E.; Alexander, H. R.; Stirling, D.; Payvandi, F.; Muller, G. W.; Libutti, S. K. J. Transl. Med. 2004, 2, 4. (13) Zilberberg, L.; Shinkaruk, S.; Lequin, O.; Rousseau, B.; Hagedorn, M.; Costa, F.; Caronzolo, D.; Balke, M.; Canron, X.; Convert, O.; Laïn, G.; Gionnet, K.; Goncalvès, M.; Bayle, M.; Bello, L.; Chassaing, G.; Deleris, G.; Bikfalvi, A. J. Biol. Chem. 2003, 278, 35564−35573. (14) Fischer, H.; Jacobson, K. A.; Rose, J.; Zeller, R. CSH Protoc. 2008, 2008:pdb.prot4986. doi: 10.1101/pdb.prot4986.
annealing temperature (°C) 59
60
61
62
conditions used were as follows: Initial denaturation at 94 °C for 4 min followed by 40 cycles of denaturation at 94 °C for 30 s, annealing for 40 s and extension at 72 °C for 50 s, and final extension of 72 °C for 10 min. Crossover points were recorded, and quantification was done by comparing the values of test samples with the standard curve. A histogram was plotted by normalizing the values of VEGF, KDR, and FGF-2 with β-actin. The data are presented as mean ± SEM (standard error of the mean), and statistical significance was calculated by Student’s paired t test.
■
AUTHOR INFORMATION
Corresponding Author
*Ph: +91 20 25673959. Fax: +91 20 25651542. E-mail:
[email protected]. Present Address †
Nimay Consulting & Services, 18 Robina Close, Basildon, SS15 4HD, UK. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS We thank Drs. V. Patwardhan and P. Parab for discussions and Dr. A. Chatterjee for his help in collection of horseshoe crab 120
dx.doi.org/10.1021/np3005198 | J. Nat. Prod. 2013, 76, 117−120
